ID: 904881184

View in Genome Browser
Species Human (GRCh38)
Location 1:33698399-33698421
Sequence GGGGCTTTTGCCTGAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904881184_904881186 -4 Left 904881184 1:33698399-33698421 CCTGGAACTCAGGCAAAAGCCCC 0: 1
1: 0
2: 0
3: 28
4: 229
Right 904881186 1:33698418-33698440 CCCCATCTCTCCCTTTCTAATGG 0: 1
1: 0
2: 1
3: 32
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904881184 Original CRISPR GGGGCTTTTGCCTGAGTTCC AGG (reversed) Intronic