ID: 904873833

View in Genome Browser
Species Human (GRCh38)
Location 1:33638219-33638241
Sequence CTCCATATGCCTAGTGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904873832_904873833 -4 Left 904873832 1:33638200-33638222 CCTTTATCAAATCTGTCTTCTCC 0: 1
1: 0
2: 4
3: 53
4: 518
Right 904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 101
904873830_904873833 5 Left 904873830 1:33638191-33638213 CCTTGACCTCCTTTATCAAATCT 0: 1
1: 0
2: 0
3: 26
4: 260
Right 904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 101
904873831_904873833 -1 Left 904873831 1:33638197-33638219 CCTCCTTTATCAAATCTGTCTTC 0: 1
1: 0
2: 1
3: 27
4: 316
Right 904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 101
904873828_904873833 19 Left 904873828 1:33638177-33638199 CCCGTGATGCATTGCCTTGACCT 0: 1
1: 0
2: 0
3: 15
4: 148
Right 904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 101
904873826_904873833 29 Left 904873826 1:33638167-33638189 CCTCATGTGCCCCGTGATGCATT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 101
904873829_904873833 18 Left 904873829 1:33638178-33638200 CCGTGATGCATTGCCTTGACCTC 0: 1
1: 0
2: 0
3: 8
4: 143
Right 904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 101
904873827_904873833 20 Left 904873827 1:33638176-33638198 CCCCGTGATGCATTGCCTTGACC 0: 1
1: 0
2: 0
3: 18
4: 357
Right 904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904873833 Original CRISPR CTCCATATGCCTAGTGTCTC TGG Intronic
903188680 1:21644096-21644118 CTCCACATGCGTTGTGGCTCTGG - Intronic
903539350 1:24088098-24088120 CTCCATCTGCCCAGAGACTCGGG - Intronic
904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG + Intronic
905008538 1:34730818-34730840 CACCATTTGCCCAGTGGCTCGGG + Intronic
908167770 1:61475203-61475225 CTGCAAATCCCTGGTGTCTCTGG + Intergenic
909725045 1:78824746-78824768 CTCCATTTGTATAGTTTCTCAGG + Intergenic
911716453 1:101138973-101138995 AGCCATATGCCCAGAGTCTCTGG + Intergenic
912164737 1:107029782-107029804 ATCCATAGTCCTAGTGTCACTGG + Intergenic
915498045 1:156295007-156295029 CTCCATGTTCCAGGTGTCTCTGG - Exonic
916462494 1:165041281-165041303 CTCCAAATGTCTTGTGTTTCAGG - Intergenic
916847800 1:168670989-168671011 CTCCATATGGCTGGAGTCTTGGG + Intergenic
919645808 1:200093545-200093567 CTCAATATTCATAGTTTCTCTGG - Intronic
919925628 1:202190476-202190498 CTCCATATGCCATGTTTATCAGG + Intergenic
922905675 1:229171891-229171913 CTACCTATGCCTATTGACTCTGG - Intergenic
1063927588 10:10995729-10995751 CTCCCTGTCCCTAGTCTCTCTGG - Intergenic
1065246162 10:23760238-23760260 CTTCATATGCCTAGTGTGAAAGG - Intronic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1065852443 10:29801975-29801997 CCCCATATGCCCAGTTGCTCAGG - Intergenic
1069346263 10:67473925-67473947 CTGCATATGCCATGTGACTCGGG - Intronic
1071784683 10:88885599-88885621 CTCCATACTCCCAGAGTCTCAGG + Intronic
1073520348 10:104122301-104122323 CACCTTATGCCTGGGGTCTCCGG + Intronic
1073804922 10:107087359-107087381 ATCCATATGTCTAGTGTTCCTGG + Intronic
1078144713 11:8714894-8714916 CTCCATATACCTAGTCCCCCAGG + Intronic
1080687362 11:34526302-34526324 CTTCATTTCCCTAGTTTCTCAGG + Intergenic
1088697031 11:112376155-112376177 CTCCATATTCCCAGTGTATGTGG - Intergenic
1092969122 12:13674492-13674514 CCACACATGCCTAGTTTCTCGGG + Intronic
1103341826 12:120224914-120224936 CCCCATAAGCCTAGAGCCTCAGG - Intronic
1112435410 13:99388477-99388499 CTCCAGATGCCGAGTTCCTCAGG - Intergenic
1116590754 14:46769439-46769461 ATTCATATGCCTAGTTTCACTGG + Intergenic
1118827787 14:69399384-69399406 CTCCATTAGCCTGCTGTCTCTGG + Exonic
1125882115 15:43204070-43204092 CTCCCTCTGCCCAGTGTCCCTGG + Intronic
1126908267 15:53390409-53390431 ATAAATATGCCTAGTGTCACTGG + Intergenic
1131456543 15:92586511-92586533 CCCCACATGCCTAGTGGCTTAGG + Intergenic
1132092756 15:98959240-98959262 ATCCAAATGCCTAGTGTCTGCGG - Exonic
1133995184 16:10742664-10742686 TTCCATATTCTTAGTGTCTGGGG + Intergenic
1136588181 16:31201387-31201409 CTCCATGTCCCTAGGGTCTCTGG - Intergenic
1139477022 16:67207840-67207862 CTCCATCTGCCTGGTGTCATCGG + Intronic
1142538091 17:634151-634173 CTCCATATTCTTGGTGACTCTGG + Intronic
1144156749 17:12511702-12511724 CTCCATTTACCTAGTGTCATAGG - Intergenic
1144217032 17:13065331-13065353 CTCAAGATGCCTCCTGTCTCAGG - Intergenic
1147525289 17:41216612-41216634 CTCTATATTCCTCCTGTCTCGGG + Intronic
1147641310 17:42002440-42002462 CTCCATAGGGGTAGTGTCTTAGG - Intronic
1157195723 18:45618762-45618784 CTCCCTATCCCTAGTCTCTTGGG - Intronic
1160175534 18:76591138-76591160 CTCAATCTGCTTTGTGTCTCTGG - Intergenic
1161743511 19:6040341-6040363 CTCCATATGTCTGGCCTCTCTGG - Intronic
1163513673 19:17750286-17750308 CCCAAAATGCCCAGTGTCTCAGG + Intronic
1164675207 19:30096016-30096038 CTCCATATTCCCAGTGCCCCCGG - Intergenic
1166694160 19:44843127-44843149 CTCCAGATAGCTTGTGTCTCAGG - Intergenic
925025052 2:601033-601055 ATCCACATGCCCAGTGCCTCAGG - Intergenic
928116780 2:28550871-28550893 CTCCATATGCCTAGGGGCAGCGG - Intronic
928897501 2:36282058-36282080 CTCCATTTTTCTAGTTTCTCAGG + Intergenic
934165201 2:89288139-89288161 CAGCATGTTCCTAGTGTCTCAGG + Intergenic
934202072 2:89894323-89894345 CAGCATGTTCCTAGTGTCTCAGG - Intergenic
943434159 2:187843112-187843134 ATCAATATGCGAAGTGTCTCAGG + Intergenic
943586519 2:189747520-189747542 CTCCATATTTATAGTGTCTTTGG + Intronic
948367865 2:237470088-237470110 CTCCATGTGCCTGGTGTCCCTGG - Intergenic
1181598704 22:23936335-23936357 CTCTACATTCCTAGGGTCTCTGG + Intergenic
949389922 3:3549282-3549304 CTCCATATGCATCTTCTCTCTGG + Intergenic
953288751 3:41640465-41640487 CTCGTTTTGCCTAGTGTCCCAGG + Intronic
954864520 3:53717571-53717593 CTCAGTATGACTAGGGTCTCTGG - Intronic
967862290 3:194161151-194161173 CTCCATTTGCCAAGCTTCTCAGG + Intergenic
970012937 4:11480539-11480561 CTCCATATTCCTGGTTGCTCAGG - Intergenic
974276898 4:59732775-59732797 GAACATATGCTTAGTGTCTCAGG - Intergenic
977494965 4:97763693-97763715 CTCCATGGGCCTGGAGTCTCAGG - Intronic
981232961 4:142379944-142379966 CACCATTTGCCTAGTGGCTTAGG - Intronic
981566786 4:146110289-146110311 CTCCATAGGCCTAGTCCATCAGG + Intergenic
983082828 4:163408852-163408874 CTCCTTATGCCTTGTTGCTCAGG - Intergenic
986894029 5:12343820-12343842 CTCCTTCTGCTTAATGTCTCTGG + Intergenic
987542219 5:19270598-19270620 CTGCATTTGGCTAGTGTCACCGG + Intergenic
989672535 5:43935779-43935801 CCCCATAAGTCTACTGTCTCTGG - Intergenic
991410168 5:66338012-66338034 ATCCATGTGACTAGAGTCTCAGG + Intergenic
992942319 5:81774529-81774551 CTCCCACTGCCTATTGTCTCTGG - Intergenic
995102851 5:108335621-108335643 GTGCATTTGCCTAGTGTCACAGG - Intronic
997833411 5:137172577-137172599 CACTGTAGGCCTAGTGTCTCTGG - Intronic
998520577 5:142796811-142796833 TTCCTTCTGCCTGGTGTCTCTGG + Intronic
998930714 5:147178167-147178189 CTCCACAAGCCTATTGTATCAGG + Intergenic
1002357190 5:178640528-178640550 CTCCATACGCCGGGTGCCTCCGG + Intergenic
1011335446 6:86254688-86254710 CTCCATATTCTTAGAGTATCTGG - Intergenic
1012248229 6:96951325-96951347 CTGCATTTACCTAGTGTCTGTGG + Intronic
1013289523 6:108708397-108708419 CTCCTGATGTCTAGTGTCTCAGG - Intergenic
1018207212 6:161446732-161446754 CTCCATATTCCTAGTGTGGGAGG - Intronic
1019624918 7:2011188-2011210 CTGCACATGCCGCGTGTCTCTGG - Intronic
1020393979 7:7692412-7692434 ATCCATTTGCCTATTTTCTCTGG - Intronic
1022821636 7:33968032-33968054 CTCCAATTGCCTAGCGTCTCTGG + Intronic
1024548823 7:50543581-50543603 CTCTATGTACCGAGTGTCTCTGG + Intronic
1031447972 7:121878175-121878197 CTACATCTGCCTAGTGGCTATGG - Intronic
1035426894 7:158784040-158784062 CTCCCTGTGCCTTGTGTCTTTGG - Intronic
1038395988 8:27245767-27245789 CTCCATCTGCCTTCTTTCTCAGG - Intronic
1040580529 8:48695235-48695257 CTCCTTATGACTAGTGTGGCAGG - Intergenic
1041042083 8:53857314-53857336 CTCCACAGGCCTTGTGGCTCAGG + Intronic
1042174810 8:66028576-66028598 CACCATATTCCCAGTTTCTCTGG + Intronic
1043427333 8:80160549-80160571 ATCCATTTGCCAAATGTCTCAGG + Intronic
1044031380 8:87241889-87241911 CTACATATGCTTATTATCTCTGG - Intronic
1045923118 8:107555667-107555689 CTCCATATGCCTTTTTTTTCTGG - Intergenic
1046214094 8:111119040-111119062 CCCCATATCCCTATTATCTCTGG - Intergenic
1056791921 9:89631540-89631562 CTCCATGTGTCTATTGGCTCTGG + Intergenic
1057076249 9:92139651-92139673 CTCCATATGCCATGTTTATCAGG + Intergenic
1060302713 9:122384668-122384690 CTCCATCTGCTGAGTGTCCCTGG - Intronic
1060412363 9:123408243-123408265 TTCCATATGCCGAGTCTCCCCGG + Intronic
1062383458 9:136298736-136298758 CTCTATGGGCCTAGTGACTCTGG - Intronic
1062415747 9:136448685-136448707 CTCCATTCTCCTGGTGTCTCTGG - Intronic
1062415785 9:136448835-136448857 CTCCATCCTCCTGGTGTCTCTGG - Intronic
1187493299 X:19772965-19772987 CTCCATCTGGCAAGTGTTTCTGG + Intronic
1190429182 X:50361890-50361912 CTTCATATGCCTAGTAATTCTGG - Intergenic
1191876123 X:65798432-65798454 CACCAAATGCCTAGTTTCACTGG - Intergenic
1194570967 X:95554268-95554290 CTACATTTGCCAAGAGTCTCTGG + Intergenic
1195304213 X:103563098-103563120 CACCAAATGCCTAGTGTTTCTGG + Intergenic
1196855821 X:119982833-119982855 CTCCACATATCTAGTTTCTCAGG - Intergenic