ID: 904883234

View in Genome Browser
Species Human (GRCh38)
Location 1:33716211-33716233
Sequence CTCCTTCTGCTACCAGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904883234_904883235 -4 Left 904883234 1:33716211-33716233 CCAGAGACTGGTAGCAGAAGGAG 0: 1
1: 1
2: 1
3: 21
4: 330
Right 904883235 1:33716230-33716252 GGAGAGAGCAAATAGCACCATGG 0: 1
1: 0
2: 4
3: 17
4: 204
904883234_904883237 12 Left 904883234 1:33716211-33716233 CCAGAGACTGGTAGCAGAAGGAG 0: 1
1: 1
2: 1
3: 21
4: 330
Right 904883237 1:33716246-33716268 ACCATGGTCTCTTCCCCTCAGGG 0: 1
1: 0
2: 5
3: 7
4: 168
904883234_904883236 11 Left 904883234 1:33716211-33716233 CCAGAGACTGGTAGCAGAAGGAG 0: 1
1: 1
2: 1
3: 21
4: 330
Right 904883236 1:33716245-33716267 CACCATGGTCTCTTCCCCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904883234 Original CRISPR CTCCTTCTGCTACCAGTCTC TGG (reversed) Intronic
900743542 1:4344801-4344823 CTCCTTCAGATACCAGTGGCAGG + Intergenic
901057675 1:6456270-6456292 TTCCTGCTGCTTCCAGCCTCTGG - Intronic
901471575 1:9460305-9460327 CTCCTCCTGCTCCAGGTCTCAGG - Intergenic
903011769 1:20336350-20336372 CTCTGTCTTCTACCACTCTCAGG + Exonic
903054910 1:20629195-20629217 CTCTTTTTCTTACCAGTCTCAGG - Intergenic
903471088 1:23587949-23587971 TTCCTGCTGCTACTAGTCCCTGG - Intronic
904037897 1:27568614-27568636 CTCCAGGTGCTACCAATCTCCGG - Intronic
904239645 1:29135400-29135422 TACCTTCTGCTTCCAGCCTCGGG + Intergenic
904883234 1:33716211-33716233 CTCCTTCTGCTACCAGTCTCTGG - Intronic
905484874 1:38288389-38288411 CTCTCTCTGCTATCAGTTTCAGG + Intergenic
905518558 1:38579981-38580003 CTGCTTCTGCTACCAGTTCCTGG - Intergenic
905964766 1:42082318-42082340 CTGCTTCTGATATTAGTCTCAGG + Intergenic
906448405 1:45922818-45922840 CTCCATCTCCTAGCAGTCTTGGG + Intronic
907506513 1:54922996-54923018 TTCCTTCTGCTGGCAGTCACAGG + Intergenic
907610062 1:55860233-55860255 CTCCTCCAGATACCAATCTCAGG - Intergenic
908372999 1:63502420-63502442 CTCTTTTTCCTCCCAGTCTCAGG - Intronic
911785206 1:101937674-101937696 CTCTTTTTCCTCCCAGTCTCAGG + Intronic
914320269 1:146552265-146552287 CTCCTTTTGCTTCCAGTCCAGGG + Intergenic
916026417 1:160837377-160837399 CTCTCACTGCTACCAGACTCTGG - Intronic
916053698 1:161053069-161053091 CTTCTTCTGCTGTCAGTCTAGGG - Intronic
916533509 1:165680864-165680886 CTCTTTCTGTTCCCAGTTTCGGG - Intronic
916691320 1:167192711-167192733 CTCCTTCTGCCACCAAGCTATGG - Intergenic
918049038 1:180958569-180958591 CTCCTTTTCTTCCCAGTCTCAGG - Intergenic
920631740 1:207659307-207659329 CTCCTGCTGAGACCAGCCTCCGG - Intronic
921563351 1:216685389-216685411 CTCCTACTTCTACAAATCTCTGG + Intronic
921590123 1:216993316-216993338 CTCCTTCTCCTACCTTTCTATGG + Intronic
922056012 1:222043356-222043378 CCACTTCAGCTTCCAGTCTCAGG + Intergenic
923175950 1:231465299-231465321 CTCCATCTTCCACCAGCCTCTGG - Intergenic
924302367 1:242652364-242652386 CTCCTCCTGCAAACAGACTCGGG - Intergenic
924615189 1:245606476-245606498 CTGCTTCTGTGACAAGTCTCAGG + Intronic
1062895593 10:1100966-1100988 TTCCTTGTGCCACCCGTCTCAGG + Intronic
1063565534 10:7170240-7170262 CTTCTTCAGCTCCAAGTCTCAGG - Intronic
1063583308 10:7329284-7329306 TTCCTTCTGCTTCCAGCCTTGGG - Intronic
1064028250 10:11866653-11866675 CTGCCTCTGCTCCCCGTCTCTGG + Exonic
1064502359 10:15988276-15988298 CTCTTTTTCCTCCCAGTCTCAGG - Intergenic
1064629202 10:17292391-17292413 CTCCTTCTACTCCCAGCCCCTGG + Intergenic
1066670223 10:37829285-37829307 TTCCTGCTGATACAAGTCTCTGG + Exonic
1070566938 10:77610714-77610736 TTCCCTCTGCTCCCAGTCCCTGG - Intronic
1070652024 10:78244272-78244294 CTCCTTTTCTTCCCAGTCTCAGG + Intergenic
1071803283 10:89088588-89088610 CTCTTTGGGATACCAGTCTCTGG + Intergenic
1071973831 10:90935078-90935100 CTCTTTTTCCTCCCAGTCTCAGG + Intergenic
1072488140 10:95875660-95875682 CTCTTTTTGTTCCCAGTCTCAGG - Exonic
1072526719 10:96277969-96277991 CTCCTTTTCTTCCCAGTCTCAGG + Intergenic
1073730833 10:106285721-106285743 CTCTCTCTGCTCCCAGTGTCTGG - Intergenic
1074509655 10:114100894-114100916 CTCCTTCTGCTCCGGGTCCCTGG - Intergenic
1075448979 10:122534456-122534478 GACCTTCTGGTACCAGTCTTTGG + Intergenic
1075543790 10:123338211-123338233 CTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1075682309 10:124341634-124341656 CTCCTGCTGCCACCAGGCCCTGG + Intergenic
1075988494 10:126810486-126810508 CTCCTTTTCTTTCCAGTCTCAGG + Intergenic
1076215245 10:128687995-128688017 TTCCTTCTGCTACCACTTGCAGG - Intergenic
1076836603 10:133024109-133024131 CTCCTGCTCCTTCCAGTCCCGGG + Intergenic
1077892807 11:6431588-6431610 CTTGTTCTGCTACCTGTCTGTGG - Intronic
1080667823 11:34351214-34351236 CTCCATCTGCCTCCAGTCTGAGG - Intronic
1081479900 11:43476465-43476487 CTCTTTTTGCTCCCAGTTTCAGG - Intronic
1082722804 11:56699062-56699084 CTCCATCTGCCATCAGTTTCTGG - Intergenic
1082769198 11:57193186-57193208 CTCCTTTTCTTCCCAGTCTCAGG - Intergenic
1082980262 11:59114418-59114440 CCCCTTCAGCTCCCAGTCTCAGG - Intronic
1084477507 11:69397217-69397239 CTCCTGCAGCTCCCACTCTCGGG + Intergenic
1084938839 11:72601536-72601558 CTCCCTCTGCTACCATTTTGGGG - Intronic
1086371985 11:86164148-86164170 CTCCTTAGGCTTCCACTCTCTGG - Intergenic
1086605154 11:88686821-88686843 CTCCTTTTCTTCCCAGTCTCAGG + Intronic
1089841511 11:121422700-121422722 TTCCTTCTGCCTCCAGCCTCTGG + Intergenic
1090183189 11:124718539-124718561 CCCCTTCTCCTCCCCGTCTCAGG + Intergenic
1090749221 11:129731344-129731366 GTCCTTCTGCCAGAAGTCTCTGG - Intergenic
1091261883 11:134241248-134241270 CTCCCACTGCTCCCAGCCTCTGG - Intronic
1094080513 12:26529553-26529575 ATTATTCTGCTACCTGTCTCAGG - Intronic
1094489367 12:30949352-30949374 CTCTTTTTCCTCCCAGTCTCGGG - Intronic
1095526696 12:43134616-43134638 TTCCTTCTGCTCCTAGTCTAGGG + Intergenic
1095968899 12:47888015-47888037 CTCTTTCTCTTCCCAGTCTCAGG - Intronic
1096968104 12:55644600-55644622 CTCCTTGAGCTACCAGAGTCAGG + Intergenic
1097904506 12:64905997-64906019 CTCCTTCTTATGACAGTCTCAGG - Intergenic
1098198580 12:68029483-68029505 CTCCTTTTCTTCCCAGTCTCTGG - Intergenic
1098926720 12:76359604-76359626 CTCCTTTTCATCCCAGTCTCGGG - Intronic
1099507934 12:83501293-83501315 CTCCTTTTGTTCCCAGTTTCAGG + Intergenic
1101154937 12:101918412-101918434 CTCCTTCTGGTACCAGTACCAGG - Intronic
1101435991 12:104665030-104665052 CACCTTGTGCTAGCAGACTCAGG + Intronic
1102100000 12:110270833-110270855 TTCTTTCTTCTACCAGGCTCAGG + Intergenic
1102794880 12:115679958-115679980 CTCTTTTTGCTCCCAGTTTCAGG + Intergenic
1103880935 12:124165451-124165473 CTCCTTTTCTTCCCAGTCTCAGG - Intronic
1106136551 13:26977896-26977918 TTCCTTCTGCTCCCTGTTTCTGG + Intergenic
1107819532 13:44273667-44273689 CTCCTCCTCCTACCAGTCTGGGG - Intergenic
1109356904 13:61242464-61242486 CTCTTTTTGCTCCCAGTTTCAGG - Intergenic
1110203130 13:72877414-72877436 TTCCTTCTGCTTCTAGCCTCTGG + Intronic
1110495112 13:76159313-76159335 CTCCTTCTGATTTCAGTCCCTGG + Intergenic
1110543305 13:76729047-76729069 CTCCTTTTCTTCCCAGTCTCAGG + Intergenic
1111016959 13:82393946-82393968 CTCCTGCTGCTATCAGTGTCAGG - Intergenic
1112843781 13:103612637-103612659 CTACTTCCCCTCCCAGTCTCTGG - Intergenic
1113280398 13:108781957-108781979 CTCCTTTTGTTCCCAGTTTCAGG + Intronic
1113570106 13:111347490-111347512 TTCCTTATGTTACCAGTCTCAGG + Intergenic
1117198340 14:53363237-53363259 CTCTTTTTCTTACCAGTCTCAGG - Intergenic
1117915052 14:60669590-60669612 CTCCTTTTGTTCCCAGTTTCAGG - Intergenic
1120809330 14:88786836-88786858 CTCTTTTTCCTCCCAGTCTCAGG + Intronic
1121483669 14:94297352-94297374 CTCTTTCTCTTCCCAGTCTCGGG - Intergenic
1121678675 14:95774981-95775003 CTCCTTCCGCCACTAGACTCTGG - Intergenic
1122026719 14:98882998-98883020 TTCCCTCTGCTCCCAGTCCCTGG - Intergenic
1122199008 14:100110783-100110805 CTCCTCCTTCCACCAGTCCCAGG + Intronic
1122306231 14:100768473-100768495 CTCCTTCCCTTACCAGGCTCAGG + Intergenic
1124695668 15:31862434-31862456 CTCCTTTTGTTCCCAGTTTCGGG - Intronic
1125638500 15:41209539-41209561 CTCCTTCTGCTGCCACACTCAGG + Exonic
1128639485 15:69325652-69325674 CCACTTCTGCTACCAGCCCCAGG + Intronic
1130152818 15:81324262-81324284 CTCCTTGTCCTGCCAATCTCCGG - Intergenic
1132354803 15:101163294-101163316 CTGCCTCTGCTACCATTCTCTGG - Intergenic
1133378898 16:5313541-5313563 CTCTTTCTCTTCCCAGTCTCGGG - Intergenic
1133754811 16:8754408-8754430 CTCTTCCTTCTACCAGTCACCGG - Intronic
1135161710 16:20102342-20102364 CTCCTATTGCTACCTGTCTGGGG + Intergenic
1136732062 16:32423973-32423995 CTCCTTCTGGTATCTGTCTGTGG + Intergenic
1139413524 16:66786787-66786809 CTTCTTCTGCTAGCAGTGGCTGG - Intronic
1140013264 16:71157841-71157863 CTCCTTTTGCTTCCAGTCCAGGG - Intronic
1140288585 16:73628547-73628569 CTCCTTTTACTACCACGCTCTGG + Intergenic
1140917676 16:79508472-79508494 CTCCTGCTGTTGCCAGTCCCAGG + Intergenic
1202994332 16_KI270728v1_random:93271-93293 CTCCTTCTGGTATCTGTCTGTGG - Intergenic
1203021019 16_KI270728v1_random:405613-405635 CTCCTTCTGGTATCTGTCTGTGG - Intergenic
1203039354 16_KI270728v1_random:678771-678793 CTCCTTCTGGTATCTGTCTGTGG - Intergenic
1143600714 17:7944074-7944096 CTTCTTCTGTCTCCAGTCTCAGG + Intronic
1144028823 17:11301879-11301901 CTCTTTCTCTTCCCAGTCTCTGG - Intronic
1144083749 17:11787940-11787962 CCCCTTTTCCTCCCAGTCTCAGG + Intronic
1144461967 17:15465869-15465891 CTCCTGCTGCTACCACCCTCAGG - Intronic
1144689367 17:17250066-17250088 CTCCTTCTCCTCCCAGCCCCTGG + Intronic
1144997202 17:19278322-19278344 CTCCTTTTCTTCCCAGTCTCGGG - Intronic
1146010574 17:29191250-29191272 CTCCTTCAGCCACCATCCTCAGG + Intergenic
1146708587 17:35020879-35020901 CTGCTTCTCTTACCAGTCACTGG - Intronic
1148480033 17:47954017-47954039 CTCCCTATGCTACCAGTCAATGG - Intronic
1148677614 17:49454240-49454262 CGCCTCCTGCTTCCAGTCTGGGG - Intronic
1148780035 17:50116140-50116162 CTCCTTCGGCTGCCAGTGTGGGG + Intronic
1149110334 17:53020292-53020314 CTTCTTCTCTTCCCAGTCTCAGG - Intergenic
1149452092 17:56757867-56757889 CTCTTTTTCCTCCCAGTCTCAGG + Intergenic
1151775754 17:76200550-76200572 TTCCCTCTCCTACCAGCCTCTGG - Intronic
1151919804 17:77145751-77145773 CTCCCTCCACTACCAGGCTCTGG - Intronic
1152314796 17:79573876-79573898 CTCCTTCTCCTCCCTGGCTCAGG + Intergenic
1153012106 18:548562-548584 CTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1154076266 18:11204979-11205001 CTCCCTCTGCTACCTTTCTCTGG + Intergenic
1155011184 18:21780390-21780412 CTCCTACTGTTCCCAGCCTCTGG + Intronic
1157234433 18:45950562-45950584 CTCCTTTTCTTCCCAGTCTCAGG + Intronic
1157946516 18:51986875-51986897 CACCTTCTGCTACCTTCCTCTGG + Intergenic
1159306039 18:66643654-66643676 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
1159851326 18:73530138-73530160 CTCCTTTTCTTCCCAGTCTCTGG - Intergenic
1161000920 19:1910364-1910386 CCGCTTCTGCTTCCAGGCTCTGG + Intronic
1162058979 19:8083286-8083308 CTCCTTCCGCTGCCACTGTCAGG - Exonic
1162066981 19:8131746-8131768 CTCCTTCCGCTGCCAGTGCCTGG - Exonic
1164214327 19:23130381-23130403 CTCTTTCTCTTCCCAGTCTCAGG + Intronic
1165083909 19:33329380-33329402 TACCTGCTGCTTCCAGTCTCCGG + Intergenic
1165495567 19:36150544-36150566 CTGCTTCTGCTTCCAGAGTCTGG + Intergenic
1166024543 19:40069217-40069239 CTGCTTCTGCTAAGGGTCTCAGG + Intronic
1166087042 19:40483217-40483239 CTCATTCTGGTACCACTCTAGGG + Intronic
1166087081 19:40483787-40483809 CTCATTCTGGTACCACTCTAGGG - Intronic
1166746170 19:45142858-45142880 CTGGTTCTGCTCCCAGCCTCCGG - Intronic
1167245878 19:48373040-48373062 CTCCTTCTGCCACCAAACCCAGG - Intronic
1167596877 19:50432611-50432633 TTGCTTCTGCTCCCAGACTCAGG + Intergenic
1167773810 19:51541757-51541779 CTCCTTCTGCTCTCAGACTGGGG + Intergenic
925273455 2:2631792-2631814 CTCCTTGTGCTCCCAGTCTTTGG + Intergenic
925273482 2:2631965-2631987 CTCCTTGTGCTCCCAGTCCTTGG + Intergenic
925537506 2:4933268-4933290 CTCTTTTTGTTCCCAGTCTCAGG + Intergenic
926262551 2:11279855-11279877 ATCTTTCTGTTACCAGTTTCTGG - Intronic
928169851 2:28996396-28996418 CCCCTTCTCTTCCCAGTCTCTGG + Intronic
928319909 2:30274736-30274758 CTCCTTATGCTACCAATACCAGG + Intronic
929947629 2:46382491-46382513 CTCCATCTGCCATCAGTCCCGGG + Exonic
930119946 2:47752323-47752345 CTGCTGATGCTACCAGTTTCAGG + Intronic
931406273 2:61981578-61981600 CTCTTTCTCTTTCCAGTCTCGGG - Intronic
932073246 2:68642232-68642254 CTCCTTTTGTTCCCAGTTTCCGG - Intergenic
932905856 2:75750475-75750497 CTCCTTAGGCCACCAGTGTCAGG + Intergenic
935188238 2:100753673-100753695 CTCCTTCTGTGCTCAGTCTCAGG - Intergenic
935648104 2:105358462-105358484 TTCCTCCAGCTACCAGTCTAGGG - Intronic
935662204 2:105476774-105476796 CTCCTTCTACTCTCAGTATCTGG - Intergenic
936454608 2:112662776-112662798 CTCCTTGTCCAAACAGTCTCAGG + Intronic
936792507 2:116165869-116165891 CTCTTTTTCCTCCCAGTCTCAGG + Intergenic
940293238 2:152098317-152098339 CTCCTTCTCATACCTGTCTGAGG + Exonic
941545927 2:166851484-166851506 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
942054446 2:172169059-172169081 CTCCTTTTCTTCCCAGTCTCGGG + Intergenic
944899006 2:204195581-204195603 CTACCTCTGCTAACAGTTTCTGG + Intergenic
945202462 2:207296469-207296491 TCCCTCCTGCTACCAGTCTGAGG + Intergenic
945719787 2:213405632-213405654 CACCTTCTTTTCCCAGTCTCTGG + Intronic
946461251 2:219870788-219870810 CTCCTGATGCTGCCAGTCTAGGG + Intergenic
946574385 2:221058163-221058185 CACCTTCTGCTACAATTCTGAGG - Intergenic
947231071 2:227886944-227886966 CTCCTTTTGCTTACGGTCTCAGG - Intronic
947898438 2:233697905-233697927 CTCCTTCTCCTAGAAGTCTAGGG + Intronic
948776710 2:240292962-240292984 CTCCTTCTGCTACTGCTCCCTGG - Intergenic
948795875 2:240401868-240401890 CTCCTTCTTCTCCCAGGCCCTGG - Intergenic
1174865888 20:54135373-54135395 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
1175099287 20:56566971-56566993 GTGCTTCTCCTAGCAGTCTCAGG + Intergenic
1175141287 20:56861990-56862012 ACCCTTCTGCTACCAGCCTGGGG + Intergenic
1175344814 20:58265299-58265321 TTCCTTCTGCTTCCAGTCTCTGG - Intergenic
1175703945 20:61161821-61161843 CACCTTCTGCTTCCAGTGACAGG - Intergenic
1175749203 20:61483622-61483644 TTCCTTCTCATCCCAGTCTCAGG - Intronic
1175766322 20:61595194-61595216 CTCCCTCTGCTGCCAATGTCTGG + Intronic
1175867086 20:62184633-62184655 CTGCTCCTGCCTCCAGTCTCTGG + Intronic
1176658856 21:9614583-9614605 CTCCTGCTGCTAGCAGGCTGAGG - Intergenic
1176914153 21:14604689-14604711 CTCCATCTTCTCCCAGCCTCAGG - Intronic
1176935493 21:14861729-14861751 CTCCTTTTCTTACCAGTCTTGGG - Intergenic
1177117401 21:17102863-17102885 CTCTTTTTGTTCCCAGTCTCGGG + Intergenic
1177224646 21:18238269-18238291 CTCTTTCTCTTCCCAGTCTCGGG - Intronic
1177334552 21:19706883-19706905 CTCTTTTTCTTACCAGTCTCAGG + Intergenic
1177523890 21:22267775-22267797 CTCTTTTTCCTCCCAGTCTCAGG + Intergenic
1179022050 21:37649288-37649310 CTCCTTCTCCTAGAAATCTCAGG - Intronic
1179060391 21:37974048-37974070 CTCCTTCTGCTACCAGGCTCAGG + Intronic
1179385022 21:40933615-40933637 CTCCTTGTGCTGCTAATCTCTGG - Intergenic
1181465817 22:23110102-23110124 CTCCCACTGCTACTAGCCTCAGG - Intronic
1181693329 22:24578785-24578807 CTCCTTCTGCCTCCTGACTCAGG - Intronic
1181741341 22:24924132-24924154 CTCCTTCTGTGTCCAGTCTTAGG - Intronic
1181873626 22:25922800-25922822 CTTCGGCTGCTTCCAGTCTCTGG + Intronic
1183342509 22:37289475-37289497 CTCATTCTGCAACCAGCCTTGGG + Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1184861224 22:47174268-47174290 CTCCCTCTGCTCCCAGCCTTTGG - Exonic
1184962646 22:47942754-47942776 CTCCTTTTCTTCCCAGTCTCAGG - Intergenic
1185145397 22:49132272-49132294 CTCCTGGCTCTACCAGTCTCTGG + Intergenic
950021416 3:9790423-9790445 CTCCTTCCTCCACAAGTCTCTGG + Intronic
950953258 3:17023632-17023654 CTCCTTTTATTCCCAGTCTCGGG + Intronic
952100753 3:30010420-30010442 CTCCTCCCACAACCAGTCTCTGG - Intergenic
954074264 3:48165604-48165626 CTCCTTCTACAGCAAGTCTCAGG + Intronic
954708299 3:52492884-52492906 TGCATTCTGCTACCAGCCTCAGG - Exonic
954922895 3:54207063-54207085 CTGCTTCTGCTGCCACTCACTGG + Intronic
956503136 3:69909334-69909356 CTCTTTTTCCTCCCAGTCTCAGG + Intronic
957273129 3:78056635-78056657 CTCTTTTTCCTCCCAGTCTCAGG + Intergenic
958481771 3:94652858-94652880 CTCCTTTTCTTCCCAGTCTCAGG + Intergenic
958600492 3:96289960-96289982 CTCTTTTTCCTCCCAGTCTCGGG + Intergenic
960632869 3:119750780-119750802 CTCCCTCTGTTCCCACTCTCTGG - Intronic
961651656 3:128419856-128419878 CTCCTCCTGCAATCTGTCTCTGG - Intergenic
961821966 3:129579703-129579725 ATCCTTCTGCAACCAGCCTTGGG - Intronic
963190828 3:142471106-142471128 CTCCTTCCCCACCCAGTCTCTGG + Intronic
963394681 3:144716292-144716314 CTCCTTTTCTTCCCAGTCTCAGG - Intergenic
963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG + Intronic
963920240 3:150898246-150898268 CTCTTATTGCTGCCAGTCTCTGG - Intronic
964586409 3:158309777-158309799 ATCTTTCTCCTACCAGTTTCTGG + Intronic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG + Intronic
965246337 3:166275468-166275490 CTCCTGCTGCTAGCATCCTCAGG - Intergenic
965250227 3:166333120-166333142 CTCCTGCTGCTATCAATGTCGGG + Intergenic
965633851 3:170760893-170760915 GTTCTCCTGCTACCAGTCTCAGG - Intronic
966299307 3:178461095-178461117 CTCTTTTTCTTACCAGTCTCTGG + Intronic
967474705 3:189902942-189902964 CTCCTTGTGCTTCCTGTCCCAGG + Intergenic
968118587 3:196108493-196108515 CTCCCTCTGCTCCCAGCCTCGGG - Intergenic
969459664 4:7322248-7322270 CCCCCTCTGCTCCCACTCTCAGG - Intronic
970398908 4:15699536-15699558 CTCTTTCTGTTCCCAGTTTCAGG - Intronic
970828715 4:20309715-20309737 CTCCTTCTACTAACAATCTTTGG + Intronic
971702611 4:29998044-29998066 TCCCTTCTACTACCAGTCTTTGG - Intergenic
972856618 4:43114577-43114599 CGCCTTCTGTAACCACTCTCTGG - Intergenic
973005553 4:45001613-45001635 CTCCTTTTCTTCCCAGTCTCGGG - Intergenic
974104654 4:57456147-57456169 CTCCTTTTCTTCCCAGTCTCAGG - Intergenic
976688542 4:87843310-87843332 TTCCATCTTCTACAAGTCTCCGG + Intronic
976987230 4:91316869-91316891 CATCTTCTGCCACCAGCCTCTGG - Intronic
977769080 4:100835671-100835693 CTCTTTATCTTACCAGTCTCAGG + Intronic
978178655 4:105766169-105766191 TTCCTGCTGTTACCATTCTCTGG - Intronic
978976903 4:114888169-114888191 CTCCTTCTGCCACCAAGCTGGGG - Intronic
981050060 4:140300870-140300892 CTTCTTCTGCAATGAGTCTCAGG + Intronic
982106001 4:152012595-152012617 CACAGACTGCTACCAGTCTCTGG - Intergenic
982222516 4:153137130-153137152 CTCCTTCTGCATCCAGTGCCTGG + Intergenic
984922675 4:184779421-184779443 CTCTTTTTGTTCCCAGTCTCAGG + Intronic
985548516 5:521792-521814 CTCCTTGTGCAGCCAGCCTCAGG - Intronic
985940041 5:3127960-3127982 CCCCATCTGCTACCAGTGGCTGG - Intergenic
986877871 5:12132661-12132683 CTCCTTTGGCTACCAGTGTCAGG - Intergenic
986894029 5:12343820-12343842 CTCCTTCTGCTTAATGTCTCTGG + Intergenic
988586630 5:32512711-32512733 CTGGTTCTGTTACCAATCTCAGG - Intergenic
988744527 5:34121342-34121364 CTCCTTTTCTTCCCAGTCTCAGG - Intronic
989025965 5:37068831-37068853 CTCTTTCTGAAACAAGTCTCAGG + Intergenic
989783396 5:45297572-45297594 CTCCTTCTGCTTCCATTTTCTGG - Intronic
990517006 5:56539600-56539622 CTTCTTGTGCTTCCAATCTCTGG - Intronic
991104766 5:62831914-62831936 CTCCTTTTCTTCCCAGTCTCGGG - Intergenic
991105044 5:62833836-62833858 CTCCTTTTCTTCCCAGTCTCAGG - Intergenic
991520359 5:67490541-67490563 CTCTTTTTCTTACCAGTCTCAGG - Intergenic
996952580 5:129145648-129145670 CTCACACTCCTACCAGTCTCTGG + Intergenic
997628524 5:135348526-135348548 TTCCTTCTTCCAGCAGTCTCAGG + Intronic
999608454 5:153342985-153343007 CTCCTCCTGTTACTAGTCTTGGG - Intergenic
1000043058 5:157499572-157499594 CTCCTGCTGCCACCAGTGTAAGG - Exonic
1001913639 5:175541530-175541552 CTCCTTCTGCTACAGCTTTCAGG + Intergenic
1006683579 6:35814427-35814449 CTCCTTCTGTTAACAGCCTCAGG - Intronic
1007215430 6:40233899-40233921 CTTCTCCTCCTCCCAGTCTCTGG + Intergenic
1007714055 6:43844042-43844064 CTACCACGGCTACCAGTCTCAGG + Intergenic
1008756285 6:54798330-54798352 CTCCTTTTCTTCCCAGTCTCAGG + Intergenic
1009824476 6:68847679-68847701 CTCCTTTTCTTCCCAGTCTCGGG + Intronic
1009900859 6:69806826-69806848 CTCCTTTTCTTCCCAGTCTCAGG - Intergenic
1009901127 6:69808749-69808771 CTCCTTTTCTTCCCAGTCTCAGG - Intergenic
1012726679 6:102822237-102822259 GTCCTTCTACCACTAGTCTCTGG - Intergenic
1012826480 6:104152536-104152558 CTCTTTTTGTTACCAGTTTCAGG - Intergenic
1014068993 6:117159689-117159711 CTCCCTCAGCCACCAGCCTCAGG - Intergenic
1015249131 6:131108241-131108263 CTCTTTCTGTTCCCAGTTTCAGG - Intergenic
1015369186 6:132431445-132431467 CTCCCCCTTCTCCCAGTCTCTGG + Intergenic
1017417477 6:154236379-154236401 TTCCTTCTCCTCCCAGTCCCTGG - Intronic
1017520342 6:155196183-155196205 ATCCCTCTCCTTCCAGTCTCTGG - Intronic
1017677172 6:156826452-156826474 ATCCTTCTGCTTCCAGTGTTGGG + Intronic
1018925364 6:168202060-168202082 TTCCTCCTGCTCCCACTCTCAGG + Intergenic
1019219303 6:170462034-170462056 TTCCTTCAGCTCCCAGACTCAGG - Intergenic
1019338720 7:497454-497476 CTCCCTCTGCTGCCAGTGTTTGG - Intronic
1022621410 7:31988197-31988219 CCCCTGCTGTTGCCAGTCTCTGG + Intronic
1024256045 7:47540686-47540708 CTGCTTCTGCTTCAAGTCACAGG - Intronic
1024782281 7:52865182-52865204 CTCCTCCTGCAACCACTATCTGG + Intergenic
1024930557 7:54663726-54663748 CTCTTTCTTCTTCCAGTTTCTGG - Intergenic
1028046060 7:86120412-86120434 TCCCTCCTGCTACCAGTCTGAGG - Intergenic
1028626231 7:92880711-92880733 CTCCTCCTGCTACCTGCCTATGG + Intergenic
1028999662 7:97139670-97139692 CTCCTGCTGCTATCAGTGTGGGG + Intronic
1029452222 7:100647489-100647511 CTCCTTCTTCTTCCAGTTTGGGG + Exonic
1031575315 7:123409368-123409390 CTCCTCCTGCCCCCAGCCTCTGG + Intergenic
1031911034 7:127516834-127516856 CTCCTTCTACTCCCAGTTGCTGG + Intergenic
1032433263 7:131880128-131880150 CTCCTCCTGCTCCCAGGCTGAGG - Intergenic
1034243976 7:149630616-149630638 CTCCTCCTGCTTTCATTCTCGGG + Intergenic
1034731793 7:153393269-153393291 TCCATTCTCCTACCAGTCTCTGG + Intergenic
1035215119 7:157360128-157360150 CTCCTTTTCTTCCCAGTCTCAGG - Intronic
1035427613 7:158791106-158791128 TTCCTTCTGCTCCCAGGCCCTGG + Intronic
1035759248 8:2057339-2057361 CTCCTGCAGGTACCAGTCCCTGG + Exonic
1036409743 8:8488366-8488388 CTTCTTCAGCTACTAGTCTCAGG + Intergenic
1036940570 8:13048205-13048227 CCCCTTCTGCCACCATCCTCAGG - Intergenic
1037497089 8:19450428-19450450 CTCCCTCTGTTACCAGCCACAGG + Intronic
1039071877 8:33656315-33656337 CTCCTTTTCTTCCCAGTCTCAGG + Intergenic
1040449961 8:47535237-47535259 CTCCTTCTGCTTCTATTTTCTGG - Intronic
1041667101 8:60456356-60456378 CTCCTTCTGTCACCAGGCTGGGG - Intergenic
1041831325 8:62157620-62157642 CTCCTTCTGCTGAAAGTCTGAGG - Intergenic
1047286511 8:123491889-123491911 CTCTTTTTCTTACCAGTCTCAGG + Intergenic
1047628216 8:126678270-126678292 CTCCTTTTCTTCCCAGTCTCAGG + Intergenic
1048157807 8:131977355-131977377 CTCCTTCCACTCACAGTCTCTGG - Intronic
1048892069 8:138957012-138957034 CTCCTGTTGCTACCAGCATCAGG - Intergenic
1049625160 8:143616622-143616644 CTCCATCTGCTACCACCTTCTGG + Exonic
1050104247 9:2149090-2149112 CTCCTTTTCTTCCCAGTCTCAGG - Intronic
1050156149 9:2667994-2668016 CTCCTTTTCTTCCCAGTCTCGGG + Intergenic
1050302179 9:4270740-4270762 CTCCTTCTGCCTTCAGCCTCAGG + Intronic
1051596143 9:18826110-18826132 ATCCTTATCCTACCAGGCTCTGG + Intronic
1051682049 9:19617299-19617321 CTCCTGCTGGTACCAGTCCGTGG + Intronic
1051989517 9:23135220-23135242 CCCCTTCTCCTCCCAGCCTCTGG + Intergenic
1052142578 9:25004707-25004729 CTGCTCCAGCTACAAGTCTCTGG - Intergenic
1052723351 9:32199625-32199647 CTCCTTTACCTCCCAGTCTCAGG - Intergenic
1052778274 9:32754914-32754936 CTCCTTTGTCTCCCAGTCTCTGG - Intergenic
1054160180 9:61667871-61667893 CTCCTTCTTCACCCAGCCTCCGG - Intergenic
1054921355 9:70545886-70545908 CTGCCTATGCTACCAGTCTTAGG - Intronic
1054980994 9:71205790-71205812 CTCATTCTGATGACAGTCTCAGG - Intronic
1055046769 9:71934434-71934456 CTCTTTCTGCTATCAGTATTTGG + Intronic
1058222750 9:102323462-102323484 CTCCCTCTGCTTCCATTTTCTGG - Intergenic
1059255102 9:112922998-112923020 CTCCCTCTATCACCAGTCTCTGG + Intergenic
1059753460 9:117271124-117271146 CTCCTTTTCTTCCCAGTCTCTGG - Intronic
1060963897 9:127701150-127701172 CCCCTTCTCCTACCTGTCTCTGG + Intronic
1060985435 9:127816681-127816703 CTGCCTCTGCCACCAGTGTCGGG + Intronic
1061139221 9:128754071-128754093 CTCCTTCTCCTAAGAGTATCTGG + Intronic
1061247939 9:129410814-129410836 TTCCTGCTGCTTCCAGTTTCTGG + Intergenic
1061868950 9:133509965-133509987 CTGCTTCTGCTCCCAGGCTCGGG + Intergenic
1203636602 Un_KI270750v1:118190-118212 CTCCTGCTGCTAGCAGGCTGAGG - Intergenic
1186248853 X:7644688-7644710 CTCTTTTTGCTTCCAGTTTCGGG - Intergenic
1187197728 X:17104049-17104071 CCCCTTCTTCTACCCTTCTCTGG - Intronic
1188550033 X:31353396-31353418 CTCTTTCTGATCTCAGTCTCAGG - Intronic
1188732575 X:33668852-33668874 TTCCTGCTGCAACCAGACTCAGG + Intergenic
1189419682 X:40845743-40845765 CTGCTTCTGCTAGCAGTGCCTGG + Intergenic
1190933067 X:54966751-54966773 CTCCTCCTGCTACTTGTTTCTGG + Intronic
1191856289 X:65629546-65629568 CTCTTTCTCTTCCCAGTCTCGGG - Intronic
1192450299 X:71240615-71240637 CTCCTTCTGGGTCCAGACTCTGG - Exonic
1192722766 X:73717122-73717144 CTCCTTTTCTTCCCAGTCTCAGG - Intergenic
1193266691 X:79480438-79480460 CTCATTTTGATACCAGTCTCTGG - Intergenic
1195880598 X:109588893-109588915 CTCTTTCTATTCCCAGTCTCAGG + Intergenic
1196480288 X:116140384-116140406 CTCCTTTTCTTCCCAGTCTCAGG + Intergenic
1197448983 X:126587805-126587827 CTCCTTCATCAACCAGTCACTGG + Intergenic
1198569051 X:137935527-137935549 CTCTTTTTGTTCCCAGTCTCGGG + Intergenic
1199035457 X:143044756-143044778 CTCCTTTTCTTCCCAGTCTCAGG + Intergenic
1199042917 X:143135598-143135620 CTCCTTCTGCTTCCAGAAGCTGG - Intergenic
1199242586 X:145564987-145565009 TTCCTTCTGCTGCTAGTCTCTGG + Intergenic
1199424238 X:147682182-147682204 CTCCTGCTGCTAACAAACTCAGG + Intergenic
1199792458 X:151168060-151168082 CTCTTTATCCTCCCAGTCTCGGG + Intergenic
1199880925 X:151973984-151974006 CTCCTGTTGGTGCCAGTCTCAGG - Intronic
1200691194 Y:6307185-6307207 CTCATTCTGCTTCCTGTCCCTGG + Intergenic
1201044078 Y:9867531-9867553 CTCATTCTGCTTCCTGTCCCTGG - Intergenic
1201579342 Y:15494474-15494496 CTCGGTGTGGTACCAGTCTCAGG + Intergenic