ID: 904872887

View in Genome Browser
Species Human (GRCh38)
Location 1:33632603-33632625
Sequence GTTTTATTCTCACAAAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904872887_904872891 25 Left 904872887 1:33632603-33632625 CCTGGTTTTTGTGAGAATAAAAC 0: 1
1: 0
2: 4
3: 32
4: 323
Right 904872891 1:33632651-33632673 AACTGACAAGATCTTTCTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 132
904872887_904872892 26 Left 904872887 1:33632603-33632625 CCTGGTTTTTGTGAGAATAAAAC 0: 1
1: 0
2: 4
3: 32
4: 323
Right 904872892 1:33632652-33632674 ACTGACAAGATCTTTCTAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 150
904872887_904872888 -4 Left 904872887 1:33632603-33632625 CCTGGTTTTTGTGAGAATAAAAC 0: 1
1: 0
2: 4
3: 32
4: 323
Right 904872888 1:33632622-33632644 AAACATGCCCTCTTTCTTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904872887 Original CRISPR GTTTTATTCTCACAAAAACC AGG (reversed) Intronic
901189996 1:7404063-7404085 ATTTTATTCTCACAAATATATGG + Intronic
902196187 1:14800174-14800196 GTTTTGGGATCACAAAAACCTGG - Intronic
903276139 1:22223154-22223176 CTTTAATCCTCACAATAACCTGG - Intergenic
903317681 1:22521316-22521338 GCCTTATTCTCACAAACACCAGG + Intronic
903745418 1:25583487-25583509 TTTTTAATCCCAAAAAAACCTGG - Intergenic
904872887 1:33632603-33632625 GTTTTATTCTCACAAAAACCAGG - Intronic
905348735 1:37329786-37329808 GTTTAATTCCCAAAAAATCCTGG + Intergenic
906512954 1:46421817-46421839 GGTTTATTCTCATAATACCCAGG - Intergenic
908182325 1:61618138-61618160 ATTTTATTCTCCAAAAAACAAGG - Intergenic
908348431 1:63259903-63259925 ATTTAATCCTCACAAATACCCGG + Intergenic
909004598 1:70260186-70260208 TTCTTATACTCACAAAAATCAGG + Intergenic
909013741 1:70361801-70361823 TTTATATTCTCACAATAATCTGG + Intronic
909019230 1:70412855-70412877 ATTTGATCCTCACAACAACCAGG + Intronic
909508047 1:76417360-76417382 GTTTTATATTCAAAACAACCTGG + Intronic
909646793 1:77925961-77925983 GTTTTTTTCTCACTAAATACTGG + Intronic
910746260 1:90578347-90578369 GTTGTTTCCTCATAAAAACCAGG + Intergenic
911632440 1:100198614-100198636 ATTTGATTCTCACAAAATTCTGG - Intronic
911774756 1:101794476-101794498 GTTTGACTTTCACCAAAACCAGG - Intergenic
912164545 1:107027516-107027538 GTGTTAATCTCATAAAATCCAGG - Intergenic
912210940 1:107556463-107556485 GGTTTACTCTCACATAAATCTGG + Intergenic
912282849 1:108335338-108335360 ATTATATTCAAACAAAAACCTGG - Intergenic
912533463 1:110343461-110343483 GTTTTATTTTCCCAGACACCCGG + Intronic
912539813 1:110405941-110405963 CTTTAATTTTCACAACAACCCGG - Intronic
915063028 1:153202446-153202468 CTTTTCTTTTCTCAAAAACCTGG + Intergenic
915826286 1:159081234-159081256 ATTTTATTCACACAAATAACAGG - Intronic
916389673 1:164318307-164318329 ATTTGATTTTCACAATAACCTGG - Intergenic
917291969 1:173479432-173479454 TTTTTCTTCTCAAAAATACCTGG - Intronic
917454544 1:175174846-175174868 GTTTTATTAGCACTAATACCAGG - Intronic
918600694 1:186356306-186356328 ATTTTATTGTCACAAACAACAGG - Exonic
919192533 1:194242117-194242139 GAATTATTCTCACAAAAATATGG - Intergenic
1065648944 10:27866982-27867004 TTTTTTTTCTCAAGAAAACCGGG + Intronic
1066028654 10:31393629-31393651 TTTTTAATGTCACGAAAACCAGG - Intronic
1067401227 10:45975638-45975660 CTTTTTTCCTCACAAACACCAGG + Intronic
1067423030 10:46174489-46174511 GTTTTATTCTCCCATAAGGCTGG - Intergenic
1067431022 10:46245975-46245997 ATTTCATTCTCACAACACCCAGG - Intergenic
1067442385 10:46316253-46316275 ATTTCATTCTCACAACACCCAGG + Intronic
1067869579 10:49945216-49945238 CTTTTTTCCTCACAAACACCAGG + Intronic
1068193055 10:53678783-53678805 GTTTTATTGTCAGAATATCCAGG + Intergenic
1068286490 10:54943808-54943830 ATTTTACTCTCAGAAAAGCCTGG - Intronic
1071957540 10:90775602-90775624 GTTTTATTCTAAGAAAGCCCTGG + Intronic
1074129854 10:110564419-110564441 CTTTTCTTTTCTCAAAAACCCGG - Intergenic
1074781387 10:116804679-116804701 GTTTTAATCTTATAACAACCAGG - Intergenic
1076602344 10:131666878-131666900 GTTTTGCTCACACGAAAACCTGG + Intergenic
1076800933 10:132827843-132827865 GTTTCATTTTTACAAAAGCCTGG - Intronic
1077814005 11:5667599-5667621 GTTTTATTCTAATTAAACCCAGG + Intronic
1079056262 11:17208572-17208594 GTTTCATCCTCACAACAGCCAGG + Intronic
1079425528 11:20338620-20338642 ATTTGCTTCTCACAAAAAGCTGG + Intergenic
1079766064 11:24394811-24394833 GTCTTATTCTCAGGAATACCAGG - Intergenic
1080496374 11:32824570-32824592 GTTTCATTCACTTAAAAACCAGG + Intergenic
1080545439 11:33312823-33312845 GTTTTATTGTCACAATAATCTGG + Intronic
1080902869 11:36511928-36511950 ATTTTATACTGACAAAAGCCTGG - Intronic
1082896226 11:58193068-58193090 CATTTATTCTCACAATAACTTGG + Intergenic
1085565138 11:77506789-77506811 CTGTTATTCTCTCAGAAACCTGG - Intergenic
1085590941 11:77759820-77759842 ATTTAATTCTCACCACAACCTGG - Intronic
1085968428 11:81557085-81557107 TTTTTATTCTCACATGAAACAGG + Intergenic
1086351301 11:85944819-85944841 GTTTTGCACTCCCAAAAACCAGG - Intergenic
1087698480 11:101408624-101408646 TTTTTATTCTCACAATAAGAGGG + Intergenic
1093156440 12:15691725-15691747 ATTTTAGTCTCACAAAAATGTGG - Intronic
1094826693 12:34275076-34275098 CTTTTGTTCTCACAGAATCCTGG - Intergenic
1095667683 12:44821168-44821190 ATTTTGTTCTCACAAAGCCCTGG + Intronic
1095935987 12:47681967-47681989 TTTTTATTCTCACCAAATCCTGG + Intronic
1096424294 12:51488201-51488223 CTTTTCTTCTCTCAAAAACCTGG - Intronic
1096691368 12:53324148-53324170 GTTGGATTCTCATAAAAAGCGGG + Intronic
1096928557 12:55176719-55176741 CTTTTCTTTTCTCAAAAACCTGG + Intergenic
1097925246 12:65120556-65120578 GTTTTATTATTTTAAAAACCAGG - Exonic
1098314214 12:69176543-69176565 CTTTTCTTTTCTCAAAAACCTGG + Intergenic
1098473542 12:70873018-70873040 ATTTTTTTCTCATAAAAATCAGG - Intronic
1098607007 12:72403453-72403475 ATTTCATTCTCACAGCAACCTGG + Intronic
1098607395 12:72408334-72408356 GTTTAATAATCACAAAAGCCAGG - Intronic
1098763313 12:74452837-74452859 GTATTAGTGTCATAAAAACCAGG - Intergenic
1099177978 12:79443812-79443834 TTTTTATTCCCACAAAGAGCTGG + Intronic
1099537952 12:83868228-83868250 TTTTTATTCTGATTAAAACCTGG + Intergenic
1099922395 12:88975265-88975287 GTTTTATTCTAGCAAAAGACTGG - Intergenic
1100038634 12:90283260-90283282 ATTTTATTATGACAAAAACTAGG + Intergenic
1100140764 12:91616189-91616211 GTTTTAATGTCAAAAAATCCAGG + Intergenic
1100190785 12:92189219-92189241 GTTCTATTATCACAAAAAGGGGG - Intergenic
1103059141 12:117844844-117844866 CTTTTCTTTTCTCAAAAACCTGG + Intronic
1104916378 12:132266957-132266979 GTTTTATTCTCAGAGACGCCAGG - Intronic
1105268821 13:18850369-18850391 GTTTTATTTTTACAGAAACCAGG - Intergenic
1106667088 13:31863418-31863440 GTGTTATTCTGATAAACACCAGG - Intergenic
1107805887 13:44153643-44153665 GTGTTTTTCTCACAAAGGCCTGG - Intronic
1108560524 13:51639062-51639084 TTTTTATTGTCACAAAATCAAGG + Intronic
1109463945 13:62702280-62702302 GTTTTATTTTCAGAAAAAGTGGG + Intergenic
1110019769 13:70455730-70455752 GTTCTATTATCCCAGAAACCAGG + Intergenic
1110052301 13:70919636-70919658 ATTTTATTCTCAAAAATACTGGG - Intergenic
1110055285 13:70961753-70961775 GTTTTCTTCTCACAAAAAGCAGG + Intergenic
1110158599 13:72348787-72348809 TTTTTAATCTCACAAAATTCTGG + Intergenic
1111850538 13:93567753-93567775 GTTTTATTCTAACAATAAATAGG - Intronic
1112473035 13:99706516-99706538 GTTTTGGTCTCAGAAAAACAGGG - Intronic
1114803052 14:25800164-25800186 GTTTTATTTTCACAAATCCTTGG + Intergenic
1117356806 14:54932060-54932082 TTTTTTTGCTCTCAAAAACCTGG + Intergenic
1118179883 14:63481862-63481884 TTTTTATTCTGACAAAATTCTGG + Intronic
1118184830 14:63527608-63527630 GTTTTCTTCTCTCTAAAACTGGG - Intronic
1118532615 14:66723645-66723667 GTTTTATTCTCATAAATATCTGG + Intronic
1119670668 14:76515824-76515846 GTCTTTTTCTCACAGAAAACAGG - Intergenic
1122059265 14:99125759-99125781 GTTTTATTCTTACAACATCTAGG + Intergenic
1122231774 14:100309706-100309728 CTTTTATTCTCACACAAGACAGG + Intergenic
1202830483 14_GL000009v2_random:23587-23609 ATTTTATTTTTACAGAAACCAGG + Intergenic
1125011361 15:34879611-34879633 TTTTTTTTCCCTCAAAAACCTGG + Intronic
1126186791 15:45838569-45838591 GTTTTATTCTAACAAAAGATTGG + Intergenic
1126620948 15:50639073-50639095 ATTTTATTCTCACTAAGACTAGG - Intronic
1126657635 15:50996398-50996420 ATTTTATTAACACAAAAACAAGG - Intronic
1127651933 15:61017653-61017675 GTTTCTTTCTAACAAAAACCAGG + Intronic
1135065122 16:19303116-19303138 ATTTCGTTCTCACAACAACCAGG - Intronic
1135894900 16:26390613-26390635 TTTTTATTCTGACAAAATCCAGG - Intergenic
1135902014 16:26469218-26469240 CTTTAATTCTTACAATAACCAGG - Intergenic
1138710849 16:58969025-58969047 GTTTTATTCTCCATAAAACCTGG - Intergenic
1139276960 16:65736727-65736749 GTTTCATCCTCACAATAAACAGG + Intergenic
1139611943 16:68065437-68065459 GTTTTATCCTCCCAAAGTCCTGG - Intronic
1140283276 16:73575193-73575215 GTTCTATTCTCACATATTCCAGG - Intergenic
1140715635 16:77723043-77723065 ATTTTATCCTCACAACAGCCCGG - Intronic
1141804334 16:86332740-86332762 ATTTAATCCTCACAACAACCCGG - Intergenic
1142836530 17:2591984-2592006 CTGTAATTCTCACAAAAGCCGGG + Intergenic
1143281810 17:5760072-5760094 GTTTTCTTTTCTCAAAAATCTGG + Intergenic
1144805503 17:17963908-17963930 ATTTAATCGTCACAAAAACCTGG + Intronic
1148073159 17:44920469-44920491 ATTTTATTCTTACAACTACCTGG - Intergenic
1148353686 17:46959536-46959558 GTGTTTTTTTCCCAAAAACCTGG - Intronic
1149359000 17:55873312-55873334 CTTTTCTTTTCTCAAAAACCTGG - Intergenic
1150254529 17:63733332-63733354 ATTGTATTCTGACAAATACCAGG - Intronic
1150558210 17:66272713-66272735 GTTTAATTCCCACAACAGCCCGG + Intergenic
1150940796 17:69692020-69692042 ATTTAATCCTCACAATAACCAGG - Intergenic
1153810181 18:8745568-8745590 GTTTTGTAATAACAAAAACCTGG - Intronic
1154419203 18:14209628-14209650 GTTTTATTTTTACAGAAACCAGG + Intergenic
1154495867 18:14960439-14960461 GTTTTATTTTTACAAAAGGCGGG + Intergenic
1156181346 18:34608697-34608719 CTTTTATTCTCACAAAGAGATGG - Intronic
1156232965 18:35172970-35172992 GTTTTATTCTCAGTAAAATGAGG - Intergenic
1157169644 18:45390786-45390808 GTATAATGCTCACAATAACCAGG + Intronic
1158385405 18:56984556-56984578 GTTTTACTCACAAAAAAACTTGG + Intronic
1159258931 18:65986025-65986047 ATTTTATTCTCACATTTACCAGG + Intergenic
1159336791 18:67078067-67078089 TATTTATTCTGACAAAAACATGG + Intergenic
1159791224 18:72781516-72781538 GTTTTAATCTGACATAAAGCTGG + Intronic
1160166835 18:76520994-76521016 GTCTTATTCTCAGTAAAACTGGG + Intergenic
1162768620 19:12935688-12935710 ATTTAATTCTCACAGTAACCTGG - Intergenic
1162906677 19:13828106-13828128 GTTTACTTCTCACAACAATCAGG + Intronic
1163181300 19:15605720-15605742 GCTGTAGTCTCAAAAAAACCTGG + Intergenic
1165185534 19:34017705-34017727 GTTTTGTTGTCTCAAAAAGCAGG - Intergenic
1168584524 19:57582289-57582311 GTTTGCTTTTCTCAAAAACCTGG - Intronic
1202642211 1_KI270706v1_random:104192-104214 ATTTTATTTTTACAGAAACCAGG - Intergenic
925039888 2:724065-724087 GTTTAATTCTCACAGCACCCTGG - Intergenic
925770480 2:7277709-7277731 CTTATGTTCACACAAAAACCGGG - Intergenic
925819849 2:7789529-7789551 GTTGTATTCTCTCCAAAGCCAGG - Intergenic
926212002 2:10878241-10878263 ATTTTATTTTCACAAACATCTGG + Intergenic
926600010 2:14832336-14832358 GTTCTTTTCTCACAAAGACCAGG + Intergenic
926856863 2:17266192-17266214 TCTTTATACTCACCAAAACCAGG - Intergenic
926946087 2:18188932-18188954 TTTTTATATTCACAAAACCCAGG + Intronic
927164449 2:20303167-20303189 CTTTTCTTTTCTCAAAAACCTGG + Intronic
928094727 2:28397136-28397158 GTTTTCTTCTAAATAAAACCTGG + Intronic
930590127 2:53317287-53317309 GTTTAATTCTCAAAACAACCTGG + Intergenic
930730112 2:54720839-54720861 TTTTATTTCTCACAAAAACCTGG - Intergenic
930746923 2:54894351-54894373 GATTAATTTTTACAAAAACCTGG - Intronic
931067189 2:58600093-58600115 TTTTTTTTCTCAGAAATACCTGG + Intergenic
936021649 2:108999771-108999793 TTTTTATTATTACAAAAACATGG + Intergenic
936756385 2:115717836-115717858 GTTTTATTATCTCAAAATTCAGG + Intronic
938993776 2:136656266-136656288 CTTTAATTCTCACCAAAACTGGG - Intergenic
940638654 2:156327007-156327029 GTTTAATTGTTATAAAAACCTGG - Intronic
942144064 2:173008336-173008358 ATTTGATTTTCACAACAACCTGG - Intronic
942389383 2:175476358-175476380 CATTAATTCTCACAACAACCTGG + Intergenic
943032740 2:182704858-182704880 GTTTTAACCTCACAAAGCCCTGG + Intergenic
943311500 2:186331019-186331041 GTTTTATAATCATAATAACCAGG + Intergenic
944317741 2:198301413-198301435 ATTTTATCCTCACAATAACAAGG + Intronic
945125500 2:206505339-206505361 ATTTTGTTCTCACAGCAACCGGG + Intronic
945437975 2:209841281-209841303 TTTCTAATCTCACTAAAACCAGG + Intronic
945516198 2:210765928-210765950 GTTTTATTTGCAGAAAAAACTGG + Intergenic
945633827 2:212320801-212320823 ATTTGATTCTCACAACAACACGG - Intronic
945786772 2:214249289-214249311 TTTTTATGTTCACAAAAATCTGG - Intronic
946687443 2:222284818-222284840 ATTTCATTCTCACAGAATCCTGG + Intronic
948037668 2:234872460-234872482 ATTTAATTCTCACAGTAACCCGG + Intergenic
948329051 2:237150763-237150785 CTTTTATTCTCACAACCGCCTGG + Intergenic
1169352093 20:4876456-4876478 TTTTTATTCTCAAATACACCTGG + Intronic
1169898850 20:10533153-10533175 GTTTTATTTGCACAAATACAAGG - Intronic
1169903871 20:10580737-10580759 TTTTCATTCTGTCAAAAACCAGG - Intronic
1171223719 20:23423150-23423172 GTTTTATTCTCCCAAAGGCTGGG + Intergenic
1171889317 20:30694365-30694387 GTTTTATTTTTACAGAAACCAGG - Intergenic
1172391889 20:34571066-34571088 GTTTCCTTATCTCAAAAACCGGG - Intronic
1174573606 20:51521823-51521845 ATTTGATTCTCACAGAAACTTGG - Intronic
1174956063 20:55100056-55100078 GTCATATTCTCACAAAAACCAGG - Intergenic
1176609669 21:8868425-8868447 ATTTTATTTTTACAGAAACCAGG + Intergenic
1176854103 21:13949665-13949687 ATTTTATTTTTACAGAAACCAGG - Intergenic
1177300150 21:19233690-19233712 ACTTTATTCTCACCAAAAACTGG - Intergenic
1178115786 21:29415040-29415062 GTTCTATTCACCCAAACACCAGG - Intronic
1178844717 21:36165145-36165167 TTTTTATGCTCAGAAAAAGCTGG - Intronic
1179276740 21:39898830-39898852 ATTTTATCCTCACAACAACTTGG - Intronic
1179327097 21:40358202-40358224 GTTTTATTCTAACTGAAACTTGG + Intronic
1179819176 21:43926480-43926502 GTTTCATTCTCACAGAGAACAGG + Intronic
1179904361 21:44414585-44414607 CTTTTCTTTTCTCAAAAACCTGG - Intronic
1180359724 22:11877662-11877684 ATTTTATTTTTACAGAAACCAGG + Intergenic
1180988092 22:19917409-19917431 GTTTTGTGCTCACTAAATCCAGG - Intronic
1181855190 22:25776285-25776307 GTTTTAGTCCCAGGAAAACCAGG - Intronic
1182494640 22:30697209-30697231 GTTTTACTTCCACTAAAACCAGG - Intronic
1183752381 22:39729028-39729050 CTTTAATTCTCACAATAACCAGG + Intergenic
1184275536 22:43407589-43407611 GTTTATTTCTCACAACAGCCTGG - Intergenic
1184542501 22:45136893-45136915 ATTTTATTCTCAGAAAAAAATGG + Intergenic
949528706 3:4932303-4932325 TTTTTTTTCTCACCAAGACCAGG - Intergenic
951505134 3:23436451-23436473 GTTGTATTCTCATAGAAAACTGG + Intronic
951804210 3:26626898-26626920 CTGTTATTTTCACAAATACCTGG - Intronic
951918690 3:27829285-27829307 GGTATATGCTCACAAAAAGCAGG + Intergenic
952203792 3:31158795-31158817 GTTTTATTGTCACATAAATAGGG + Intergenic
952803740 3:37324451-37324473 GTTAGATGCTCACAAAATCCAGG + Exonic
952920438 3:38280313-38280335 CTTTTCTTTTCTCAAAAACCCGG + Intergenic
954702835 3:52460259-52460281 GTTTTATTTTCCCAAAGAGCTGG - Intronic
954926438 3:54239867-54239889 ATTTTATTCTCATAGAAACTAGG - Intronic
956095639 3:65713162-65713184 GTTTTATGCCCACAAACAGCAGG - Intronic
956300661 3:67768928-67768950 AATATATCCTCACAAAAACCTGG - Intergenic
957238000 3:77619871-77619893 ATTTCATTCTCACAAAAACTAGG - Intronic
959174174 3:102884505-102884527 GTTTTATTCTCTCCAAAATGGGG - Intergenic
959174654 3:102891326-102891348 GTTTTATTCTCTCCAAAATGGGG + Intergenic
959359941 3:105375749-105375771 ATTTTTTTCTTAAAAAAACCAGG + Intronic
959518125 3:107293214-107293236 CTTATATTCACACAAAAACCTGG - Intergenic
959643628 3:108671316-108671338 GTTTTATTATCAGAAACACTTGG - Intronic
962204423 3:133423351-133423373 ATTTAATTCCCACAACAACCCGG - Intronic
962724665 3:138211797-138211819 ATTTAATTCTCACATCAACCTGG - Intronic
962773328 3:138634217-138634239 GTCTTAGTATCAGAAAAACCTGG - Intergenic
963536350 3:146533830-146533852 GTTTTATTATCAACAAAACATGG - Intronic
965316550 3:167198350-167198372 GTTTTATTGTCACAGACACATGG + Intergenic
966308842 3:178570764-178570786 TTTTTATTCTCACAAAAATGGGG + Intronic
967438585 3:189479816-189479838 AATTTACTCTCACAAACACCAGG - Intergenic
967668282 3:192200891-192200913 TTTTTTTTCACACAAAAGCCTGG - Intronic
1202736350 3_GL000221v1_random:3199-3221 ATTTTATTTTTACAGAAACCAGG + Intergenic
969145135 4:5115951-5115973 TTTACATTCTTACAAAAACCTGG - Intronic
970610105 4:17717196-17717218 ATTTGATCCTCACAAAAACTGGG - Intronic
970765380 4:19542108-19542130 GTTTTATACTCTTAAAAACTAGG - Intergenic
970943968 4:21668338-21668360 TTTTTCTTCTAAAAAAAACCGGG - Intronic
971017323 4:22501744-22501766 GTTTTATAATCACAAAAAAATGG + Intronic
971018397 4:22511061-22511083 GTGTTAGTCTGAGAAAAACCTGG + Intronic
971080168 4:23201072-23201094 GTTCTATCCTTACAAATACCGGG + Intergenic
971347053 4:25821268-25821290 GGTTTATTCTGAGAAAAACAGGG - Intronic
971770122 4:30884965-30884987 GTTTTATTCTTACATGAAACAGG - Intronic
971812448 4:31444159-31444181 GTTTAATTCTTACAATAACTGGG + Intergenic
972293711 4:37716284-37716306 ATTTTATCCTCACAACAACCTGG + Intergenic
973243809 4:47988314-47988336 TTTTTTCTCTCACAAAAAACAGG + Intronic
974697161 4:65390801-65390823 GTTTTAATCTCACAGAAAAATGG - Intronic
974731317 4:65870010-65870032 CTTTAATTCTTACAAAATCCAGG - Intergenic
975943794 4:79680304-79680326 TTGTAATTCTCTCAAAAACCTGG - Intergenic
976501881 4:85800284-85800306 GATTCATTGTCACAATAACCTGG - Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
978075049 4:104518102-104518124 CTTTAGTTCTCACTAAAACCCGG - Intergenic
978967964 4:114765788-114765810 GTTTTATTGTCACAAAGAGAAGG + Intergenic
980711727 4:136577765-136577787 GTATTATTCTCTCAAATAACAGG + Intergenic
981330258 4:143500024-143500046 ATTTTTCTCTCACCAAAACCTGG + Intergenic
982217050 4:153091596-153091618 AATTTATTCTCTCACAAACCTGG + Intergenic
982748491 4:159131041-159131063 GTATTATTTTCAAATAAACCTGG - Intronic
984218431 4:176943496-176943518 TTTTTTTTCCCACAGAAACCAGG + Intergenic
985126557 4:186700774-186700796 ATTTAATTCTCACAACCACCGGG - Intronic
1202769583 4_GL000008v2_random:190067-190089 ATTTTATTTTTACAGAAACCAGG - Intergenic
985987104 5:3524972-3524994 GTTTTATTTGGACAAACACCAGG - Intergenic
986224703 5:5801800-5801822 GATTTATTCTCACACATATCTGG + Intergenic
986864333 5:11967893-11967915 CTTATATTCTCACAAACACATGG + Intergenic
988211146 5:28205431-28205453 GTTTTATTTTAACAAACAGCAGG - Intergenic
995013857 5:107288274-107288296 TTTTTATTTTCTAAAAAACCTGG - Intergenic
995433279 5:112106331-112106353 CTTTTCTTTTCTCAAAAACCTGG - Intergenic
996826832 5:127692346-127692368 ATTTTATTCTCACATAAAGGAGG + Intergenic
997488995 5:134256900-134256922 TTTTTATTCTTACAAAAAAGAGG + Intergenic
998137852 5:139683838-139683860 GTTTTATTCACAAAACAGCCTGG - Exonic
998305627 5:141073224-141073246 GTTTTATTTTCTAAAAGACCTGG + Intergenic
998655020 5:144169205-144169227 GTATTTTTGTCACAAACACCAGG + Intronic
998831596 5:146165414-146165436 GTTTTAGTCTCCCAAATAGCTGG - Intronic
1000154476 5:158536905-158536927 GTTATTTTCTCTCATAAACCAGG + Intergenic
1000190374 5:158904537-158904559 GTTTTATTTTCACAAAATGTGGG - Intronic
1002894768 6:1371011-1371033 GCTTTAGAGTCACAAAAACCAGG + Intergenic
1003157286 6:3607512-3607534 GTTTTACTCTCAGAACAGCCTGG + Intergenic
1003456639 6:6289064-6289086 TTTTTATTCTCACAATAAACTGG - Intronic
1003879100 6:10464294-10464316 GTCTTCTTCTCACTGAAACCTGG + Intergenic
1004213064 6:13672133-13672155 ATTTTACTCTAATAAAAACCAGG - Intronic
1004504467 6:16237150-16237172 CTTTAATTCTCACAAAAACCAGG + Intergenic
1006201325 6:32294556-32294578 ATTTGATACTCACAACAACCAGG + Intronic
1006563064 6:34930488-34930510 GTTTTATTCTTCCAAATCCCAGG + Intronic
1008279191 6:49575569-49575591 GTGTTTTTCTTACAAAATCCTGG + Intergenic
1008917372 6:56803094-56803116 ATTTGATTCTCACAAAAATCAGG + Intronic
1009275045 6:61665393-61665415 CTTGCATTCTCAGAAAAACCAGG + Intergenic
1011217604 6:85021418-85021440 GTTTAATCCTCACAAAACCTGGG + Intergenic
1014522070 6:122456625-122456647 TTCTCATTCTCACAAAATCCAGG + Exonic
1014597575 6:123364203-123364225 GTTTTCTTCTAACAATATCCAGG + Intronic
1014850918 6:126338877-126338899 CTTTTATCCTCACACTAACCTGG - Intergenic
1015129939 6:129797626-129797648 TTTTTATTTTCAGAGAAACCTGG + Intergenic
1016754928 6:147674463-147674485 GTTTTTTTCTCACTAAAATCTGG + Intronic
1017238011 6:152137508-152137530 GGTTTGATTTCACAAAAACCAGG + Intronic
1017416113 6:154222617-154222639 GTTTCCTTCTCAGGAAAACCAGG + Intronic
1017455833 6:154600559-154600581 GTTTTGTTCTCACAAATATTGGG - Intergenic
1019935110 7:4249649-4249671 GCTTTATCCACTCAAAAACCTGG - Intronic
1020610038 7:10384355-10384377 TATTTAGTCTCACAAAAATCAGG + Intergenic
1020951628 7:14686048-14686070 GTTTTAATCTCACAGAAAGATGG + Intronic
1021189206 7:17601228-17601250 ATTTAATCCTCACAATAACCTGG + Intergenic
1021261974 7:18469714-18469736 TTTTTATTTTCACAATAACTAGG - Intronic
1021342527 7:19481898-19481920 GTTTTATTCTCATATTTACCTGG + Intergenic
1021406406 7:20272301-20272323 ATTTGCTTCTCACAAAAACTAGG - Intergenic
1021796876 7:24264412-24264434 GTTTTATTCTCAGTAAAATAAGG + Intergenic
1022677448 7:32513156-32513178 CTTTTCTTTTCTCAAAAACCTGG + Intronic
1023857889 7:44196347-44196369 ATTTAATCCTCACAAAAACAGGG - Intronic
1024193249 7:47033961-47033983 GTTTTATTCTCTTAACAATCTGG - Intergenic
1026142075 7:67714784-67714806 ATTGGATTCTCACAGAAACCTGG - Intergenic
1026438731 7:70424042-70424064 ATTTAATTCTCACAAAAATCCGG + Intronic
1026449671 7:70516623-70516645 ATTTAATCCTCACAATAACCAGG - Intronic
1026506667 7:70990381-70990403 GTTCTTTTCTCACAAAACCATGG + Intergenic
1027474565 7:78613053-78613075 GTTTTATTCACACAAACTTCAGG + Intronic
1027721693 7:81750654-81750676 ATCATATTCTCACAAGAACCAGG + Intronic
1028638499 7:93017196-93017218 GTGTTTTTCTCACAAAAGACAGG + Intergenic
1031652686 7:124310410-124310432 GATTTATTGTCACAAAAGCAAGG + Intergenic
1032945335 7:136845563-136845585 GTTTTATGCTTACAAAAAGAAGG - Intergenic
1034070261 7:148177630-148177652 GTTTAATCCTCACCACAACCTGG + Intronic
1035302900 7:157908688-157908710 GTCTTATTCTTACAAAAATATGG + Intronic
1036580560 8:10070967-10070989 CTTATGTTCACACAAAAACCTGG - Intronic
1036800220 8:11785573-11785595 ATTTAATGCTCACAAAAACCAGG + Intronic
1036801872 8:11798577-11798599 GTTTTGTAATCACAAAATCCAGG - Intronic
1038753947 8:30323472-30323494 GTTTTTTTCTGACAAAAAAAAGG + Intergenic
1038757547 8:30355870-30355892 GTTTTATTGTCACTTAAATCAGG + Intergenic
1038812946 8:30869749-30869771 CTTTTCTTTTCTCAAAAACCCGG + Intronic
1039925301 8:41925790-41925812 GCTTTATTTTCACAATAACAAGG + Intergenic
1040365333 8:46709442-46709464 GATTTTTTTTCACAAAAATCTGG - Intergenic
1042185333 8:66131165-66131187 CTTTAATTCTCACAATAATCCGG + Intronic
1042752520 8:72173801-72173823 GTTTTATTCTCTTGCAAACCAGG - Intergenic
1043778997 8:84307855-84307877 GTTTGTTTCTCACAAAAAAAGGG + Intronic
1044107736 8:88232861-88232883 GTTTTAAACTCACCAAAAGCAGG - Intronic
1044371612 8:91418787-91418809 CTCTTATTCTCACAAAAACCGGG - Intergenic
1046934358 8:119872409-119872431 ACTTTATCCTCACAAAACCCTGG - Intergenic
1047810810 8:128406837-128406859 GTTTTATTCTCAGTAACACAAGG - Intergenic
1048621085 8:136133563-136133585 ATTTAATTTTCACATAAACCAGG - Intergenic
1049328274 8:142035301-142035323 ATTTTCTCCTCACCAAAACCTGG - Intergenic
1050166167 9:2766997-2767019 GATATATTCTCACATAAACTAGG - Intronic
1050363312 9:4851772-4851794 GTTTTATACACACGAAAAACAGG - Intronic
1052095751 9:24381630-24381652 GTTTTGTTCTGACAAATTCCAGG + Intergenic
1052825621 9:33172107-33172129 CTTTTCTTTTCTCAAAAACCAGG - Intergenic
1053248831 9:36557657-36557679 ATTTAATTCTCACAACACCCAGG + Intergenic
1053659109 9:40252823-40252845 GTTTTATTTTTACAGAAACTGGG + Intronic
1053909478 9:42882190-42882212 GTTTTATTTTTACAGAAACCAGG + Intergenic
1054360140 9:64105593-64105615 GTTTTATTTTTACAGAAACCAGG + Intergenic
1054371232 9:64399125-64399147 GTTTTATTTTTACAGAAACCGGG + Intronic
1054525490 9:66123399-66123421 GTTTTATTTTTACAGAAACTGGG - Intronic
1054678858 9:67888842-67888864 GTTTTATTTTTACAGAAACCGGG + Intronic
1055325177 9:75121168-75121190 ATTTAATTCTCACTAAAACCTGG - Intronic
1055839691 9:80488281-80488303 GTTTTATCCTCCCAAGAAACAGG - Intergenic
1055851218 9:80632456-80632478 GTTTTATTCTGGGAAAAATCTGG + Intergenic
1060029986 9:120205994-120206016 GTTTAATCTTCACAACAACCTGG - Intergenic
1060068761 9:120528347-120528369 GTTTGATCCTCACAACAGCCCGG - Intronic
1060911461 9:127354468-127354490 TTTTTATTTTCAGTAAAACCTGG - Intronic
1061538515 9:131264547-131264569 ATTTAATCATCACAAAAACCGGG - Intronic
1203705079 Un_KI270742v1:33638-33660 ATTTTATTTTTACAGAAACCAGG + Intergenic
1185831613 X:3308560-3308582 ATAATATTCTCCCAAAAACCGGG - Exonic
1185895152 X:3851827-3851849 TTTTTTTTCTAACAAATACCTGG - Intergenic
1185900270 X:3890252-3890274 TTTTTTTTCTAACAAATACCTGG - Intergenic
1185905386 X:3928683-3928705 TTTTTTTTCTAACAAATACCTGG - Intergenic
1185928292 X:4171680-4171702 GTTTTCTTCTCCTGAAAACCTGG + Intergenic
1186079255 X:5912756-5912778 GTCTTATTCACAGGAAAACCTGG - Intronic
1187659225 X:21520341-21520363 CTCTTATTCTAAGAAAAACCAGG + Intronic
1188735835 X:33714280-33714302 CTTTTATTTTCACTTAAACCTGG - Intergenic
1188962730 X:36512560-36512582 GCTTTATCCTCACAAAGAACAGG + Intergenic
1189057998 X:37719852-37719874 GTTTTTTTCTTACAAATACCTGG - Intronic
1189773987 X:44453832-44453854 ATTTTTTTCCAACAAAAACCAGG - Intergenic
1190636277 X:52437023-52437045 ATTTTATTCTTACAATTACCTGG + Intergenic
1191743082 X:64456407-64456429 GTTTCATCATCACAAAAACTTGG + Intergenic
1191998591 X:67123767-67123789 ATTTAACTCTCACAAAACCCTGG - Intergenic
1192038097 X:67587804-67587826 TTTTCATTCTCACAAAAATCAGG - Intronic
1195145411 X:102009991-102010013 CTTTTATTCTTAAAAAAAGCAGG + Intergenic
1195860539 X:109378161-109378183 ATTTAATCCTCACAAAAATCTGG + Intronic
1197086184 X:122478506-122478528 ATTTTATCCTCATAAAATCCAGG - Intergenic
1198056295 X:132998774-132998796 GATTTATTGTCACAAAAAGCAGG - Intergenic
1198149240 X:133891993-133892015 ATTTAATTCTCATAACAACCTGG - Intronic
1199069696 X:143462084-143462106 GTTTCATCCTTACAACAACCTGG - Intergenic
1199273818 X:145919229-145919251 TTTGTATACACACAAAAACCTGG + Intergenic
1200926068 Y:8656005-8656027 GTTTTGTTCTCTGAAATACCTGG - Intergenic
1201244380 Y:11988566-11988588 AATATATTCTCCCAAAAACCTGG + Intergenic