ID: 904878797

View in Genome Browser
Species Human (GRCh38)
Location 1:33678530-33678552
Sequence TGTGAATGAACAGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904878790_904878797 30 Left 904878790 1:33678477-33678499 CCATCGCTGATGTGAGTCATGAT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 904878797 1:33678530-33678552 TGTGAATGAACAGCTGCTGCAGG 0: 1
1: 0
2: 3
3: 25
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904878797 Original CRISPR TGTGAATGAACAGCTGCTGC AGG Intronic
900378536 1:2372502-2372524 GGTGAACGTTCAGCTGCTGCAGG - Exonic
902321861 1:15673494-15673516 TGTGAATGGTCTGCTGCTGCAGG + Intergenic
902329786 1:15725603-15725625 CCTGGATGAACAGCTGATGCTGG - Intronic
903505598 1:23833154-23833176 TGTGTATGACCTGCTGCTGTGGG - Intronic
904343202 1:29851457-29851479 TGTGAATGCGAAGCTCCTGCAGG - Intergenic
904878797 1:33678530-33678552 TGTGAATGAACAGCTGCTGCAGG + Intronic
906364774 1:45198007-45198029 TGTGGATGGTCTGCTGCTGCAGG - Intronic
906704230 1:47882912-47882934 TGGGAATGAGCAGCTTCTCCAGG - Intronic
909793915 1:79709194-79709216 TGTGAATTTACAGCTGATGGGGG + Intergenic
910195057 1:84631779-84631801 GTTGAATGGACAGCTGTTGCTGG - Intronic
910206510 1:84753753-84753775 TGGCAAGGAACAGCTGCTGTGGG - Intergenic
912916420 1:113819603-113819625 TTTGACTGAACAGATTCTGCAGG + Exonic
915658353 1:157380501-157380523 TCCCAATGAACAGCTCCTGCTGG + Intergenic
920440330 1:205976291-205976313 TGTGACAGAACAGAGGCTGCAGG + Intergenic
921158729 1:212458042-212458064 TGGTAAGGAACTGCTGCTGCCGG - Intergenic
921393446 1:214641791-214641813 AGAGAATGAACAGCTGATGAAGG + Exonic
921492403 1:215794176-215794198 AGTGAATTAACAGATGCTGTTGG - Intronic
923366663 1:233268387-233268409 TGAGAATCAACCGCTGCTGAGGG + Intronic
924139774 1:241010269-241010291 TGTGAATGAACACCTGATCATGG + Intronic
1067051587 10:43024667-43024689 TGTGAGTGCATGGCTGCTGCTGG + Intergenic
1067268284 10:44766513-44766535 TAGGAATGAACAAATGCTGCAGG - Intergenic
1067942056 10:50665404-50665426 TGTGAATTCATAGCTTCTGCAGG - Intergenic
1068813509 10:61283379-61283401 TGTGTTTTAACAGGTGCTGCAGG + Intergenic
1069874006 10:71550653-71550675 TGAGAATGAACAGCTGCTTCAGG + Intronic
1069912447 10:71767778-71767800 TGTGAATGGACACTTCCTGCGGG - Intronic
1070599093 10:77853449-77853471 GGAGAATGGGCAGCTGCTGCGGG - Exonic
1070863294 10:79690349-79690371 TGTGAATTCATAGCTTCTGCAGG - Intergenic
1072040611 10:91602704-91602726 ACTGACTGAACAGCTTCTGCAGG + Intergenic
1073177807 10:101566952-101566974 TGTGCCTGAACAAGTGCTGCGGG - Intergenic
1075628650 10:123985569-123985591 TGTGGATGATCTGCTGCTGTTGG - Intergenic
1077698593 11:4418551-4418573 TGGGAAAGAGCAGCTGCTGCAGG - Intergenic
1078131189 11:8615483-8615505 TGTTAATGAAGAGCCTCTGCAGG + Exonic
1079328530 11:19514757-19514779 TTTGAAGGAGCAGCTGCTGCGGG - Intronic
1080432364 11:32210656-32210678 TGTGAATCAGCAGCTGCTGACGG - Intergenic
1081395124 11:42577884-42577906 GGTGAAAGAACAGCTGTTGTAGG + Intergenic
1084589487 11:70082184-70082206 TGTGAATGAACAACAGAGGCTGG - Intronic
1084765878 11:71308071-71308093 TGACAGTGAGCAGCTGCTGCTGG - Intergenic
1088123915 11:106400310-106400332 CATGAAAGAACAGCTGCTACAGG + Intergenic
1088693221 11:112345408-112345430 TGTGGGTGAACAGCTGAAGCTGG + Intergenic
1088894683 11:114068824-114068846 TGAGAATGATCAGGTGCTCCTGG - Intronic
1088924880 11:114291659-114291681 TGAGAAAGCACAGCTGCTGCGGG - Intronic
1089773594 11:120820572-120820594 TGTGGGTGCACAGCTGCCGCCGG - Intronic
1090106895 11:123863021-123863043 TGTGAAGGAATACCTGCAGCTGG + Intergenic
1090258855 11:125304349-125304371 TCTGAATGAACAGCTCCAGCTGG - Intronic
1090718041 11:129447497-129447519 TGTGAATGGGCAGCTCCTGATGG + Intronic
1092750320 12:11712868-11712890 TGTGAATGGTCAGGAGCTGCAGG + Intronic
1093496222 12:19761428-19761450 TATGAATGAACAGCTTATGAGGG + Intergenic
1094675304 12:32614009-32614031 TGTGGATGGTCTGCTGCTGCAGG - Intronic
1096611869 12:52807320-52807342 GGTGAATGAACAACTACAGCAGG + Intronic
1098473340 12:70870564-70870586 AGTGAATGAACATATGCTTCCGG + Intronic
1098728493 12:74000707-74000729 TGTGAATGATCTATTGCTGCAGG - Intergenic
1098864144 12:75742950-75742972 TGTAGATGATCTGCTGCTGCTGG - Intergenic
1100523418 12:95398426-95398448 AGTAAATTAACACCTGCTGCAGG + Intergenic
1105368572 13:19782918-19782940 TTTGAATGTGCAGCTGCAGCGGG - Intronic
1105785102 13:23740617-23740639 AGTGAAAAAACAGCTGCTTCAGG - Intronic
1107144108 13:37039050-37039072 TGTGGAAGATCTGCTGCTGCAGG - Intronic
1107961426 13:45562830-45562852 TCTTAAAGAATAGCTGCTGCAGG - Intronic
1108206877 13:48099038-48099060 TGTGGATGGTCTGCTGCTGCAGG + Intergenic
1108522576 13:51259317-51259339 TGTGGATGAGCAGCCGCTGGAGG - Intronic
1109184310 13:59250840-59250862 TGCCAATGTTCAGCTGCTGCAGG + Intergenic
1109326104 13:60869808-60869830 TGTGCAAGGACAGCTGCTGCTGG + Intergenic
1110348837 13:74482262-74482284 TGAGAATGAATAGCTGATGAAGG - Intergenic
1110679640 13:78293575-78293597 TGAGAATGAACAGGCACTGCAGG - Intergenic
1111429152 13:88129427-88129449 TGTGATTGACCAACTGCTGGAGG + Intergenic
1111703249 13:91717257-91717279 TGTGAATTTACAGCTGAAGCTGG - Intronic
1113860624 13:113483531-113483553 TGTCAGGGAAAAGCTGCTGCTGG - Intronic
1115490296 14:33951850-33951872 TGTGAAAGTACAGCTGCTTGTGG - Intronic
1117467774 14:56010822-56010844 TGTGAATGGTCTGCTGTTGCAGG - Intergenic
1117689201 14:58288092-58288114 TGTGACTGGTCTGCTGCTGCAGG + Intronic
1118248670 14:64136951-64136973 TGTAACTGAGCAGCAGCTGCTGG - Intronic
1118830653 14:69428380-69428402 TGTGGATGGTCTGCTGCTGCAGG - Intronic
1119903173 14:78278672-78278694 TGTGTTTGCACAGCTGCTGTGGG + Intronic
1120847847 14:89141753-89141775 TGTGGATGGTCTGCTGCTGCAGG + Intronic
1121507474 14:94487685-94487707 TGTGAAGGAAAAGATGGTGCAGG + Intronic
1122663260 14:103311925-103311947 TGTGACTGTATTGCTGCTGCAGG - Intergenic
1124168751 15:27353356-27353378 TGTAAGAGAAGAGCTGCTGCAGG - Intronic
1126776593 15:52105630-52105652 TGGGAATGATCAGGTGCTGGTGG + Intergenic
1127279386 15:57475923-57475945 AGAGAAAGAACAGCAGCTGCTGG - Intronic
1128842089 15:70858768-70858790 TGTGTAGGAGCAGCTGCTGAAGG - Intronic
1129311816 15:74718149-74718171 GGTGCATGAACAGCAACTGCTGG + Intergenic
1131430239 15:92381828-92381850 TGTGGATGATCTGCTGCTGCAGG + Intergenic
1132506075 16:309746-309768 TCTGAATGAACAGCTCCCTCTGG + Intronic
1132994442 16:2815636-2815658 TGTCCTTGAGCAGCTGCTGCTGG + Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1134229280 16:12416553-12416575 TGTGAAGGAACACCTGACGCTGG + Intronic
1135113131 16:19706062-19706084 TGTGACTGAGCTGCTGCTGCTGG - Exonic
1137293224 16:47066321-47066343 TGTGAAACAAGAGCTGCTCCCGG - Intergenic
1137676459 16:50305967-50305989 TGAGAATCCACAGCTGCTCCTGG + Intronic
1137927546 16:52555032-52555054 TGCAAATGAACAGCAGCTGATGG - Intergenic
1139834021 16:69823961-69823983 CCTAAATGAACACCTGCTGCAGG + Intronic
1142299986 16:89251415-89251437 TGAGGATGTACAGATGCTGCGGG - Intergenic
1147592726 17:41695226-41695248 TGTGAATGTACAGGTGCAGCTGG - Intergenic
1147947528 17:44088443-44088465 GTTGCATGACCAGCTGCTGCAGG + Exonic
1148178519 17:45586836-45586858 TGTGTCTGTACGGCTGCTGCAGG + Intergenic
1148908371 17:50926171-50926193 TGTGAATGGACAGGTGCTTTAGG + Intergenic
1154312896 18:13281463-13281485 TGTGAATGACCATCTAATGCTGG + Intronic
1155236455 18:23824578-23824600 TCTGAATGGAGAGCTCCTGCGGG + Intronic
1156480683 18:37434618-37434640 GGTGAATGAGCAGCTGCACCAGG + Intronic
1160706860 19:533924-533946 CCTGAAGGAACAGCAGCTGCAGG - Intronic
1161539181 19:4839413-4839435 TGTGAAGGACCAGGTGCAGCAGG - Exonic
1161794178 19:6376886-6376908 TTTGGATGAGCAGCTGCTACTGG + Intronic
1161950434 19:7464742-7464764 TGTGTGTGAGCAGCTTCTGCTGG + Intronic
1162244208 19:9385744-9385766 TGTGTAGCAACAGCTGGTGCTGG + Intergenic
1162334620 19:10052814-10052836 TGAGATTCAGCAGCTGCTGCGGG + Intergenic
1162805314 19:13135264-13135286 CCTCAATGAACAGCGGCTGCAGG + Exonic
1163625303 19:18386142-18386164 TGGGACTGACCAGATGCTGCCGG - Exonic
1164085734 19:21900594-21900616 TGTGAGTCAACACCTACTGCAGG - Intergenic
1166268667 19:41700462-41700484 TGTGTCTGTGCAGCTGCTGCAGG - Intronic
924976191 2:177889-177911 TGTGGGTGCACAGGTGCTGCTGG + Intergenic
926497502 2:13609220-13609242 TGTGAATGAAAACCTCCTGTGGG + Intergenic
931903830 2:66821244-66821266 TGTGCTGGAACAACTGCTGCAGG - Intergenic
933909683 2:86928992-86929014 TTTGAATGAAAGGGTGCTGCAGG + Intronic
934023044 2:87974387-87974409 TTTGAATGAAAGGGTGCTGCAGG - Intergenic
936413499 2:112281926-112281948 TTTGAATGAAAGGGTGCTGCAGG + Intronic
936494220 2:113004003-113004025 TGTGGATGGTCTGCTGCTGCAGG + Intergenic
936590156 2:113795885-113795907 TGTGAATGTACAGCTGCACAGGG + Intergenic
939088753 2:137753633-137753655 TGTGAATAATCTGCTGCTGTGGG + Intergenic
939932753 2:148255018-148255040 TGCCAAGGCACAGCTGCTGCTGG + Intronic
940887660 2:159003619-159003641 TGTTAATGAAGAGCTTCTGAAGG - Intronic
941634284 2:167918612-167918634 TGTGGATGGTCTGCTGCTGCAGG - Intergenic
943357529 2:186875895-186875917 TGTGAATGGTCTGCTACTGCAGG + Intergenic
943843177 2:192605038-192605060 TGTGAGTATACAGCTGTTGCTGG - Intergenic
945134764 2:206615395-206615417 TGTGAAAGTACAACTACTGCGGG - Intronic
948392886 2:237625534-237625556 TGTGTCTGAACAGCTCCCGCTGG - Intergenic
1169752736 20:9011325-9011347 TGTGGATGAAAAGTTGCTGGTGG - Intergenic
1170174687 20:13455648-13455670 TGTGGATGGTCTGCTGCTGCAGG - Intronic
1172821018 20:37734435-37734457 TGCCAATTAACTGCTGCTGCAGG - Intronic
1172856903 20:38011737-38011759 TTTGATTGATCAGGTGCTGCAGG + Exonic
1173363816 20:42367641-42367663 TGTGCATGAGCAGGTGATGCAGG + Intronic
1173794075 20:45846685-45846707 TGTGAATGCTCACCTGCTGTGGG - Intronic
1174658878 20:52193372-52193394 TGAGAATAAACAGCTGCTGCAGG - Intronic
1176013980 20:62919012-62919034 GGTACATGAACGGCTGCTGCTGG - Intronic
1177828768 21:26113220-26113242 TGTGAACGAATGGCTTCTGCTGG - Intronic
1178471602 21:32898562-32898584 TGTGAAAGAACTGCTGCTGCTGG - Intergenic
1179202599 21:39239724-39239746 TGTGAATCTACAGATGATGCTGG + Intronic
1179920760 21:44506089-44506111 TGTGAACGAGCAGGTCCTGCAGG - Intronic
1181096346 22:20507723-20507745 TTTGACTGACCAGCTTCTGCCGG - Exonic
1184557038 22:45239211-45239233 TCTGAAGGACCATCTGCTGCAGG - Intronic
1185019649 22:48366768-48366790 TGAGAAGGAGCAGCTGCCGCCGG - Intergenic
949691445 3:6644495-6644517 TTTGAATGATAGGCTGCTGCAGG + Intergenic
953988327 3:47463109-47463131 TGGGAAAGAACAGCTACTGTGGG - Intronic
954439873 3:50516090-50516112 AGTAAGTGAACAGCTGTTGCCGG + Intergenic
956486387 3:69726568-69726590 TGTGGATGGTCTGCTGCTGCAGG + Intergenic
959112290 3:102136027-102136049 TGTAAATGAACAGCGCCTTCTGG + Intronic
961121085 3:124370906-124370928 TGTGGATGGTCTGCTGCTGCGGG + Intronic
961862387 3:129927213-129927235 TGTGACTCAGCATCTGCTGCAGG - Intergenic
961974344 3:131007247-131007269 TGTGCTTGCACAGCTGCTCCAGG + Intronic
962646202 3:137443298-137443320 TGTGGATGGTCTGCTGCTGCAGG + Intergenic
962713044 3:138103494-138103516 TCTGCATTAGCAGCTGCTGCAGG + Exonic
962759847 3:138500135-138500157 TGTGAATGAGCAGGTTATGCAGG - Exonic
962942206 3:140135545-140135567 TGTCAAGGAAAAGCTGCTGAAGG + Intronic
963225481 3:142857763-142857785 AATGAATGAACAGCTGTTGAAGG + Intronic
964045417 3:152318641-152318663 TCTGGGTGAACAGTTGCTGCTGG - Intronic
964455934 3:156866301-156866323 TGTGAGTGAAAATCTGCTGGGGG + Intronic
965823865 3:172711063-172711085 CGTGAATGAGCAGCTGCCGCGGG - Exonic
968206578 3:196807812-196807834 TGTGAATCACCAACTGGTGCAGG - Exonic
970466709 4:16331017-16331039 TGTGAATGGCCTGCTACTGCGGG - Intergenic
971007414 4:22390844-22390866 TAGGAATGAACAGCTGCTTAAGG + Intronic
972928045 4:44036955-44036977 GGTGAATTCACAGCTGCTTCAGG + Intergenic
974886749 4:67828426-67828448 TGTGGATGATCTGTTGCTGCGGG - Intronic
978761014 4:112356549-112356571 GGTGGATGCACAGCTGCTCCCGG - Intronic
979107223 4:116704009-116704031 TTTGAATGCTCAGCTGCTACAGG - Intergenic
980119103 4:128709404-128709426 TGGGAAGGAACTGCTGCTTCAGG + Intergenic
980590494 4:134881587-134881609 TGTAGATGATCAGCTGCTGTGGG - Intergenic
981799069 4:148635190-148635212 TCTGAATCACCATCTGCTGCTGG - Intergenic
983929935 4:173442392-173442414 TGTGACGGAACAGATGATGCAGG + Intergenic
984891628 4:184498971-184498993 TGTGAATGGTCTGCTGCTGTGGG - Intergenic
986103514 5:4636823-4636845 TGTCAATGAACATATGCTTCTGG - Intergenic
986292539 5:6411590-6411612 TGTGAATGAACTCCCGCTCCGGG + Intergenic
986431735 5:7688023-7688045 TGTAGATGAACAGATGCTACTGG + Intronic
987987719 5:25170562-25170584 TGTCAATGAACAACAGATGCTGG + Intergenic
988828386 5:34963713-34963735 TGTGAATGGTCTGTTGCTGCAGG + Intergenic
989350982 5:40486427-40486449 TGTGAATGAGAAGATGCTGGAGG - Intergenic
990275944 5:54196746-54196768 TGTGATTAAACAGCTGCAGTGGG + Intronic
991921653 5:71663298-71663320 AGTGAACGAACAGCTTCTTCAGG - Intergenic
992756458 5:79911240-79911262 TGTGAGTGTACAGCTCCTCCAGG - Intergenic
994014183 5:94946017-94946039 TGAGAAGGAACAGCTACTGAGGG + Intronic
995039149 5:107568473-107568495 TGTTAATGCAGTGCTGCTGCTGG - Intronic
997496464 5:134331242-134331264 TGTGAATGGTCTGCTGCTGCAGG + Intronic
997827399 5:137118848-137118870 TGCATATGAACAGCTGCTGAAGG + Intronic
998266524 5:140671364-140671386 TGTGTCTGTACGGCTGCTGCAGG - Exonic
999387720 5:151166950-151166972 TGTGAATGAATAGCTGATACAGG - Intergenic
1002800108 6:514636-514658 TGTGAAGACACAGCTGCTCCAGG + Intronic
1003561904 6:7187493-7187515 TGTGCATGGTCAGCTGGTGCTGG - Exonic
1003918180 6:10806921-10806943 TGTAAAGGAACACCTGCGGCTGG - Intronic
1004222389 6:13758048-13758070 TGAGAATGAGGAGATGCTGCTGG + Intergenic
1004301776 6:14465077-14465099 GCTGAATGAACAGCAGCTGTAGG + Intergenic
1005137391 6:22585555-22585577 TGTGAAAAGACAGCTGATGCTGG - Intergenic
1005319306 6:24636711-24636733 TGTGGATGATCTGCTGCTGTGGG - Intronic
1005941175 6:30561420-30561442 AATGAATGAACTGCTGCTACAGG + Intronic
1006556400 6:34870931-34870953 GGGGAATGAACAGCTGCTCCAGG - Exonic
1010763471 6:79750972-79750994 TGCAAATGAGCAGCTGATGCTGG - Intergenic
1011704895 6:89990918-89990940 AATGAATGAACAGCTTCTTCTGG + Intronic
1012021270 6:93923366-93923388 TGAGAAAGAACATCTGCTGAGGG - Intergenic
1012216124 6:96586651-96586673 TGTGAATGGTTTGCTGCTGCAGG - Intronic
1013591486 6:111622681-111622703 TGTGAATGACCGGCAGCTCCAGG + Intergenic
1013841031 6:114394056-114394078 AGTAAATGAAGAGGTGCTGCTGG + Intergenic
1014351617 6:120353170-120353192 TGTAAATTAACAACTGGTGCAGG + Intergenic
1017539165 6:155382467-155382489 TGGGAGTGAGTAGCTGCTGCTGG + Intergenic
1017607342 6:156148097-156148119 CGGGAATGAAGAGGTGCTGCAGG + Intergenic
1020055727 7:5116715-5116737 TGAGAAGGAAGAGCTGCAGCCGG - Intergenic
1023173479 7:37412855-37412877 TGTGGCTGACAAGCTGCTGCTGG - Intronic
1023494098 7:40776190-40776212 TGTGAATCAACAGCAGATTCTGG - Intronic
1028398927 7:90403815-90403837 TTTGAATAACCAGCTGATGCTGG + Intronic
1029275970 7:99404553-99404575 TGTGAATGGACAGGTCCTGCAGG + Intronic
1031080639 7:117253815-117253837 TGTCAATGTGCAGCTGCTGGAGG - Intergenic
1032545384 7:132737591-132737613 AGTTCATGAGCAGCTGCTGCTGG + Intergenic
1033428674 7:141268420-141268442 TGTGTATGACCTGCTGCTGCAGG - Intronic
1035832033 8:2706207-2706229 TGTAAATAAACAAGTGCTGCAGG + Intergenic
1038842138 8:31194746-31194768 AATGAATGCCCAGCTGCTGCTGG + Intergenic
1041036553 8:53797329-53797351 TGGGAAAGAACTGCTGCTGCCGG - Intronic
1041197501 8:55415561-55415583 TGTTAATGAACTATTGCTGCAGG + Intronic
1042506020 8:69561643-69561665 TGTAAATGAACCCCTGCTGATGG - Intronic
1042538912 8:69887916-69887938 CATGATTGAACAGCGGCTGCTGG - Intergenic
1043147074 8:76672794-76672816 TGGGAGTGGACAGCAGCTGCTGG - Intergenic
1043401823 8:79891837-79891859 TGTGAAAGAGCAGCGGCTGCCGG - Intergenic
1043579587 8:81697025-81697047 TGTGAATGGTCTGCTGCTACGGG - Intergenic
1049918703 9:343612-343634 TGAAAATGAAGAGCTGCTCCAGG - Intronic
1049923013 9:382577-382599 TGTGAGTTCAAAGCTGCTGCAGG + Exonic
1050036316 9:1439655-1439677 TGTGAATTAACACCTCCTGGGGG - Intergenic
1051643724 9:19247900-19247922 TTTGAAGGTAAAGCTGCTGCTGG - Intronic
1052045180 9:23785689-23785711 TGTCAATGAGCAGCTGCTCCAGG + Intronic
1052339782 9:27353708-27353730 TGTGAATGAAGAGCTGATTAGGG - Intronic
1054735069 9:68742770-68742792 TGTGAATGGGCAGCTGATGTGGG + Intronic
1056265574 9:84893502-84893524 TGCCAATGAGAAGCTGCTGCAGG - Intronic
1057317279 9:93977787-93977809 AAAGAATGAACAGATGCTGCTGG + Intergenic
1058838049 9:108877053-108877075 CTGGAAGGAACAGCTGCTGCTGG - Intronic
1058907685 9:109495144-109495166 TTGGAATGAAGAGCTGATGCTGG + Intronic
1059313808 9:113407076-113407098 TGTGAATGAGCAGCACCTGCTGG + Intergenic
1061079468 9:128361320-128361342 AGTGAATGAACAGATGAGGCGGG - Exonic
1061147074 9:128806290-128806312 TGTGAATATGCGGCTGCTGCAGG + Exonic
1061163361 9:128908868-128908890 TGTTGATGGACAGCTTCTGCAGG - Exonic
1061736110 9:132660505-132660527 GGAGAATGGACAGCTGCTGCTGG - Intronic
1062227813 9:135463456-135463478 TGCCAATGCACAGCTGCTGCTGG + Intergenic
1186188297 X:7043123-7043145 TGTGAATGATCACCTGCCCCAGG - Intergenic
1188153884 X:26716774-26716796 TGTGCATGTTCTGCTGCTGCAGG + Intergenic
1189893933 X:45633656-45633678 TGTGTAGGAGCAGCTGCTGAAGG + Intergenic
1190135565 X:47793884-47793906 AATGAATGAAAAGCTGTTGCAGG - Intergenic
1194931758 X:99896854-99896876 TGTGGATGGTCTGCTGCTGCAGG + Intergenic
1195162401 X:102183451-102183473 TGTGAATGAACAGGTGTCTCAGG + Intergenic
1195897670 X:109763719-109763741 TATGTATGATCTGCTGCTGCAGG + Intergenic
1196179787 X:112677313-112677335 AGTGACTTAACAGCTGCTGAGGG + Intronic
1196835497 X:119810029-119810051 TGTGGATGACCTGCTGCTGCAGG - Intergenic
1196836385 X:119817939-119817961 TGTGGATGACCTGCTGCTGCAGG - Intergenic
1197282700 X:124555779-124555801 TGTGGATGACCTGCTGCTGCAGG - Intronic
1199454066 X:148008102-148008124 TGGGAATAACCAGATGCTGCAGG - Intronic