ID: 904878790

View in Genome Browser
Species Human (GRCh38)
Location 1:33678477-33678499
Sequence ATCATGACTCACATCAGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904878790_904878795 -2 Left 904878790 1:33678477-33678499 CCATCGCTGATGTGAGTCATGAT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 904878795 1:33678498-33678520 ATGGTGGATCTTTACATTAGGGG 0: 1
1: 0
2: 0
3: 10
4: 110
904878790_904878797 30 Left 904878790 1:33678477-33678499 CCATCGCTGATGTGAGTCATGAT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 904878797 1:33678530-33678552 TGTGAATGAACAGCTGCTGCAGG 0: 1
1: 0
2: 3
3: 25
4: 217
904878790_904878794 -3 Left 904878790 1:33678477-33678499 CCATCGCTGATGTGAGTCATGAT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 904878794 1:33678497-33678519 GATGGTGGATCTTTACATTAGGG 0: 1
1: 0
2: 0
3: 9
4: 101
904878790_904878796 5 Left 904878790 1:33678477-33678499 CCATCGCTGATGTGAGTCATGAT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 904878796 1:33678505-33678527 ATCTTTACATTAGGGGAAAATGG 0: 1
1: 0
2: 3
3: 48
4: 410
904878790_904878793 -4 Left 904878790 1:33678477-33678499 CCATCGCTGATGTGAGTCATGAT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 904878793 1:33678496-33678518 TGATGGTGGATCTTTACATTAGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904878790 Original CRISPR ATCATGACTCACATCAGCGA TGG (reversed) Intronic