ID: 904876447

View in Genome Browser
Species Human (GRCh38)
Location 1:33658173-33658195
Sequence CTGGGTGTCTGCCACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904876447 Original CRISPR CTGGGTGTCTGCCACTCAGG AGG Intronic
900299162 1:1968482-1968504 CTGAGTGGCGGCCACTCAGCGGG + Intronic
900557146 1:3286364-3286386 CTGGGGCTCTGCCAGGCAGGGGG - Intronic
900774434 1:4571489-4571511 ATGGGTGTCTGCCACAAGGGAGG + Intergenic
901061482 1:6473928-6473950 CAGGGTGACTGCCTCTGAGGAGG + Intronic
901810761 1:11765808-11765830 TTGGGTGGCTGGCACTCAGGTGG - Intronic
901813193 1:11779174-11779196 CTTGGGGTCTGCACCTCAGGGGG + Intronic
902873481 1:19327580-19327602 CTGGGTGCCTGGCACACAGGAGG - Intronic
903221612 1:21872691-21872713 CTGGGTTGCTGGCACTCAGGTGG + Exonic
904399076 1:30243928-30243950 CTGAGTGTCTTCCACACAGTGGG + Intergenic
904528321 1:31151489-31151511 CATGGTCTCAGCCACTCAGGAGG + Intergenic
904876447 1:33658173-33658195 CTGGGTGTCTGCCACTCAGGAGG + Intronic
905365193 1:37447608-37447630 CGGGGTGTGTGTCACTCAGGAGG - Intergenic
905442380 1:38003888-38003910 CTGGGTGTCTTCCAATCACAGGG - Intronic
906258355 1:44367705-44367727 CAGGGTGGCTCCCACCCAGGAGG + Intergenic
906615944 1:47232721-47232743 CTGGGTGTCTGGGACACTGGAGG - Intergenic
907293798 1:53435788-53435810 CAGGGTCTCTGTCACCCAGGTGG - Intergenic
911274496 1:95844470-95844492 CTGGGTGTTTGCCACTCAGAGGG - Intergenic
912235411 1:107844999-107845021 GGAGGTGTCTCCCACTCAGGAGG - Intronic
912724861 1:112050108-112050130 CTTGGTGCCTGCTGCTCAGGAGG + Intergenic
914509312 1:148317508-148317530 CTGAGGGCCTGCCCCTCAGGAGG + Intergenic
915663683 1:157424954-157424976 AGGGGTGTCTCCCAGTCAGGAGG - Intergenic
917009707 1:170457491-170457513 GTAGGTGTCTCCCAGTCAGGAGG + Intergenic
918319495 1:183351345-183351367 CTGGGTGTCTGCCACTTTGATGG - Intronic
919697732 1:200595808-200595830 CATGGTGGCTGCTACTCAGGAGG + Intronic
920493919 1:206440667-206440689 CTGGGTCCCAGCTACTCAGGAGG - Intronic
920563881 1:206958668-206958690 CTGTGTCTCTGCAGCTCAGGAGG - Exonic
920934604 1:210419298-210419320 CTGTGTGTCTGCCAGGGAGGTGG + Intronic
921626254 1:217380357-217380379 GGAGGTGTCTGCCAGTCAGGAGG - Intergenic
922001793 1:221486076-221486098 CAGGGTGCCTGCCACTCCTGTGG - Intergenic
922904513 1:229163760-229163782 CTGGGTGTCTGCTCTCCAGGTGG + Intergenic
923263099 1:232286012-232286034 CTGGGACTCTGTCAATCAGGAGG - Intergenic
1062833324 10:620458-620480 CTCCGTATCTGCCCCTCAGGAGG - Intronic
1063157712 10:3395642-3395664 CTGGGCTTCTGCCACTCACCAGG + Intergenic
1063385889 10:5616293-5616315 CGGGGTGGGTGGCACTCAGGGGG - Intergenic
1065341448 10:24710603-24710625 CTCAGTGTCTGGCACTCAGAAGG + Intronic
1065454049 10:25888110-25888132 CTGTGTCTCAGCTACTCAGGAGG + Intergenic
1065664184 10:28040497-28040519 CTGGGTTCCAGCTACTCAGGAGG - Intergenic
1066388034 10:34957270-34957292 CTGGGTCCCAGCTACTCAGGAGG - Intergenic
1066753670 10:38687109-38687131 CTGGGTCTCAGCTACTCAGGAGG - Intergenic
1067061822 10:43081650-43081672 CTGGGAGGCTGCCAGTCAGTGGG + Intronic
1067939084 10:50637477-50637499 ATCAGTGTCTGTCACTCAGGAGG - Intergenic
1068242619 10:54323764-54323786 ATGGGTGTATTGCACTCAGGTGG - Intronic
1069800804 10:71080413-71080435 CTGGGTCTCTGCCACATATGAGG - Intergenic
1070765029 10:79051480-79051502 CAGGGGGTCTGTAACTCAGGCGG - Intergenic
1071401716 10:85279831-85279853 GGAGGTGTCTGCCAGTCAGGAGG + Intergenic
1072000976 10:91195511-91195533 CAGGGTCTCTGTCACTCAGACGG + Intronic
1072216686 10:93293209-93293231 GTGGGCATCTGCTACTCAGGGGG - Intergenic
1074428137 10:113370228-113370250 CATGGTGGCTGCCTCTCAGGAGG - Intergenic
1074543452 10:114384924-114384946 CAGAGTGTCTGGCACACAGGTGG - Intronic
1076348862 10:129800980-129801002 CTGGGTATGTGGTACTCAGGAGG + Intergenic
1079130758 11:17745617-17745639 CTGGGTGTGGGGCACTCAAGTGG - Intronic
1081914158 11:46720138-46720160 GTGGGAGTCTGCCGCTGAGGAGG - Intronic
1082210771 11:49498575-49498597 ATGGGTGTGTGTCTCTCAGGAGG - Intergenic
1084288206 11:68145546-68145568 CTGCGTGTCTGCCAGCCAAGGGG + Intergenic
1084720486 11:70902486-70902508 CTTGGGGGCTGCCTCTCAGGGGG + Intronic
1085042320 11:73333813-73333835 CTGACTGTCTGCCACCCTGGGGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086177953 11:83914919-83914941 GTGGATGTGTTCCACTCAGGTGG + Intronic
1086638869 11:89126214-89126236 ATGGGTGTGTGTCTCTCAGGAGG + Intergenic
1087038135 11:93774031-93774053 CTGGGTTCCTGCACCTCAGGAGG - Intronic
1089038909 11:115426802-115426824 CTGGGTCTCTGCCATTCACAGGG + Intronic
1089312130 11:117565603-117565625 ATGAGTGTCTGCCACACAGAAGG + Intronic
1090200679 11:124853252-124853274 CTCGGTGTCTGGCACTTAGTAGG + Intergenic
1092086728 12:5768776-5768798 CTGGCTGTCTGCCCCTGAGCTGG + Intronic
1092158301 12:6299561-6299583 CAGGCTGTCTGCCACCCTGGCGG + Intergenic
1092457545 12:8657692-8657714 CTGTGTCCCAGCCACTCAGGAGG - Intronic
1096192104 12:49626351-49626373 CTGCTTGTCTCCCACTCATGTGG - Intronic
1096549928 12:52365279-52365301 CTGAGTGTCTGCGGCTCAAGGGG + Intronic
1097145794 12:56938609-56938631 CTGCATGTCTGCCATGCAGGAGG - Intergenic
1097151355 12:56982147-56982169 CTGCATGTCTGCCATGCAGGAGG - Intergenic
1097189982 12:57214970-57214992 CTGGGTTTCTGCCTCTCATTCGG - Intergenic
1100473900 12:94918030-94918052 CTAAGTGCCAGCCACTCAGGAGG + Intronic
1101523689 12:105507892-105507914 AAGGTTGTCTCCCACTCAGGAGG - Intergenic
1102677968 12:114671520-114671542 CTGGGTCTCTGCCCACCAGGCGG - Exonic
1103744996 12:123116525-123116547 CTGCGTCTCAGCTACTCAGGAGG + Intronic
1105054157 12:133081563-133081585 CTGGGGTTCTGCCAGGCAGGTGG - Intronic
1106263851 13:28092259-28092281 CTGGAGGTTTGCCACTGAGGAGG - Intronic
1107129760 13:36882840-36882862 CTGGGTTCCAGCTACTCAGGAGG + Intronic
1107189144 13:37558973-37558995 CTGTCTGTCTGCCGCTCAGAAGG + Intergenic
1107566820 13:41613580-41613602 CTGGGGCCCTGCGACTCAGGTGG - Intronic
1108527749 13:51300274-51300296 CTGGGTGTCTGGGACTCTGGAGG - Intergenic
1109225086 13:59683947-59683969 CTGTGTGTCTGCCAGCCACGAGG + Intronic
1112546448 13:100376295-100376317 GGGGGTGTCTCCCAGTCAGGAGG + Intronic
1113555257 13:111228952-111228974 CTGGGTGGCTTCCAGTCAAGCGG + Intronic
1113777794 13:112958625-112958647 CTGGGCGTGTGCCAGGCAGGTGG - Intronic
1114016529 14:18434921-18434943 CTGAGTGTTTGTCCCTCAGGTGG - Intergenic
1114083365 14:19219950-19219972 GAGGGTGTCTTCCACTCAGCAGG + Intergenic
1116495881 14:45559633-45559655 CTGCGGGCCTGCCGCTCAGGAGG - Intergenic
1116685776 14:48036264-48036286 CTGGGGGTGTGGCTCTCAGGTGG + Intergenic
1119432606 14:74578295-74578317 CGGGGTGTCTGCCACACAGTCGG - Intronic
1119613069 14:76080188-76080210 CTGGCTCTGTCCCACTCAGGCGG + Intronic
1121486852 14:94323032-94323054 CTGGGTTCCTGCCATGCAGGGGG - Intronic
1122075454 14:99232088-99232110 CTGGTGGTCTGCCAGACAGGAGG - Intronic
1122698344 14:103569606-103569628 CCGGGTGTCTGCAGCTCAGTGGG - Intronic
1126194548 15:45917681-45917703 CTGGGGGCCTGGCACTCAGCTGG + Intergenic
1127832086 15:62759863-62759885 CAGGGTGGGTGCCACTCAGCAGG - Intronic
1131812224 15:96184547-96184569 CTGGGTGAATGCCAATCAGCAGG - Intergenic
1132593125 16:735114-735136 CTGGGTGGCTGCCTCTGGGGTGG - Intronic
1133599801 16:7328124-7328146 CTGAGTCTCCGCCACTCTGGAGG - Intronic
1134147958 16:11782735-11782757 CTGAGTCCCAGCCACTCAGGAGG - Intronic
1134821205 16:17248867-17248889 CTGGGTGCCAGCTACTCAGGAGG - Intronic
1135137400 16:19895228-19895250 CAGGGTGGCTGCCATGCAGGAGG + Intergenic
1135942042 16:26830363-26830385 CAGGGTGTCTGCCACTTGTGTGG + Intergenic
1136729062 16:32390087-32390109 CTGGGTCTCAGCTACTCAGGAGG + Intergenic
1137362936 16:47836766-47836788 CTGTGTCCCTGCTACTCAGGAGG + Intergenic
1138106166 16:54288082-54288104 CTGGGTGTCTGCCGTGGAGGTGG - Intergenic
1138633110 16:58315179-58315201 CTGGGTGTATTATACTCAGGAGG - Intronic
1139638113 16:68271331-68271353 CAGGGTCTCTGTCACCCAGGCGG + Intronic
1139643647 16:68311295-68311317 CCGGGTGCCTGCCACTCGCGGGG + Exonic
1141929074 16:87189011-87189033 ATGGGTGCCTGCCACTAATGTGG - Intronic
1142218564 16:88841754-88841776 CTGGGTCTCTGGGACTTAGGTGG - Intronic
1202997337 16_KI270728v1_random:127432-127454 CTGGGTCTCAGCTACTCAGGAGG - Intergenic
1203024024 16_KI270728v1_random:439774-439796 CTGGGTCTCAGCTACTCAGGAGG - Intergenic
1144457685 17:15432500-15432522 CTGTGTGTCTGCCAATGGGGAGG - Intergenic
1144905688 17:18638526-18638548 CTGGGTGGGTGCCTCTCAGTGGG - Intronic
1147498293 17:40938208-40938230 CAAGGTGTCTGCCCCTCTGGAGG - Intergenic
1150307680 17:64100233-64100255 GGGGCTGTCTGCCACTGAGGAGG + Intronic
1150656391 17:67042505-67042527 CTGGGTGCCTGGCACTCAGTAGG + Intergenic
1150915685 17:69434450-69434472 TTGAGTGCCTGCCACTCTGGAGG + Intronic
1151064113 17:71131439-71131461 GGGGGTGTCTCCCAGTCAGGAGG + Intergenic
1151420138 17:73991564-73991586 CAGGGTCTCTGCCACTCCTGTGG - Intergenic
1151799805 17:76371699-76371721 CAGGGTCTCTGTCACCCAGGTGG - Intronic
1152243841 17:79175148-79175170 ATGGGGGTCTGACACGCAGGTGG + Intronic
1152600517 17:81259954-81259976 CTGGATGCCTGCCACTCGGTGGG - Intronic
1157394127 18:47327596-47327618 CTGGGTGGCTCCCTCCCAGGGGG - Intergenic
1158440650 18:57471477-57471499 CTGGATTTTTGCCCCTCAGGAGG - Intronic
1161439912 19:4285064-4285086 CTGGGTGCCTGGCACGCAGCAGG - Intronic
1161790617 19:6357639-6357661 GTGGGTGCCAGCTACTCAGGAGG + Intergenic
1163255697 19:16154470-16154492 CCCGGTGTCTGCCCCTGAGGAGG + Exonic
1163457093 19:17413561-17413583 CAGGTGATCTGCCACTCAGGAGG + Intronic
1163653367 19:18531828-18531850 GTGGGGGGCTGGCACTCAGGCGG + Exonic
1164621103 19:29696580-29696602 CTGGGTGTCTGGATGTCAGGTGG - Intergenic
1164702315 19:30294677-30294699 TAGGGAGTCTGCCACTCATGGGG - Intronic
1164871803 19:31651846-31651868 CCTGGTGTCTGCCACCTAGGGGG - Intergenic
1165760878 19:38320473-38320495 CTGGGTGTTTCCTACTTAGGAGG - Intronic
1166262258 19:41648567-41648589 CTGGGTGTCTGTCACAGAGATGG + Intronic
1167085922 19:47309721-47309743 CTGGGTGTGTGCCCCGCAGAGGG + Intronic
1167137105 19:47623388-47623410 CTGGGGGTCTGACCCTCATGAGG - Intronic
1167749070 19:51368944-51368966 CTGGGTGTGAGTCACTTAGGTGG - Exonic
1168199565 19:54805029-54805051 CTGGGTGCCGACCACTCAGTGGG - Exonic
1168294656 19:55372878-55372900 CCGGGTCTCCGCCCCTCAGGGGG + Intergenic
926924118 2:17969330-17969352 CTGGGAGGCTGCCACTCAAATGG - Intronic
927576105 2:24203211-24203233 CTGGGTCACAGCCACTCAGGAGG - Exonic
927927720 2:27025141-27025163 CTGGGTGGCTGCCCCTCCAGGGG - Intronic
928377780 2:30789991-30790013 CTGGGTGTCTGCTGCTGCGGAGG + Intronic
929284062 2:40115598-40115620 CTGGGTGGCTGCCACTTTGCTGG + Exonic
931350774 2:61486377-61486399 GTGGGTGTCTCCAACTTAGGTGG + Intronic
931907533 2:66858703-66858725 CGAGGTGTCTCCCAGTCAGGAGG + Intergenic
932074697 2:68651875-68651897 CTGTGTGTCTGCCACTACAGTGG - Intronic
934185349 2:89667990-89668012 CTGGGTCTCAGCTACTCAGGAGG + Intergenic
934317052 2:91932417-91932439 CTGGGTCTCAGCTACTCAGGAGG - Intergenic
934854327 2:97719451-97719473 ATAGGTGTCGGCCATTCAGGGGG + Intronic
937318730 2:120948253-120948275 CCGGCTGTGTGCCCCTCAGGAGG - Intronic
937910591 2:127073741-127073763 CTGTTTGTCTGTCACTGAGGTGG - Intronic
938174012 2:129107759-129107781 CTGAGTCTCTGCCACTCTGAAGG + Intergenic
938641979 2:133290873-133290895 CTGGGTCTCAGCTACTCAGGAGG - Intronic
938725244 2:134102982-134103004 CAGGGTCTCTGTCACCCAGGTGG - Intergenic
942136367 2:172930120-172930142 CTGGGTGGGTGCTACCCAGGGGG + Intronic
944667262 2:201968411-201968433 CCGGCTGACTGCCACCCAGGGGG + Intergenic
945467104 2:210182006-210182028 GGGGGTGTCTCCCAGTCAGGAGG - Intergenic
946217636 2:218197880-218197902 CTGTGTGTCTGCGTGTCAGGTGG - Intergenic
947274690 2:228377150-228377172 CGGGGTGTGTGCCACTTAGGTGG + Intergenic
947321212 2:228921056-228921078 CTGGGTGTCTGCATCTAAAGGGG - Intronic
947534498 2:230932200-230932222 CTGGGCGCCTGCCCGTCAGGTGG + Intronic
947711853 2:232321072-232321094 CTGGGTGCCTGTCACCCATGAGG + Intronic
948283183 2:236764371-236764393 CTGGATGTCAGATACTCAGGTGG + Intergenic
1169390532 20:5186836-5186858 CTGGGTATGTGCCACTCACAGGG + Exonic
1170592832 20:17784096-17784118 CTGGTTGTCTGACATGCAGGAGG - Intergenic
1177114917 21:17073701-17073723 CTGGGTCTGAGCCACTCATGAGG + Intergenic
1177341368 21:19805461-19805483 CTGGGTCCCAGCTACTCAGGAGG - Intergenic
1177853730 21:26378537-26378559 TTGGTTGTCTGCCAGTCAGTAGG + Intergenic
1178350313 21:31868544-31868566 CTTGGTGTCTGGCTCCCAGGAGG + Intergenic
1179572740 21:42287410-42287432 CAGGGTGCCAGCCACTCATGTGG + Intronic
1180294610 22:10873317-10873339 GAGGGTGTCTTCCACTCAGCAGG - Intergenic
1180441036 22:15365794-15365816 CTGAGTGTTTGTCCCTCAGGTGG - Intergenic
1180441115 22:15366609-15366631 CTGAGTGTTTGTCCCTCAGGTGG - Intergenic
1180497416 22:15902731-15902753 GAGGGTGTCTTCCACTCAGCAGG - Intergenic
1180543410 22:16474931-16474953 CTGGGTCTCAGCTACTCAGGAGG - Intergenic
1181833803 22:25585176-25585198 ATGGGTGTTTCCCACTCAGGAGG + Intronic
1182335110 22:29578847-29578869 CTGGGTGTTTGCCACACAAATGG + Intronic
1182809102 22:33100918-33100940 TTGGGAGTCTGCCTCCCAGGTGG - Intergenic
1183279615 22:36924856-36924878 CTGGGTGTCTTGCCATCAGGAGG - Intronic
1183564250 22:38601815-38601837 TTGGGTGTCAGCTGCTCAGGTGG + Intronic
1184122048 22:42458003-42458025 GCGTGTGTCTGCTACTCAGGAGG + Intergenic
1184989969 22:48160800-48160822 GTGGGTGTCTGCCACCCAAAGGG - Intergenic
950673595 3:14541250-14541272 CTTGGTGTCTGACCCTCAGTTGG - Intronic
951811122 3:26701307-26701329 CTGGGTGGCAGCTGCTCAGGAGG + Intronic
952098544 3:29984820-29984842 TGAGGTGTCTGCCAGTCAGGAGG + Intronic
952827647 3:37537573-37537595 CAGGGTGTCTGGCACTCTGTAGG - Intronic
953604740 3:44404382-44404404 ATGGGTGCCTGGCACACAGGGGG + Intronic
954654884 3:52188254-52188276 CTGAGTCCCAGCCACTCAGGAGG + Intergenic
954754996 3:52834309-52834331 CTGGGTGTCCCCCACCCTGGAGG - Intronic
955731151 3:61988406-61988428 TTGGGTGGCAGCCACTCATGTGG + Intronic
956634832 3:71353432-71353454 CTGGGTGTTAGCCACTCTGAGGG + Intronic
959015641 3:101131050-101131072 CTGGATGTCTCCCACTCTGCCGG - Intergenic
960915614 3:122691423-122691445 CTGGGTGATTGCCATTCAGCGGG + Intronic
961365340 3:126395865-126395887 GTGGCTGTCAGCCACCCAGGGGG + Intronic
961868632 3:129972744-129972766 CTGGATGTCTGTCCATCAGGAGG - Intergenic
965715316 3:171596390-171596412 CTGGCTGTCTGCAGGTCAGGGGG - Intergenic
966211047 3:177453945-177453967 CTGTATGTCAGCTACTCAGGAGG - Intergenic
968961724 4:3748986-3749008 CTGGGGGACTGCCATCCAGGTGG - Intergenic
969164750 4:5298231-5298253 CGAGGTGTCTCCCAGTCAGGAGG + Intronic
969601280 4:8177903-8177925 CTGGGATTCCCCCACTCAGGGGG + Intergenic
970856192 4:20651508-20651530 TTGGTTGGCTGCCAATCAGGAGG - Intergenic
972608731 4:40637396-40637418 CAGGGTGGCACCCACTCAGGAGG + Intergenic
973218125 4:47694704-47694726 CGGAGTGCCTGGCACTCAGGAGG + Intronic
975424908 4:74214655-74214677 CAAGGTGTCTCCCAGTCAGGAGG + Intronic
977948944 4:102947494-102947516 CTGGGTCTCAGCTACTCAGGAGG - Intronic
984976317 4:185233358-185233380 CTGGGTGCCTGGCACTTAGCTGG - Intronic
985573857 5:664725-664747 GAAGGTGTCTGCCGCTCAGGAGG + Exonic
985609826 5:881200-881222 CTGAGCGTCTGTCCCTCAGGAGG + Intronic
989459540 5:41681807-41681829 CTTGGTGTCTGCTTCTCAGAGGG - Intergenic
993387598 5:87278422-87278444 GTGGGTGCCTGCTACTCGGGAGG + Intronic
993480385 5:88417296-88417318 CTGTGTGTCTGACACACAGTAGG + Intergenic
993708775 5:91201213-91201235 CTGTGATTCTGCTACTCAGGAGG + Intergenic
997604384 5:135163593-135163615 CTGCCTGGGTGCCACTCAGGCGG - Intronic
998054822 5:139065520-139065542 CTGGGTTTCTGCTCCTCAGAGGG + Intronic
998216114 5:140239732-140239754 CTGGGTGCCTGCCCCTCTGCAGG + Intronic
998801808 5:145876396-145876418 CTTGGTCTCAGCTACTCAGGAGG - Intergenic
999459144 5:151742719-151742741 CAGGGTGTCTGACTCCCAGGTGG + Intronic
1000052471 5:157575128-157575150 CTCGGTGCCTGCCACACTGGTGG - Intronic
1000798309 5:165692859-165692881 CAAGGTGTCTCCCAGTCAGGAGG + Intergenic
1000996027 5:167960140-167960162 GTAGGTGTCTCCCAGTCAGGAGG + Intronic
1001232390 5:169999943-169999965 CTTGGTGACTGCCACTCTGTAGG + Intronic
1002507858 5:179692647-179692669 CTGAGTGCCAGCTACTCAGGAGG - Intronic
1003024386 6:2541399-2541421 CATGGTCTCAGCCACTCAGGAGG - Intergenic
1003424018 6:5984555-5984577 GTGGGTGTCTGCTACTGAGAGGG - Intergenic
1004593286 6:17074125-17074147 TGGGGTGTCTCCCAGTCAGGAGG - Intergenic
1006463472 6:34177349-34177371 CTGTGTGGCTGCCACACAGCAGG - Intergenic
1006715404 6:36115804-36115826 CTGGGTCCCAGCTACTCAGGAGG + Intergenic
1011868146 6:91857794-91857816 CTTGGTGTGTGCCCCTCATGAGG - Intergenic
1012043480 6:94239377-94239399 GGGGGTGTCTCCCAGTCAGGAGG - Intergenic
1013951631 6:115789717-115789739 CTAGGTTTCAGCTACTCAGGAGG + Intergenic
1014872562 6:126614491-126614513 GGGGGTGTCTCCCAGTCAGGAGG + Intergenic
1015881785 6:137877314-137877336 CAGGGTGGCAGCAACTCAGGTGG - Intronic
1017076923 6:150627403-150627425 CAGGGTTTCTTCCACTCAGAAGG + Intronic
1017926228 6:158913811-158913833 CTAGGAGTTTGACACTCAGGAGG - Intergenic
1018186557 6:161270089-161270111 ATGGGTATCTGCCAGTCATGGGG + Intronic
1019351683 7:557010-557032 CTGGTTCTCTGCAGCTCAGGAGG - Intronic
1019686546 7:2384991-2385013 CTGGGTGGCTGCAGCTCAGCAGG + Intergenic
1020266898 7:6566778-6566800 CTGAGTCCCAGCCACTCAGGAGG - Intergenic
1022550655 7:31236328-31236350 CTGGGTGTCAGTCACACTGGAGG + Intergenic
1022582307 7:31567701-31567723 CAGGGTGACAGCTACTCAGGAGG - Intronic
1024005237 7:45220288-45220310 CTGGGTGACCCCCACTCAGTTGG - Intergenic
1025145387 7:56496724-56496746 CTGAGTGTCAGCCAGTAAGGAGG - Intergenic
1027760990 7:82278434-82278456 CTGGATCTCAGCTACTCAGGAGG + Intronic
1032262588 7:130348821-130348843 TTGGTTGACTGCCAATCAGGAGG - Intronic
1032911142 7:136431910-136431932 CAAGGTGTCTCCCAGTCAGGAGG - Intergenic
1033075299 7:138244391-138244413 GTGGGTGCCTGCTATTCAGGAGG - Intergenic
1034436153 7:151063583-151063605 CTGGGTCTCTGCATCTGAGGGGG + Intronic
1035900113 8:3450157-3450179 GTGGGTCTCTTACACTCAGGCGG + Intronic
1036177516 8:6553184-6553206 CTGTGTGTGTGCCACGGAGGGGG + Intronic
1036798583 8:11773186-11773208 CAGGGTGTCTGCCACAGAGCTGG + Intronic
1039527607 8:38231040-38231062 CTGGGTCTGAGCTACTCAGGAGG - Intronic
1040293945 8:46139621-46139643 CTGGGAGTCTGCCACGGATGTGG - Intergenic
1040337701 8:46424423-46424445 CTGGGTGGCAGGGACTCAGGGGG + Intergenic
1041249113 8:55917632-55917654 CTGGGTGTCCTCCACTCACATGG + Intronic
1042997560 8:74717684-74717706 CGTGGTGTCTGCTATTCAGGAGG + Intronic
1044131162 8:88525882-88525904 GGAGGTGTCTGCCAGTCAGGAGG - Intergenic
1047450187 8:124958495-124958517 CATTGTGTCTGCCACTCAGTGGG - Intergenic
1049261366 8:141640910-141640932 CTGGGGGGCTGCCAGTCAGATGG - Intergenic
1050506941 9:6358383-6358405 ATGGTTGTCTGCCAGTCAGACGG - Intergenic
1053904843 9:42831115-42831137 ATGGGTCTCAGCTACTCAGGAGG + Intergenic
1055338910 9:75261408-75261430 GGAGGTGTCTCCCACTCAGGAGG + Intergenic
1055664959 9:78544150-78544172 CTTGGTGTCTTCCACTAAGTTGG + Intergenic
1057168685 9:92947808-92947830 CTGGGTGTCTGCGGCTGAGCAGG + Intronic
1057318651 9:93991223-93991245 CTCGGTCTCTGCCACCCAGTGGG - Intergenic
1057880430 9:98788795-98788817 CTGAGTGAGTGACACTCAGGAGG - Intronic
1058986205 9:110210400-110210422 CTGGGTGGCTGCCACTAAATGGG + Intergenic
1060459461 9:123836013-123836035 CAGGGTGTCTGACACACAGTAGG + Intronic
1060482742 9:124026949-124026971 CTGCCTGTCTACCACCCAGGTGG + Intronic
1062412444 9:136431911-136431933 CTGTGCGCCCGCCACTCAGGCGG + Exonic
1062444344 9:136587436-136587458 CTGGGTCACAGCCACTCCGGAGG + Intergenic
1187242168 X:17523362-17523384 CTGGGTCTCTGCCTCTCAAGTGG - Intronic
1196133463 X:112181875-112181897 CAAGGTGTCTCCCAGTCAGGAGG - Intergenic
1197404274 X:126030130-126030152 CTGGAACTCTGCCATTCAGGTGG + Intergenic
1198490008 X:137130129-137130151 GGAGGTGTCTCCCACTCAGGAGG - Intergenic
1200548896 Y:4554003-4554025 GGAGGTGTCTGCTACTCAGGAGG + Intergenic
1201184280 Y:11383716-11383738 CTGGGTCTCAGCTACTCAGGAGG - Intergenic