ID: 904878797

View in Genome Browser
Species Human (GRCh38)
Location 1:33678530-33678552
Sequence TGTGAATGAACAGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904878790_904878797 30 Left 904878790 1:33678477-33678499 CCATCGCTGATGTGAGTCATGAT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 904878797 1:33678530-33678552 TGTGAATGAACAGCTGCTGCAGG 0: 1
1: 0
2: 3
3: 25
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904878797 Original CRISPR TGTGAATGAACAGCTGCTGC AGG Intronic