ID: 904872917

View in Genome Browser
Species Human (GRCh38)
Location 1:33633196-33633218
Sequence GGGGCGGTGTAGACACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904872910_904872917 3 Left 904872910 1:33633170-33633192 CCAACAGGAGAAGGCTACACCAC 0: 1
1: 0
2: 1
3: 4
4: 84
Right 904872917 1:33633196-33633218 GGGGCGGTGTAGACACAGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904872917 Original CRISPR GGGGCGGTGTAGACACAGTC TGG Intronic