ID: 904881184

View in Genome Browser
Species Human (GRCh38)
Location 1:33698399-33698421
Sequence GGGGCTTTTGCCTGAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904881184_904881186 -4 Left 904881184 1:33698399-33698421 CCTGGAACTCAGGCAAAAGCCCC 0: 1
1: 0
2: 0
3: 28
4: 229
Right 904881186 1:33698418-33698440 CCCCATCTCTCCCTTTCTAATGG 0: 1
1: 0
2: 1
3: 32
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904881184 Original CRISPR GGGGCTTTTGCCTGAGTTCC AGG (reversed) Intronic
900160494 1:1220984-1221006 GGGGCTTGTGCCTGTAATCCCGG + Intronic
901517858 1:9761357-9761379 GTGGCGTGTGCCTGAGGTCCCGG + Intronic
901691256 1:10974652-10974674 GGCACCTTTGCCTGAGTTCTTGG - Intronic
901740085 1:11335969-11335991 GTGGCTCCTGCCTGAGTTCCTGG + Intergenic
902329309 1:15723345-15723367 GGGACTTTTTCCAGATTTCCGGG - Intronic
904259414 1:29279868-29279890 GGGGCTGGTGCCTGAGGTCAGGG + Intronic
904832297 1:33312796-33312818 GGGGCTTTTACCTGAATTTAGGG + Exonic
904881184 1:33698399-33698421 GGGGCTTTTGCCTGAGTTCCAGG - Intronic
905880338 1:41459265-41459287 GGGGCTTAGGCCTGAGTTTCTGG + Intergenic
906110362 1:43318300-43318322 GGGCCTCTCTCCTGAGTTCCAGG - Intronic
910493402 1:87798401-87798423 TAGCCTTTTGCCTGAGTTTCAGG + Intergenic
910804642 1:91178370-91178392 GGGGCTCTTGCCTGGCTTCTGGG + Intergenic
914050520 1:144126630-144126652 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
914128662 1:144838815-144838837 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
916078662 1:161218331-161218353 GGGGCTCTAGCCTGGGTTTCCGG + Intronic
916312696 1:163414584-163414606 GTGGCTTTTGCCTGTAATCCAGG + Intergenic
920048675 1:203150274-203150296 GGGGCTTCTGCCCCAGCTCCAGG - Intronic
922619302 1:226980485-226980507 GGGGCTTGGGCCTGGGTCCCTGG - Intronic
922700466 1:227756711-227756733 GGGACTTTTGCCTGGGGTCCTGG + Intronic
923328344 1:232899901-232899923 GGGCTTTGTGTCTGAGTTCCAGG + Intergenic
923813051 1:237342274-237342296 GTGGCTTGTGCCTGTGGTCCTGG - Intronic
1063584952 10:7344067-7344089 GGGGCTTTTTCGTGCCTTCCTGG + Intronic
1064990759 10:21254841-21254863 GGGGCTTGTGTCTTACTTCCTGG + Intergenic
1067831686 10:49614344-49614366 GGGGCTGCAGCCTGGGTTCCCGG - Exonic
1069822857 10:71238270-71238292 GGGGATTTTGCCTGACTTTCAGG - Intronic
1069858844 10:71457650-71457672 GGGGCCGGTGCCTGAGTCCCAGG + Intronic
1071478706 10:86046498-86046520 GTGGCCTGTGGCTGAGTTCCAGG + Intronic
1073142151 10:101255222-101255244 GGGGCTTTGGCCAGAGTCCAGGG + Intergenic
1076729545 10:132431512-132431534 GGAGCTCTTGTCTGAGTTCCAGG + Intergenic
1076745113 10:132509079-132509101 GGGGCTGTTGGCTGAATCCCTGG - Intergenic
1083720228 11:64600273-64600295 GGGGCTTGTCCCTGACTTTCAGG - Intronic
1084232344 11:67762090-67762112 GAGGCTTGGGCCAGAGTTCCAGG - Intergenic
1086658097 11:89383389-89383411 GGGCCTTGGGCCAGAGTTCCAGG - Intronic
1087628950 11:100628089-100628111 GGGTCTTTTGCCTCATTTTCTGG - Intergenic
1088137330 11:106573397-106573419 TGGACTTTTGACTGAGGTCCTGG + Intergenic
1090467340 11:126946130-126946152 GGGGCTTGAGCCTTAGTTCTAGG - Intronic
1091551056 12:1535091-1535113 GGGGCTGGTGCCTGAGTTCTAGG + Intronic
1093368330 12:18332715-18332737 GGGGTTTTTGCCTGGGCTCAGGG + Intronic
1094838494 12:34333311-34333333 GGGACTTTTGCCTGAGGACGGGG - Intergenic
1095977703 12:47951108-47951130 AGGGCCTTTGCCTGAACTCCAGG - Intergenic
1097973241 12:65657653-65657675 TGGGCTTTATCCTGAGATCCAGG + Intergenic
1100459043 12:94780408-94780430 GGGCCTTGTGCCTGCGTACCTGG - Intergenic
1101611489 12:106296552-106296574 GTAGCTTTTACCTGAGTTCCTGG - Intronic
1101921841 12:108939310-108939332 GGGGCTGTTTTCAGAGTTCCAGG + Intronic
1103612508 12:122132599-122132621 TGTGCTTCTGCCTGAGTGCCAGG + Intronic
1104798000 12:131533114-131533136 GGCATTCTTGCCTGAGTTCCGGG - Intergenic
1104931083 12:132339815-132339837 GGGGCTTCTGCCTCAGTGACCGG - Intergenic
1105521800 13:21137815-21137837 GTGGCTTGTGCCTGTGTTCCCGG + Intergenic
1105673346 13:22644098-22644120 GGGGACTTCGCCTGAGATCCTGG - Intergenic
1106173318 13:27307798-27307820 GCGGCTGTTGCCTGAGACCCAGG + Intergenic
1106731291 13:32544038-32544060 GTGGCTTTTGCCTGTAATCCCGG - Intergenic
1108282027 13:48870428-48870450 GAGGCTTGGGCCAGAGTTCCAGG + Intergenic
1108513033 13:51172274-51172296 GAGGCTTGGGCCAGAGTTCCAGG - Intergenic
1108803836 13:54130996-54131018 GAGGCTTGGGCCAGAGTTCCAGG + Intergenic
1108814163 13:54269263-54269285 GAGGCTTGGGCCAGAGTTCCAGG - Intergenic
1108913381 13:55581550-55581572 GAGGCTTGGGCCAGAGTTCCAGG + Intergenic
1108919509 13:55658279-55658301 GAGGCTTGGGCCAGAGTTCCAGG + Intergenic
1108952910 13:56115723-56115745 GAGGCTTGGGCCAGAGTTCCAGG + Intergenic
1108970522 13:56369460-56369482 AGGACTTTTGCCTCAGTTTCTGG + Intergenic
1109399076 13:61801217-61801239 GTGGCTTTTTCCTGAATTACAGG - Intergenic
1111036485 13:82681564-82681586 GTACCTTTTGCCTGAGTACCAGG + Intergenic
1111436156 13:88211102-88211124 TGGGCTTTTGCCTGAGTGAAAGG + Intergenic
1113058153 13:106291319-106291341 AGACCTTTTGTCTGAGTTCCAGG - Intergenic
1114926929 14:27414043-27414065 GGGGCTATTGAATGATTTCCTGG + Intergenic
1121336983 14:93083595-93083617 GGGGCTTTTTCCCCAGTGCCTGG - Intronic
1121442071 14:93955738-93955760 GGGGACTTTGCCTGAGGTCATGG - Intronic
1122072855 14:99215957-99215979 GGGGCTTTTTCCTCTGTTCCCGG - Intronic
1122329686 14:100904071-100904093 GGGGCATTTCCCTGAGGTGCCGG - Intergenic
1122842110 14:104471043-104471065 AGGGCTTGAGCCTGAGATCCTGG + Intergenic
1123038626 14:105481460-105481482 GGGGGTTTTGGCTGAATTCCAGG - Intergenic
1123057893 14:105580584-105580606 GGGGCTTGCACCTGAGTTCCTGG + Intergenic
1123082177 14:105700517-105700539 GGGGCTTGCAGCTGAGTTCCTGG + Intergenic
1123420395 15:20125940-20125962 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
1123445464 15:20327584-20327606 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
1123529619 15:21132476-21132498 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
1123821581 15:24036003-24036025 GGGGCTATTGCGTGAGTACGAGG - Intergenic
1124722434 15:32121685-32121707 CGGGTTTGTGCCTGAGGTCCTGG + Intronic
1126874187 15:53021018-53021040 GGGGTTTTTGGCTTAGCTCCAGG + Intergenic
1128231103 15:66036040-66036062 TGGGCTTTCTCCCGAGTTCCAGG + Intronic
1129458733 15:75689348-75689370 GCGGCTTCTGCGTGTGTTCCAGG + Exonic
1130742346 15:86614245-86614267 GGGGCTCTTGCCTTAATTTCTGG + Intronic
1132114364 15:99124927-99124949 GGGGCTTCTGGCTGGGTTCAGGG - Intronic
1132561885 16:598972-598994 TGGGCTTTCGCCTGACTTCCTGG + Intronic
1132562077 16:600167-600189 TGGGCTATGCCCTGAGTTCCCGG + Intronic
1132932562 16:2466413-2466435 GGGGCTTATGCCTGTAATCCCGG + Intergenic
1135668079 16:24352492-24352514 AGGGCTTTTGCCTGGGTTATGGG + Intronic
1136535643 16:30897486-30897508 AGGCCATTTGCATGAGTTCCAGG - Intronic
1139323015 16:66130520-66130542 GAGGCTTCTTCCTGAGTACCAGG - Intergenic
1141191568 16:81828764-81828786 GTGGCATTTTCCTGAGTGCCTGG + Intronic
1141251379 16:82362066-82362088 GGGGCTTTAGCCTGGTGTCCTGG + Intergenic
1141844202 16:86596046-86596068 AGGGCTCTTGCCTGTGTGCCAGG + Intergenic
1144049782 17:11488725-11488747 GGGGCTTCTGCCTGAATTACTGG - Intronic
1144957951 17:19028980-19029002 GGGCCTTCTGCCTGGGTACCCGG - Intronic
1144977207 17:19145540-19145562 GGGCCTTCTGCCTGGGTACCCGG + Intronic
1147253006 17:39164982-39165004 GGAGCTCTTCCCTGGGTTCCCGG - Intronic
1148772857 17:50076938-50076960 GGGGCTCTTGGCTGAGTCCTGGG + Intronic
1149697948 17:58631421-58631443 GGGGCTTTTTTCTGTGGTCCTGG - Intronic
1150383730 17:64740985-64741007 GGGGCTATTGCCTGAAATCTTGG + Intergenic
1151980182 17:77504020-77504042 GGGGCTTTTGAGTGTCTTCCTGG - Intergenic
1152042993 17:77917162-77917184 GGGGCTTTGGCCTGAACCCCAGG + Intergenic
1152643073 17:81457236-81457258 GGGGCAGGTGCCTGAGGTCCTGG - Intronic
1153015936 18:582755-582777 TGGGCTTCAGCCTGGGTTCCTGG - Intergenic
1154021829 18:10669657-10669679 GAGGCTTTTGCCTGACACCCTGG + Intronic
1156722917 18:40092379-40092401 GGGGTTCTTGCCTGATATCCTGG + Intergenic
1156958216 18:42993282-42993304 GAGGCTTGGGCCAGAGTTCCAGG - Intronic
1157103302 18:44749499-44749521 GGAGCTTTTCCCTGGATTCCAGG + Intronic
1157794522 18:50561017-50561039 GGGGCTGTGGCGGGAGTTCCAGG + Intronic
1160832733 19:1111236-1111258 GAGCCTTTTGCCTGACTTACAGG + Intronic
1161041558 19:2113261-2113283 AGGGCTCTTCCCTGAGTGCCAGG + Intronic
1161078480 19:2298498-2298520 GTGGCTCATGCCTGTGTTCCCGG - Intronic
1161252063 19:3285720-3285742 GGGGCTATTGCCTGAGGGGCGGG - Intronic
1162001418 19:7746956-7746978 GGGACTTGGGCCTGGGTTCCTGG - Intronic
1162545356 19:11325803-11325825 GGGGCTTATGCCTGTAATCCTGG + Intronic
1162557920 19:11399206-11399228 GTGGCTATTGCCTGTGATCCCGG - Intronic
1163566974 19:18057769-18057791 GGGACTTTTGCCAGAGTGCATGG - Intergenic
1163575467 19:18108824-18108846 GCTGCTTTTGCCTGAGTTGGGGG + Intronic
1164743760 19:30595760-30595782 AGGGCCTTTCCCTGACTTCCTGG + Intronic
1165346307 19:35250525-35250547 GGGGTTGTAGCCTGGGTTCCCGG - Exonic
1165595732 19:37010019-37010041 GGGGCCTCAGCCTGAGTTCCAGG + Intronic
1165608974 19:37133996-37134018 TGGACTTCTTCCTGAGTTCCTGG + Intronic
1166127851 19:40726659-40726681 GGGGGTCTTGCCTTATTTCCAGG - Intronic
1166561186 19:43733396-43733418 GGGGCTTCCACCTGACTTCCTGG - Exonic
1168248180 19:55124949-55124971 GGGCCTTGGGCCGGAGTTCCAGG - Intergenic
1168306264 19:55437914-55437936 GGGGCTGAGGCCTGAATTCCTGG - Intronic
1168596442 19:57681715-57681737 GGGGCTTTTCCCAGATTTCTGGG - Intergenic
1202689927 1_KI270712v1_random:79268-79290 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
925262583 2:2541413-2541435 TGAGCTCTTGCCTGAGTTCTGGG + Intergenic
925425483 2:3746081-3746103 GAGGCTGTTGGCTGAGTGCCAGG + Intronic
925991913 2:9260949-9260971 GGGGGTTGTGCCTGTGTCCCTGG + Intronic
929763822 2:44827830-44827852 GTGTGTTTTGCCTGAGTTCCTGG + Intergenic
931433912 2:62231154-62231176 GTGGCTTATGCCTGTGATCCCGG + Intergenic
931647309 2:64436199-64436221 GAGGTTTTTGCCTGGGTTACTGG - Intergenic
931838639 2:66126576-66126598 GGGACTTTGGCCAGAGTTCATGG - Intergenic
933298839 2:80520548-80520570 GGGCCTTTTTCCGGAGTTGCAGG + Intronic
933956491 2:87376755-87376777 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
934240637 2:90268781-90268803 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
934272555 2:91547978-91548000 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
934561286 2:95314841-95314863 GGGGCCTTTGCGTGTTTTCCCGG + Intronic
934564750 2:95332149-95332171 CGGCCTTTTGCCTGTGCTCCTGG - Intronic
934740034 2:96713622-96713644 GGAGCTGTTTCCTGAGATCCTGG - Intronic
936525339 2:113237369-113237391 GGGCCATTTACCTGAGTTCCAGG - Intronic
937347202 2:121133412-121133434 GGAGCTTCTACCTGAGTTGCAGG - Intergenic
939001539 2:136741200-136741222 GGGGCTTTAGCTTGAGTTTGGGG + Intergenic
939808512 2:146804421-146804443 GGGGCTTCTGCCTCAGTTTTTGG - Intergenic
944390309 2:199211236-199211258 GGGGCTTTGGCCCAAGTTCCAGG - Intergenic
947917327 2:233841430-233841452 GGGAATATTGCCTGAGTCCCAGG - Exonic
947921855 2:233883119-233883141 GATGCTTTTGCCTGTGTTCAAGG + Intergenic
947932894 2:233978496-233978518 GGGGCTTTTTTCTTCGTTCCTGG + Intronic
948523925 2:238558986-238559008 GGGGCTGGCGCCTGAGTGCCAGG + Intergenic
1169257689 20:4111364-4111386 TGGGCTCTGGCCTGAGTTCCTGG - Intergenic
1169422252 20:5470122-5470144 GGGGCTTCTGCCTGGCTACCTGG + Intergenic
1170212286 20:13857546-13857568 GGCCATTTTGCCTGAGTCCCTGG - Intronic
1171255227 20:23685331-23685353 GGTGCTTTGGTCTGAGGTCCTGG - Intergenic
1172009853 20:31840333-31840355 AAGGCTTTTGACTCAGTTCCTGG - Intergenic
1172753906 20:37270122-37270144 TGGGCTTTCTCCTGAGATCCTGG - Intergenic
1173847668 20:46198340-46198362 GGGTGTTTGGCCTGAGTTTCTGG - Intronic
1175280704 20:57802238-57802260 GGGGCTTTATCCTGAGGCCCAGG - Intergenic
1175653367 20:60748282-60748304 GTGGCTTTCTCCTGAGTTCTGGG - Intergenic
1176129573 20:63490983-63491005 GTGGCTTTTCCGTGGGTTCCTGG - Intronic
1177936795 21:27358280-27358302 TGGGGTTTTGCCAGAGTTCTTGG + Intergenic
1178935795 21:36860380-36860402 GGGGAATTAGCCTGACTTCCTGG - Intronic
1181462911 22:23095817-23095839 GGTGCTCTTGCCTGAGTTGCTGG - Exonic
1182548013 22:31086715-31086737 AGGGCTCTGGCCTGAGTTTCAGG + Intronic
1183271844 22:36867296-36867318 GGGGCTCTGGCCAGGGTTCCTGG + Intronic
1183381536 22:37492713-37492735 GGTGCTGTTGCCTGAGTGCCTGG - Exonic
1183728186 22:39601158-39601180 GGGTCTTGTGCCTGCTTTCCTGG + Intronic
1184653951 22:45931910-45931932 GTGACTTCTGCCTGGGTTCCTGG - Intronic
949934796 3:9108348-9108370 GTGGCTCGTGCCTGAGTCCCAGG + Intronic
950276680 3:11667239-11667261 GGGGCTTATGACTGAGTGACAGG + Intronic
954153380 3:48671001-48671023 GGGGGTTTGGGCTGACTTCCTGG - Intergenic
959871761 3:111337133-111337155 TGGGCATTTGCCTGATTTCATGG + Intronic
961060866 3:123826860-123826882 GGTGCATTTGCCTGGGTTCTAGG - Intronic
963618394 3:147572625-147572647 GTGGCTCATGCCTGTGTTCCCGG - Intergenic
964807143 3:160622872-160622894 GAGGACATTGCCTGAGTTCCTGG + Intergenic
967005318 3:185377834-185377856 GGGCCTTGGGCCAGAGTTCCAGG + Intronic
967117213 3:186352758-186352780 GAGGCTTTTGAGGGAGTTCCAGG - Intronic
967959648 3:194910284-194910306 GAGGCTTTTGCCTGGCTTCCGGG + Intergenic
968993417 4:3929786-3929808 GAGGCTTGGGCCAGAGTTCCAGG - Intergenic
971375554 4:26053161-26053183 GGGGATTTTGCTCGAGTGCCTGG + Intergenic
975105159 4:70559672-70559694 GGTGCTTTTTCTTGAGTCCCAGG - Intergenic
976739921 4:88347059-88347081 GAGGCTTGGGCCAGAGTTCCAGG + Intergenic
979560242 4:122094042-122094064 GGGTTTTTGGCCTGAGTACCTGG + Intergenic
985425252 4:189823841-189823863 TGGGCTTTGGCATGACTTCCTGG - Intergenic
986637150 5:9834638-9834660 GGAGCTATTGCCTGTGTCCCTGG - Intergenic
987218563 5:15765724-15765746 ATGGCTCTTTCCTGAGTTCCAGG + Intronic
988669502 5:33365996-33366018 GGGCCTTTGGCCTGGGTTCTGGG - Intergenic
989688866 5:44118040-44118062 GGGCCTTGAGCCAGAGTTCCTGG + Intergenic
989782992 5:45291796-45291818 GTGGCTTGTGCCTGTATTCCCGG - Intronic
994306503 5:98211804-98211826 CGGGCTTCTTCCTGGGTTCCTGG - Intergenic
994814895 5:104573170-104573192 GGGGCTTTTTCCTGGTTTACGGG - Intergenic
996017737 5:118559396-118559418 AAGGCATTTGCCTGTGTTCCAGG + Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
996685430 5:126274816-126274838 GTGGCTTTTGTCTAATTTCCAGG - Intergenic
998130940 5:139650756-139650778 GGGGCTTCGGTCTCAGTTCCCGG - Intronic
999120874 5:149208573-149208595 GGGACTTTTGCTGGAGTTCCTGG - Intronic
1000519373 5:162278695-162278717 GAGGCTTGGGCCAGAGTTCCAGG + Intergenic
1001217987 5:169873921-169873943 GAGGCTTTGGCCTGCATTCCAGG + Intronic
1002432332 5:179210790-179210812 GGGGCTTCAGCCTGACTGCCGGG - Intronic
1002452066 5:179324892-179324914 TGGGCTTTTGCCTGAATGCTGGG - Intronic
1002604036 5:180371437-180371459 CGGGCTTTGGCATGAGCTCCAGG + Intergenic
1002921379 6:1575672-1575694 GGGGGTTTTGGCTGTCTTCCTGG - Intergenic
1003603574 6:7541093-7541115 GGGGCAATTTCCTGAATTCCTGG + Intergenic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1004349712 6:14880441-14880463 GGGGCTGCTGCCTGAGCCCCTGG - Intergenic
1004415537 6:15420802-15420824 AGGGTTTTTGCCTGAGTAGCAGG - Intronic
1007350890 6:41272700-41272722 AGGGGCTTTGCCTGAGTACCAGG + Intronic
1007722232 6:43891803-43891825 GGGGCTTTTCCCTGAAATGCAGG - Intergenic
1010058505 6:71592624-71592646 AAGGCTTTGGCCTAAGTTCCTGG + Intergenic
1010750731 6:79614004-79614026 GCGGCTTTGACCTGAGTTTCTGG + Intergenic
1011830534 6:91365877-91365899 TGGGCTTGTGCCTGAGTTCTAGG - Intergenic
1012529630 6:100220007-100220029 TGGGCTTTTGCCCAAGTTTCTGG - Intergenic
1013714028 6:112936109-112936131 GGCACTTATGCCAGAGTTCCAGG - Intergenic
1014295512 6:119612581-119612603 GGGTCTTGTGCTTGAGTTTCAGG + Intergenic
1015353017 6:132245328-132245350 GGGGATTATGCCTTAATTCCAGG - Intergenic
1015497592 6:133896958-133896980 AGAGCTTTTGACTGAGTTCTTGG + Intergenic
1020973849 7:14981521-14981543 GGGCCTTTTGCCTCAGTTGCTGG + Intergenic
1021569788 7:22053210-22053232 TTCTCTTTTGCCTGAGTTCCTGG + Intergenic
1026221149 7:68398709-68398731 GGGGCTTTTGCTTCTGTTCATGG + Intergenic
1026540250 7:71274111-71274133 GTGGCTTTTGCCTGTTTCCCTGG + Intronic
1026942157 7:74293430-74293452 GGGGCTGTAGCCTGAGTCCACGG + Intronic
1029712776 7:102308630-102308652 GGGTCCCTGGCCTGAGTTCCAGG + Intronic
1033065586 7:138150772-138150794 GGGGCTTTTAAGTGGGTTCCAGG - Intergenic
1034390188 7:150780970-150780992 GGGGCTCTGTCCTTAGTTCCAGG - Intergenic
1035398577 7:158550582-158550604 GGAGCCTTTGGCTGAGTCCCGGG - Intronic
1035973200 8:4276208-4276230 TGGGCATTTGCGTTAGTTCCAGG - Intronic
1036210084 8:6834625-6834647 GGGACTTTTCCCTGAGTTCGCGG - Intronic
1036747406 8:11419771-11419793 GGGCCTTTTCCCTGAATTCCAGG + Intronic
1040305625 8:46210341-46210363 GGGGCTTTTGCTTGAGACACAGG - Intergenic
1041651806 8:60309806-60309828 GAGCCTTGGGCCTGAGTTCCAGG + Intergenic
1042898451 8:73695926-73695948 CGGGTTTTTCCCTGGGTTCCAGG - Intronic
1043007977 8:74844389-74844411 GGGGCTTTTTCCTGAGATGGAGG - Intronic
1044277715 8:90321767-90321789 GGGGCTTTTCTGTGAGTTCTGGG - Intergenic
1046671307 8:117059588-117059610 TGGGCTTTTGCCTGAAGTGCAGG - Intronic
1047393348 8:124472264-124472286 GTGGCTTATGCCTGAAATCCCGG - Intergenic
1047408668 8:124606415-124606437 GGGGCTTGTGCCTGTAGTCCCGG - Intronic
1048595963 8:135866550-135866572 GCAGTTTTTGCCTGGGTTCCTGG + Intergenic
1049335239 8:142080828-142080850 GGGGCTTCAGCGTGAGTCCCTGG - Intergenic
1049378944 8:142302521-142302543 GGGGCCTGTGGCTGAGTCCCTGG - Intronic
1049678275 8:143903173-143903195 GGGGCAGCTGCCTGAGTCCCCGG - Intergenic
1051052659 9:12950726-12950748 GAGGCTTGGGCCAGAGTTCCAGG - Intergenic
1052952444 9:34223846-34223868 GGCTCTTTTTGCTGAGTTCCTGG + Intronic
1056812772 9:89777108-89777130 GGGGCTCTCTCCTCAGTTCCTGG + Intergenic
1058940388 9:109807910-109807932 GGGGCTTTTTCCTGTTTTGCTGG + Intronic
1059929492 9:119247061-119247083 TGTGCTCTTGTCTGAGTTCCTGG - Intronic
1060917617 9:127400465-127400487 GTGTCTTATGACTGAGTTCCAGG + Intronic
1061053008 9:128207087-128207109 GGGACTTTGACCTGAGCTCCTGG + Intronic
1062264073 9:135678819-135678841 CAGGCCTTTGCCTGAGCTCCTGG + Intergenic
1062604660 9:137341181-137341203 GTGGCCTGTGCCTGTGTTCCTGG + Intronic
1186431677 X:9510398-9510420 GGGGCTTTTTCTTTAGGTCCTGG + Intronic
1186827951 X:13360703-13360725 GGGTCATTGGCCTGACTTCCAGG + Intergenic
1187529106 X:20080558-20080580 AGGGCTTTTGCGTGAGCTTCTGG + Intronic
1187672470 X:21682150-21682172 GGGGCCTTTTGGTGAGTTCCAGG + Intergenic
1188608761 X:32069738-32069760 GTGCATTTTGCCTGAGTTCAGGG + Intronic
1189651358 X:43193134-43193156 GAGGCTTATGCATGAGTTCCTGG - Intergenic
1196687218 X:118521672-118521694 GTGGCTTTTGCAAGAGCTCCAGG - Intronic
1198578585 X:138037546-138037568 AAGGCTTTTGACTGAGTTCCTGG + Intergenic
1199576516 X:149318072-149318094 GAGCCTTGTGCCAGAGTTCCAGG - Intergenic
1199763397 X:150923151-150923173 GGGGCTTATGCCTGTAATCCCGG + Intergenic