ID: 904884518

View in Genome Browser
Species Human (GRCh38)
Location 1:33726267-33726289
Sequence CCTCCCCAGCCCCCAAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 473}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904884518_904884527 1 Left 904884518 1:33726267-33726289 CCCCTCCTTGGGGGCTGGGGAGG 0: 1
1: 0
2: 3
3: 72
4: 473
Right 904884527 1:33726291-33726313 GGGAGCTCTAACATCCCAAATGG 0: 1
1: 0
2: 0
3: 15
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904884518 Original CRISPR CCTCCCCAGCCCCCAAGGAG GGG (reversed) Intronic
900203713 1:1422170-1422192 CCTCCCAGGTCCCCAAGGACAGG + Intergenic
900381435 1:2385966-2385988 CCTGCCCGCCCTCCAAGGAGCGG - Intronic
900395518 1:2451730-2451752 GCTGCCCAGCCCCCAGGGAGGGG - Intronic
900613317 1:3553497-3553519 CCTCCCCACACCCCAGGCAGGGG + Intronic
900644338 1:3702267-3702289 CCTCCACAGCCCTCCTGGAGGGG + Intronic
900677336 1:3896099-3896121 CCTCCCCAGCTCCCAGGCAGCGG + Intronic
900796327 1:4710898-4710920 CCTCCCCAGTTCACATGGAGCGG - Intronic
900902869 1:5528540-5528562 CCTCCCCGGCCTCCCAGCAGGGG - Intergenic
901365978 1:8748734-8748756 TCTTCCCAGCCCCAAAGGTGTGG + Intronic
901924181 1:12555464-12555486 CCTCTCCAGGCCCCAAGGCTTGG - Intergenic
902372775 1:16016321-16016343 CCTCCTAAGCCCCCAAGGACTGG - Intronic
902374399 1:16023508-16023530 CCTGCCCAGCCCCCAGTGTGAGG + Intronic
902572119 1:17353572-17353594 TCTCCCCTGCCTCCCAGGAGAGG - Intronic
902930221 1:19725905-19725927 ACTCCTCAGCCCCCAAGGCCTGG - Intronic
903177666 1:21590385-21590407 CCCACCACGCCCCCAAGGAGGGG + Intergenic
903539636 1:24089757-24089779 CCTACCCATCCCCCAGAGAGGGG + Intronic
903883733 1:26529670-26529692 CCGCCCCAGCCCCCGCGGCGCGG - Intergenic
904186879 1:28712398-28712420 CCCCCCGAACCTCCAAGGAGTGG - Intronic
904324789 1:29721373-29721395 ACTGCCCAGCCCCCAAAGAGTGG + Intergenic
904491680 1:30864385-30864407 CCTCCCCACCCCCCAAGCCTTGG - Intergenic
904884518 1:33726267-33726289 CCTCCCCAGCCCCCAAGGAGGGG - Intronic
905217329 1:36418102-36418124 CGTCCTCTGCCCCCAGGGAGAGG - Exonic
905238315 1:36565628-36565650 CCTCCCCAACCCATAAGGATGGG + Intergenic
905463119 1:38134137-38134159 GCTCCCCTGCCCCCATGGATGGG + Intergenic
905466145 1:38155174-38155196 CCTCACCAGCCCCACAGGTGGGG - Intergenic
906144155 1:43550177-43550199 CCTCTCCAGCCTCCAAGGGAGGG + Intronic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
907977182 1:59443442-59443464 GCTCCCCACCCCCCAACTAGTGG + Intronic
911794082 1:102054539-102054561 CCTTCCCAGTCCCCTAGGAGTGG - Intergenic
912475437 1:109931602-109931624 CCTCCCCATCCCTGAGGGAGTGG + Intergenic
914513244 1:148352745-148352767 CCTCCCCAGGCCTCAAGGACTGG + Intergenic
915093312 1:153441592-153441614 CCTCCCCTGCCCCCATGGCAGGG + Intergenic
915565919 1:156712613-156712635 CCTCCCCAGCTCCCAGGGCAGGG + Intergenic
915590277 1:156866651-156866673 CCTCTCCAGACCCCAGGGAGGGG - Intronic
916314014 1:163427520-163427542 CCTCCCCCTCCTCCCAGGAGAGG + Intergenic
917599463 1:176559947-176559969 CCTCCCCAGCCCCAGATGCGGGG + Intronic
918056504 1:181026098-181026120 CCTCCACTGCCCACAAGGAAAGG + Intergenic
919767375 1:201136054-201136076 CTTTCCCAGGCCCCAGGGAGGGG - Intronic
919847426 1:201650522-201650544 CCTTCCCAGCCCCCAGCGGGCGG - Intronic
920092778 1:203465979-203466001 CCTCCCCAGCCTCCCAGGCTTGG - Intergenic
922364847 1:224854177-224854199 CCTCCTCAGCCCCCATGGGTGGG - Intergenic
922712437 1:227844322-227844344 CCTCCCCTACCCCCCATGAGTGG + Intronic
922719507 1:227893134-227893156 CCTCCCCAGACCCCAAAATGTGG - Intergenic
922728750 1:227939332-227939354 ATTCCCCAGCCCCACAGGAGTGG + Intronic
922822737 1:228495115-228495137 TCCCCCCAGGCCCCAAGGAAAGG - Exonic
922905238 1:229169018-229169040 CCTCCTCAGCCCCCAGGGAGGGG - Intergenic
923092556 1:230751220-230751242 GCTCCCCTGACCCCCAGGAGGGG + Intronic
923335589 1:232967038-232967060 CCTCCCCAACCCCCAGTGTGAGG - Intronic
1065727354 10:28678266-28678288 CCGCCCGAGCCCCCAGGGTGCGG - Intronic
1066624401 10:37391469-37391491 CCTCCCTTGCCCCAAAAGAGGGG + Intergenic
1067540174 10:47145126-47145148 CCACTCCAGCCCCAGAGGAGGGG - Intergenic
1068548806 10:58384051-58384073 CGCCCCCAGCCCCAAAGGTGAGG - Intergenic
1069618416 10:69820935-69820957 CCTCCCCACCCCCAAACCAGAGG + Intronic
1069899774 10:71700787-71700809 CCTCCCCAGGACCCATGGACAGG + Intronic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1070647616 10:78212571-78212593 CCTGCCCCGCCCCCCAGCAGTGG + Intergenic
1072752657 10:97994317-97994339 CATCCCTAGCCCCAAAGGAGAGG - Intronic
1073176724 10:101561425-101561447 CCTTCCCAGCCCCAAAGCTGGGG - Intergenic
1073462448 10:103673888-103673910 CCTCCCCAGAGCCCAGGGTGGGG - Intronic
1074354612 10:112771035-112771057 ATTCCCCAGGACCCAAGGAGAGG + Intronic
1074533961 10:114315503-114315525 CCTGCCCCTTCCCCAAGGAGAGG + Intronic
1074871933 10:117583704-117583726 CTTCCCCAGGCCCCAGGAAGAGG - Intergenic
1075646918 10:124102743-124102765 CCACCCCAGTCTCCAAGGACAGG + Intergenic
1076133775 10:128030826-128030848 CCTCCCCAGCCTCCTTGGACCGG + Intronic
1076512846 10:131024789-131024811 CCGGCCCAGGCCCCCAGGAGAGG - Intergenic
1077109804 11:857214-857236 CCTGCCCAGCCCCCATGGAACGG + Intronic
1077173923 11:1180268-1180290 TCCGCCCAGCCCCCAAGCAGCGG - Intronic
1077184144 11:1228907-1228929 CCACCCCAGGACCCCAGGAGGGG + Intronic
1077858750 11:6156748-6156770 CCTCCCCCACCCCCCAGCAGTGG + Intergenic
1077906733 11:6540025-6540047 GCTCCGCAGCCCCCAATGGGAGG + Exonic
1077976282 11:7251925-7251947 CCTCCCCAGACACCGAGGAGAGG - Intronic
1078179891 11:9003137-9003159 CCAGCCCCGCCCCCAAGGAGTGG - Intronic
1078916549 11:15783882-15783904 CCTTCCCTACCCCTAAGGAGGGG + Intergenic
1079132227 11:17753692-17753714 CCTCCCCACCCCCCACGCCGGGG - Intronic
1079709743 11:23666476-23666498 GTTCCCCAGCCCCCATAGAGGGG + Intergenic
1079762386 11:24345546-24345568 CCTCCCTTGCACCCAAGAAGAGG + Intergenic
1080197019 11:29623334-29623356 CCAACCCATCCCCCACGGAGAGG + Intergenic
1081627884 11:44666356-44666378 CTTCCCCACCCCCCAAGAATTGG + Intergenic
1081631733 11:44694107-44694129 CCTCCCCAGCTCCCAACTCGGGG - Intergenic
1081647875 11:44802555-44802577 CCTCCCCAGCCCCCACTGGATGG + Intronic
1081717324 11:45259650-45259672 CATCCCCAGCTCCCAGGAAGAGG + Intronic
1082811791 11:57482909-57482931 CCTCCCCAAGCCCCGGGGAGTGG + Intergenic
1083308480 11:61772716-61772738 CCACCCCAGGCCCCAAGGCCAGG + Intronic
1083328308 11:61884970-61884992 CCTCCACAGCCCCCAAAGCAGGG + Intronic
1083406152 11:62458709-62458731 CCTCCACTGCTCCCAAGGACAGG + Intronic
1083416842 11:62531374-62531396 CATGCCCAGCCTCAAAGGAGAGG - Exonic
1083457728 11:62790145-62790167 CCCCCCCACCCCCCAACGAAAGG - Exonic
1083594544 11:63912611-63912633 TCTCCCCACCCTCCAAGGAGTGG - Intronic
1083718814 11:64593877-64593899 ACTCCCCAGCCCCCAGGGAAAGG - Intronic
1083755154 11:64788306-64788328 CCTTCCCAGCCCCCCAGCTGTGG + Intergenic
1083877436 11:65531724-65531746 CCTCCCCAGCCACCAGGTTGGGG - Intronic
1083922580 11:65788465-65788487 CCTCCCCTCCCCCCTCGGAGGGG - Intronic
1083949773 11:65947525-65947547 CTGCCCCAGCGCCCCAGGAGGGG + Exonic
1084164134 11:67367173-67367195 CTTCCCCGGCCCCCAGGGGGAGG + Intronic
1084165445 11:67373041-67373063 CCTCCCCGGCCCGCCGGGAGGGG - Intronic
1084285621 11:68128669-68128691 CCTCGCCAGGTCCCAAGGGGGGG - Intergenic
1084444852 11:69197575-69197597 CCACCCCAGCCCCCCAGTGGTGG + Intergenic
1084505138 11:69561779-69561801 CCACCTCAGCCTCCCAGGAGTGG - Intergenic
1084786007 11:71442011-71442033 CCTTCCCAGCCCCATAGCAGGGG - Intronic
1084805009 11:71572696-71572718 CATCCCCAGACCCACAGGAGAGG + Intergenic
1084844578 11:71889006-71889028 CTTCTTCAACCCCCAAGGAGAGG + Intronic
1085276970 11:75306704-75306726 TCTCCCCAGCCCCAAGTGAGGGG + Intronic
1085317373 11:75553751-75553773 CCTGCCCAGGCCCCAGGCAGAGG - Intergenic
1085644846 11:78216340-78216362 CCTCTCCAGGCCCCCAGGAGAGG + Exonic
1085658836 11:78343315-78343337 CCTCCCAAACCCCAAAGAAGTGG + Intronic
1087380569 11:97399490-97399512 CCTCCCCTATCCCCAAGCAGAGG - Intergenic
1088852377 11:113715496-113715518 CCTAACCAGCCCTGAAGGAGTGG + Intergenic
1089616914 11:119699970-119699992 CCACCCCAGCCCCTGAGGTGTGG + Intronic
1089730522 11:120516163-120516185 CCTGCCCACCCCCCAAACAGGGG - Intronic
1090054815 11:123413725-123413747 CCACCCCAGCTTCCAAGAAGAGG + Intergenic
1090243085 11:125197630-125197652 CCTTCCCTGCCCCAAAGCAGAGG + Intronic
1090334691 11:125954569-125954591 CCTCCCAAGCCCCCCAGGGAGGG - Intergenic
1091222159 11:133935996-133936018 CCACCCCAGCCCCCACGGGCAGG - Intronic
1092272812 12:7037082-7037104 CCTCACCAGCCTCTAAGGGGAGG - Intronic
1093910653 12:24743277-24743299 TATTCCCAGCCCCCAAGCAGAGG + Intergenic
1094317580 12:29149738-29149760 GGTCCCCAGTCCCCAAGGCGCGG - Intronic
1096602315 12:52738172-52738194 CCTCCCCACCCCCCGACGACAGG - Intergenic
1097190183 12:57216117-57216139 CCTGCCCAGCCCCCATGCAGAGG + Intergenic
1098003709 12:65972304-65972326 CCTCCCCTGCCACCAGGGATTGG - Intergenic
1098208045 12:68133461-68133483 CCTGCCCAATCCCCAAGCAGGGG - Intergenic
1098260161 12:68661639-68661661 CCACCCCAGCCCCCAAGTTGTGG + Exonic
1099129679 12:78811485-78811507 CCTCCCCCGCCCCCCATGACAGG - Intergenic
1099478629 12:83140094-83140116 CCACACCTGCCCCCAAGCAGAGG - Intergenic
1100815213 12:98380462-98380484 AGTCCCCTGCCCCCAAGGACTGG + Intergenic
1101702879 12:107191860-107191882 CCTCTCCAGGCTCCAGGGAGGGG + Intergenic
1102900817 12:116635289-116635311 CCTACCCAGCACAGAAGGAGGGG + Intergenic
1103595260 12:122021542-122021564 CCTGCCCAGCCCCCAGAGCGCGG - Exonic
1103715938 12:122945368-122945390 GCTCCCCATCCTCCAAGGAGAGG + Intronic
1103724436 12:122990749-122990771 CCTGCCCAGCCCCGGAGCAGTGG + Intronic
1104964550 12:132503043-132503065 CCTCCATAGCTCCCAAGGGGTGG + Intronic
1105290268 13:19048872-19048894 CCACCCCAGCCTCCATGGAAGGG + Intergenic
1105409870 13:20162011-20162033 CCTCCCCGTCCCCCAAGGTCTGG + Intergenic
1105537952 13:21287566-21287588 CCACCCCATCCCCCAGGGAAAGG + Intergenic
1107914960 13:45140198-45140220 CCTCCTCAGCCCCTAAAGTGTGG + Intronic
1108416227 13:50200567-50200589 TCACCCCATCCCCCAAGGAAGGG - Intronic
1108629720 13:52269521-52269543 ACTCCCCAGCACTCAAGGAGAGG - Intergenic
1108656338 13:52536967-52536989 ACTCCCCAGCACTCAAGGAGAGG + Intergenic
1109100656 13:58180604-58180626 CCTCCCCTTCCCACAAGCAGAGG + Intergenic
1110152883 13:72276217-72276239 CCTTACCAACCCCCAAGCAGGGG + Intergenic
1110716500 13:78710738-78710760 TCTTCTCTGCCCCCAAGGAGTGG - Intergenic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1113488935 13:110677009-110677031 CCTCCCGGGTCCCCAGGGAGAGG + Exonic
1114459585 14:22877915-22877937 ACCCTCCAGCCCCCAAGGGGAGG + Exonic
1116192641 14:41680021-41680043 CCTCCCCTGTCCACAAGCAGTGG - Intronic
1116351847 14:43872471-43872493 CCTCCTCCACCCCCAAGCAGTGG - Intergenic
1116396387 14:44452355-44452377 GCTCCCCATCCCACAAGGAGTGG - Intergenic
1117135502 14:52730705-52730727 CCTCTCCAGACCCCGCGGAGGGG + Intronic
1117512836 14:56470980-56471002 CCTCCCAGGCCTCCAAGGACTGG - Intergenic
1117813725 14:59576465-59576487 TCTCCCCAGCCTCCAAGGAGCGG + Intronic
1119437733 14:74609194-74609216 CCTCCCCAGCTGACATGGAGTGG + Intronic
1119599808 14:75967990-75968012 CCTCCCCAGCCTACTAGGGGAGG + Intronic
1119905505 14:78298221-78298243 CCTCCCCAGGCCCCATGCCGGGG + Intronic
1120248989 14:82038998-82039020 CCTCCCAAGCCCCGAGGGAAGGG + Intergenic
1121175387 14:91887141-91887163 CCTGCCCAGGCCCCAAGTACAGG + Intronic
1121325169 14:93015641-93015663 CATGCCCTGCCCCCAAGCAGGGG + Intronic
1122082553 14:99275259-99275281 CCTCCCCACCCCCAAAAAAGAGG + Intergenic
1122298851 14:100720421-100720443 ATTGCCCAGTCCCCAAGGAGGGG - Intergenic
1122500050 14:102191407-102191429 CATCCCCCGCCCCCCAGAAGAGG + Intronic
1122561344 14:102616882-102616904 CCACCTCAACCTCCAAGGAGGGG - Intronic
1122718026 14:103706968-103706990 CCTGCCCAGACCCCACGGAAGGG + Intronic
1122982696 14:105198765-105198787 CCACCCCAGCCCACCAGCAGGGG - Intergenic
1123216434 14:106813140-106813162 CCTGCCCAGGCTGCAAGGAGGGG + Intergenic
1123694868 15:22871571-22871593 CCTGCCCAGGCCCCGTGGAGTGG - Intronic
1124003329 15:25777412-25777434 CCTCCCCGGTCCCCAAGGGAAGG + Intronic
1124916000 15:33974857-33974879 CGGCCCCAGCCTCCAAGTAGCGG - Intronic
1125577014 15:40763237-40763259 CCGCACCAGCCACCAATGAGCGG - Intergenic
1125731974 15:41897601-41897623 TCTCCCCAGCTCCCAGGGAGGGG - Exonic
1127143134 15:55997112-55997134 CCTCCTCACCCCACAAGGGGTGG + Intergenic
1127730607 15:61798619-61798641 CTTCTACAGCCCCCAGGGAGGGG - Intergenic
1128161827 15:65427927-65427949 CCTCAGCAGCCCCCAAGCAGTGG + Intergenic
1128519238 15:68364670-68364692 CCTCTCCTGACCCCAAGCAGTGG + Intronic
1129151623 15:73692211-73692233 CCTCCCCAGCCCCCAGTGAATGG + Intronic
1129264232 15:74385479-74385501 CCACCCCATCCCCCAAGCTGAGG + Intergenic
1129391920 15:75224973-75224995 CCTCCAAAACCCCCAAGGATTGG - Intergenic
1129472454 15:75763189-75763211 CCTCCGAAACCCCCAAGGACTGG + Intergenic
1130975302 15:88769235-88769257 TCTGCACAGCCCCCCAGGAGGGG - Intergenic
1132584272 16:699521-699543 CCTCCCCAGGCTTCAAGGTGAGG - Intronic
1132778704 16:1611255-1611277 CCGCCCCAGCCCCCAAGAGCTGG - Intronic
1132856033 16:2044922-2044944 CCTCCCCACCCCACAGGGGGAGG - Intronic
1133734928 16:8607683-8607705 TCTCTCCAGCCCCCAGGCAGCGG - Intergenic
1133749424 16:8713070-8713092 CCTCCCCAACCCCCGAGGCGGGG + Exonic
1134034748 16:11021091-11021113 CTTCCTCAGCCCCTAGGGAGGGG + Intronic
1134803040 16:17103229-17103251 CCTCCCCTGCCCCCAAGACTGGG - Exonic
1135618002 16:23928647-23928669 CCTCCCCAGTCCCCCAACAGAGG - Intronic
1135967445 16:27047800-27047822 CTTCCCCAATCCCCAAGGAACGG + Intergenic
1136225571 16:28858096-28858118 CCAGCCCAACCCCCAGGGAGGGG - Intronic
1136687134 16:32002209-32002231 CCTGCCCCACCCCCAAGGACTGG - Intergenic
1136787747 16:32945760-32945782 CCTGCCCCACCCCCAAGGACTGG - Intergenic
1136882034 16:33908029-33908051 CCTGCCCCACCCCCAAGGACTGG + Intergenic
1137275679 16:46931908-46931930 CCTCCCCAGCCCCAGGGAAGAGG - Intergenic
1137592539 16:49702577-49702599 CACCCCCAGCCCTCAAGGAGAGG + Intronic
1137943644 16:52713428-52713450 CATCCCCAGCCCCTAAGGCTGGG - Intergenic
1137995279 16:53204160-53204182 CCACCCCAGCCTGCCAGGAGAGG + Intronic
1138346356 16:56322597-56322619 CCAGCCCAGCCCCCAAGCAGAGG - Intronic
1138491125 16:57377283-57377305 CCTCCCCAGGCCCTATTGAGTGG - Intronic
1138909656 16:61380965-61380987 CCTCCTCAGCCCCAAAGTAGTGG + Intergenic
1140765194 16:78150767-78150789 CCTCCTCTTCCCCCAAGGCGGGG + Intronic
1142222124 16:88860684-88860706 CCTCCCAAGGCCCCAGGAAGGGG - Intronic
1142302510 16:89266783-89266805 CCTCCCCAGCACCCAGGTACAGG + Intergenic
1203089975 16_KI270728v1_random:1207417-1207439 CCTGCCCCACCCCCAAGGACTGG - Intergenic
1142740739 17:1930570-1930592 CAGCGCCAGCCCACAAGGAGGGG - Intergenic
1142801337 17:2347921-2347943 CCTCCCCACCCCCCAGGGATTGG + Intronic
1143135760 17:4711308-4711330 CCTCCCCCACCCCCAGAGAGAGG - Intronic
1143506463 17:7368446-7368468 CCTCCCCAGCCTCCACGTAGCGG + Intergenic
1145993201 17:29091389-29091411 TCTTCCCCTCCCCCAAGGAGGGG - Intronic
1146063186 17:29617614-29617636 TCTCCCCCTCCCCCCAGGAGAGG - Exonic
1146242828 17:31245858-31245880 ACTCCCCAACCTCCAAGGAGAGG - Intronic
1146295814 17:31649554-31649576 CCTCCCCAGCCTCCCTGGAGGGG + Intergenic
1146689281 17:34861954-34861976 CCACCCCAGCCCCCAGTGTGTGG + Intergenic
1146762418 17:35490087-35490109 CCTCCCCAGTGCCCCAGGCGCGG + Intronic
1146876323 17:36415197-36415219 CCAATCCAGACCCCAAGGAGAGG + Intronic
1147063060 17:37897676-37897698 CCAATCCAGACCCCAAGGAGAGG - Intergenic
1147148102 17:38497878-38497900 CCTGCCCCACCCCCAAGGACTGG - Intronic
1147342832 17:39764802-39764824 CCTCCCCCTCCCCACAGGAGAGG - Intergenic
1147646868 17:42039524-42039546 CCTCCACAGCCCACAGGGTGGGG + Intronic
1148479227 17:47949331-47949353 CTCCCTCAACCCCCAAGGAGGGG + Intergenic
1148840008 17:50488998-50489020 CCTCCCCAGGCCCTCAGGTGAGG - Intergenic
1148865758 17:50627730-50627752 CCTCCCCAGCCGTGAAGGAGAGG + Intergenic
1150259192 17:63774409-63774431 CCTCCAGTGCCCCCAAGGACTGG - Intronic
1150467113 17:65403152-65403174 CCTCCACAGACCCCAGGGAGGGG + Intergenic
1151288497 17:73131342-73131364 CCTCCCCCGACCCCAAGAACTGG + Intergenic
1152179169 17:78807146-78807168 GCCCCCCAGACCCCCAGGAGTGG - Exonic
1152482268 17:80562387-80562409 ACCACCCAGCCCCCAAGCAGGGG - Intronic
1152597284 17:81243888-81243910 CCCTCCCAGCCCCCAAGGCTCGG + Intergenic
1152635202 17:81428063-81428085 CCTCCCCTGCACCCAGGAAGAGG - Intronic
1152659587 17:81536055-81536077 CCTCCTCAGGTTCCAAGGAGTGG - Intronic
1152702180 17:81824595-81824617 CCTCTCCAGCACAGAAGGAGGGG + Exonic
1152711094 17:81870924-81870946 CCCCCCGCGTCCCCAAGGAGGGG + Intronic
1152795381 17:82303844-82303866 CCTCCCCTGCCCCACAGAAGTGG - Intergenic
1152840980 17:82568069-82568091 CCCCTCCAGCCCCCGGGGAGCGG + Exonic
1155139896 18:23035632-23035654 CCTACCCAGACCCCAAGAAAGGG + Intergenic
1155333571 18:24742297-24742319 CCTCCAGTGCCCCCAAGGAGTGG - Intergenic
1155499186 18:26470293-26470315 CTTTCTCAGCCACCAAGGAGAGG + Intronic
1156472097 18:37383846-37383868 CCTTCCTAGCCAGCAAGGAGAGG - Intronic
1157712324 18:49858516-49858538 GCCCCCCACCCCCCAGGGAGGGG + Intronic
1157828468 18:50834116-50834138 ACTCCCCAGCCCCCAAGGCAGGG + Intergenic
1157935224 18:51864752-51864774 CCTCCACACCCCGCAAGCAGAGG + Intergenic
1158236508 18:55321882-55321904 CCTCCCCCGCCCGCCAGGAATGG - Intronic
1158749756 18:60245095-60245117 CTCCCCCAGGCCCCACGGAGAGG - Intergenic
1159782347 18:72674878-72674900 CTGCCCCAGCCTCCCAGGAGAGG + Intergenic
1160447880 18:78941378-78941400 CCTCCCCAGAAGCCAAGCAGAGG + Intergenic
1160509108 18:79443501-79443523 CCTCCCCACCCCCCGAGGGACGG - Intronic
1160974683 19:1787020-1787042 CCTCTCCCCGCCCCAAGGAGCGG + Intronic
1161216489 19:3097323-3097345 CCTCCCCTGCCCCTTAGCAGTGG + Intronic
1161397521 19:4052477-4052499 CCTCCCCAGCAGGCCAGGAGAGG - Intronic
1162063631 19:8111515-8111537 CCTCTCCAGCACCCACAGAGCGG + Intronic
1162959122 19:14115971-14115993 CCTCCCCAGCCCCCACCCATTGG + Intronic
1163400219 19:17087601-17087623 CCTCCTCAGCCACCCAGGATAGG - Intronic
1163720025 19:18894498-18894520 CCTCCCCAGCCCCTTGGGTGGGG - Intronic
1164733813 19:30525956-30525978 CCTGCCCTGCCCCCAACCAGAGG + Intronic
1165144926 19:33724783-33724805 CCTCCCCAGCCCACCCGGAGTGG - Intronic
1165329202 19:35131935-35131957 CCGCCCCAGCCCTCCATGAGAGG - Intronic
1165533177 19:36421301-36421323 GCTCCCCGGGGCCCAAGGAGAGG + Intergenic
1165829451 19:38723279-38723301 CCTCCTCAGGCCCCAAGGCCTGG + Intronic
1165866394 19:38942091-38942113 CTTCCTCAGCCCCCCAGAAGGGG - Exonic
1166165195 19:40982799-40982821 CTTCCCCAACCCACGAGGAGAGG - Intergenic
1166594226 19:44030879-44030901 CCCCCCATGCCCCAAAGGAGTGG + Intronic
1166904257 19:46094677-46094699 CCTCCCCTGCCCCCACTGACAGG + Intergenic
1167611723 19:50511032-50511054 CCTCCCCGGACACCAAGGAATGG + Intronic
1168127129 19:54290792-54290814 CCTCCTCAGCCCTCACGAAGGGG - Intergenic
1168173232 19:54604717-54604739 CCTCCTCAGCCCTCATGCAGGGG + Intronic
925182127 2:1824070-1824092 GTTCCCCAACCCCCATGGAGAGG - Intronic
925336419 2:3102193-3102215 CCTCCCTAGCCCCCATGTTGGGG + Intergenic
925387819 2:3474510-3474532 CCTTGACAGCGCCCAAGGAGGGG + Intronic
925390915 2:3493324-3493346 CCTGCCTGTCCCCCAAGGAGGGG - Intergenic
925712235 2:6752711-6752733 CTCCCCCTGCTCCCAAGGAGAGG - Intergenic
926854000 2:17232094-17232116 CCTCCCCAGAAGCCAAGCAGAGG + Intergenic
926990702 2:18676860-18676882 CCTCACCCTCCCCCAATGAGAGG - Intergenic
927188552 2:20499996-20500018 CCTCCTCATCATCCAAGGAGAGG - Intergenic
927240298 2:20915075-20915097 CCTCACCCACCCACAAGGAGAGG - Intergenic
927493986 2:23540183-23540205 CCTGCCCAGCCCCCCAGAAGTGG + Intronic
927843151 2:26457818-26457840 GCTCCCCAGCCCACAGGCAGGGG + Exonic
927866042 2:26588329-26588351 CCTTGCCACCCCCAAAGGAGGGG - Intronic
928130399 2:28644889-28644911 CCTCCCCAAGCCCTAATGAGGGG - Intergenic
929588597 2:43131225-43131247 CCTCCCCAGCCCCACAGGCTGGG - Intergenic
929813053 2:45208080-45208102 CATCCACAGCCCTAAAGGAGCGG - Intergenic
930035060 2:47080162-47080184 ACTCCCCAGCCCCCACGCAAGGG + Intronic
931017775 2:58005847-58005869 CCTCCCCAGCCCTACTGGAGGGG + Intronic
931074863 2:58699308-58699330 CCTGCCCAGCCACCAGGAAGGGG - Intergenic
932451976 2:71816925-71816947 CCTCCTCAGTCCCCAGGGGGTGG + Intergenic
932863296 2:75316629-75316651 CCGCCCCAGCCCCCAAGTGTAGG + Intergenic
933390676 2:81662904-81662926 GCTGCCCCGCCCCCAAGGAAAGG + Intergenic
934612535 2:95751884-95751906 ACTGCCCAGCCCCTAAGGGGTGG + Intergenic
934714854 2:96537518-96537540 CCGCCGCAGCCCCACAGGAGAGG + Intronic
934841613 2:97627560-97627582 ACTGCCCAGCCCCTAAGGGGTGG - Intergenic
936849135 2:116874237-116874259 CCTACCGAGCTCCCAAGGGGAGG - Intergenic
937974875 2:127576587-127576609 CCTCCCAGGCTCCCGAGGAGCGG + Exonic
937980516 2:127611972-127611994 GGTCACCAGCCCCCAGGGAGGGG - Intronic
938109169 2:128552677-128552699 ACCCCCCAGCAACCAAGGAGGGG - Intergenic
938630444 2:133160932-133160954 TGTCCCCAGCCCCCAAGCTGTGG + Intronic
938961633 2:136349066-136349088 CCTCCCCAACCCCCAAAAAAAGG - Intergenic
939459926 2:142486646-142486668 CATCCCCAACTCCCAGGGAGGGG + Intergenic
939580695 2:143942199-143942221 CCTCTCCCAACCCCAAGGAGAGG - Exonic
942444171 2:176067266-176067288 CCTCCGCAGCCACCTAGGCGTGG - Intergenic
942555933 2:177172305-177172327 CCACCCCAGCCCCCATGTAAGGG + Intergenic
942864053 2:180650821-180650843 TCTCCCCACCACCCAAGGAAAGG - Intergenic
946007005 2:216533792-216533814 CGTGCCCAGGCCCCAAGCAGGGG - Intronic
947528582 2:230894346-230894368 GCACCCAAGACCCCAAGGAGCGG - Intergenic
948765170 2:240215782-240215804 CCTCCCTGGCCCTCGAGGAGAGG + Intergenic
948851808 2:240711912-240711934 CCAACCCAGTCCCCAGGGAGAGG - Intergenic
948908419 2:240991069-240991091 GGTCCACAGCTCCCAAGGAGAGG - Intronic
1168736103 20:138236-138258 CCTGCTCAGCCCCTAAGGGGAGG - Intergenic
1169065781 20:2693427-2693449 CCCGCCCAGCGCCCCAGGAGGGG + Intronic
1169263302 20:4153049-4153071 CCTCCCCAGCCCCTAAGGCCAGG - Intronic
1169534624 20:6525147-6525169 CCACCCCAGGGCCCAAGGAGAGG - Intergenic
1169880263 20:10340066-10340088 CCTCCCCAGAAGCCAAGCAGAGG - Intergenic
1172642199 20:36447150-36447172 CCTCCCATGCCCCCCAGGGGTGG - Intronic
1172854559 20:37992068-37992090 CCTCCCCAGCGCCCCATCAGGGG + Intronic
1175288153 20:57851596-57851618 CCACCCCAGCCCCCACCCAGAGG - Intergenic
1175954131 20:62599639-62599661 CCCCCACAGCCCCTAAAGAGTGG + Intergenic
1176111979 20:63415077-63415099 CTTCTCCAGCCCCCGAGGCGTGG - Exonic
1176425794 21:6547547-6547569 CCTCTCCATCCCCCGAGGTGGGG + Intergenic
1179113032 21:38463714-38463736 CCTCCCCAGCTCACGAGGGGTGG - Intronic
1179418909 21:41220357-41220379 CCTCCCCACTCCCCAAGGTTGGG + Intronic
1179701285 21:43155864-43155886 CCTCTCCATCCCCCGAGGTGGGG + Intergenic
1180840914 22:18958442-18958464 CCGCCCCGGCCCACCAGGAGAGG - Intergenic
1181059615 22:20275978-20276000 CCGCCTCAGCTCCCAAGTAGCGG - Intronic
1181060575 22:20280332-20280354 CCGCCCCGGCCCGCCAGGAGAGG + Intronic
1181168360 22:20995043-20995065 CCCTCCCAGCCCCCAGGGAAGGG - Intronic
1181362931 22:22352799-22352821 CATCCCCAGGTCTCAAGGAGGGG + Intergenic
1181365737 22:22375872-22375894 CATCCCCAGGTCTCAAGGAGGGG + Intergenic
1181478084 22:23180798-23180820 CCTCACCTGCCACCAGGGAGTGG + Exonic
1181731656 22:24851403-24851425 CCTCTCCAGCCCCCAAGAGGTGG + Intronic
1182418820 22:30238709-30238731 CCTCCCCCACCGCCCAGGAGTGG - Intergenic
1182585028 22:31340032-31340054 TCTAACCAGCCCCCAAGAAGTGG + Intronic
1182775584 22:32828974-32828996 CCTCCCCACTGCCCCAGGAGCGG + Intronic
1182917042 22:34043628-34043650 CCTCCCCATCTCCCAGGCAGGGG - Intergenic
1183481202 22:38066487-38066509 CCTGCCCAGCACCCAAACAGGGG - Intronic
1183658932 22:39207106-39207128 CCCTCCCAGCCCCCCAGGACAGG - Intergenic
1183938877 22:41281127-41281149 CCTACCCTGCCCCCAACCAGGGG - Exonic
1184092587 22:42300235-42300257 CCTGCCCAGCCTCCTAGCAGAGG - Intronic
1184173805 22:42774753-42774775 CCTTCCCAGGCCCCCAAGAGTGG - Intergenic
1184257216 22:43294197-43294219 CACCCCCGGCCCCCGAGGAGGGG + Intronic
1184423048 22:44392828-44392850 CCTCCCCTCCCCAGAAGGAGTGG + Intergenic
1184782460 22:46656053-46656075 CCACCCCAGCCTCCACGGGGAGG + Intronic
1185258229 22:49848429-49848451 CCTCCCCGGTCCCCCAGGAAGGG + Intergenic
1185276855 22:49953620-49953642 CCCCCCCAGCCCCCGAGACGTGG - Intergenic
1185330203 22:50248983-50249005 CTTCCCCAGCCACACAGGAGTGG + Intronic
1185366695 22:50440114-50440136 CTCCCACTGCCCCCAAGGAGGGG - Intronic
950098396 3:10343261-10343283 CCCCTCCAGCCCCCGAGGAGGGG + Intronic
950173893 3:10858356-10858378 CCTCCCCACCCCACAGGAAGTGG + Intronic
950283144 3:11723986-11724008 CCCCCCCATCCCCCACTGAGGGG - Intergenic
950559784 3:13714792-13714814 CCTCCGCAGCCCCCCATGAATGG - Intergenic
950915044 3:16636298-16636320 GCTCCCAAGCCCCCAGGGATTGG - Intronic
952278083 3:31896837-31896859 CCTCCCCTCCCTCCAAGGACTGG - Intronic
952468551 3:33618532-33618554 CCGCCTCAGCCTCCAAGTAGCGG - Intronic
952966376 3:38623548-38623570 CCTACCCAGCCCCAGAGGAGTGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954645965 3:52131703-52131725 TCTCCCCAGCCCCCAACCAGGGG + Intronic
954992864 3:54855951-54855973 CCTCCCCTTCCCCCACAGAGGGG + Intronic
955195542 3:56801984-56802006 CCTCCCCACCCATCAAGGCGTGG - Intronic
955687791 3:61562949-61562971 GCGCCCCAGCCCCCAGAGAGAGG - Intronic
959111146 3:102123905-102123927 ACTCCCCTTCCCCCAAGCAGAGG + Intronic
960076817 3:113495565-113495587 CTTCCCCAGCCCCACAGGGGTGG + Intronic
960386778 3:117029986-117030008 CATCCCCAGCCCCCACTGAAAGG + Intronic
961446454 3:126983676-126983698 TCTCCCCAGCCTCCGTGGAGGGG - Intergenic
961832978 3:129633924-129633946 CCACCACAGCCCCCAGGGCGGGG - Intergenic
961983225 3:131103896-131103918 CCTCTGCTGCCCCCAAGGTGGGG - Intronic
962201588 3:133404607-133404629 CATCCCCATTCCCCAGGGAGTGG + Intronic
962658201 3:137571031-137571053 TCTTCCCAGCCCCCGAGGAAGGG - Intergenic
965287606 3:166837348-166837370 ACTCCTCATCCTCCAAGGAGAGG + Intergenic
965520193 3:169662940-169662962 CCTCCCCTTCCCCCCAGGCGGGG - Intronic
965792025 3:172399756-172399778 CTTCCCCAACCCCCCAAGAGGGG - Exonic
966862760 3:184239698-184239720 TCTCCCCAGCCCCTATGGACTGG + Exonic
966887420 3:184384521-184384543 CCTCCCCTGCCCCCAGGCCGTGG + Exonic
966946094 3:184778064-184778086 CATCCCCTACCCCCAAGAAGAGG + Intergenic
967081530 3:186054214-186054236 CCTCCCCAGTCCCAGAAGAGGGG - Intronic
967888159 3:194347045-194347067 CCTCCCCAGTTCCCAGGGAGGGG - Intronic
968353393 3:198080932-198080954 CCTCCGCAGCCACCAGGGATGGG + Intergenic
968481957 4:837181-837203 CCTCCACCGCAGCCAAGGAGGGG + Intergenic
968649403 4:1754469-1754491 CCTTCCCAGCCCCCCAGCACAGG - Intergenic
968657959 4:1786766-1786788 CCTCTCCAGCCCTCAGGAAGTGG - Intergenic
968660876 4:1798230-1798252 GCTTCTCAGCCCCCAGGGAGGGG + Intronic
968674396 4:1870186-1870208 CACCTCCAGCCACCAAGGAGTGG - Intergenic
969604750 4:8196831-8196853 CATCCCCAAGGCCCAAGGAGGGG + Intronic
969660517 4:8524901-8524923 CATACCCAGCCCCCCAGGACAGG - Intergenic
969684716 4:8664815-8664837 TCTCCCCAGCCCCAAAGAGGTGG + Intergenic
971095784 4:23400203-23400225 CCTCCCCCGCCCTCCAGCAGTGG - Intergenic
972468914 4:39384940-39384962 CCTCCCCCACCCCCCAGCAGCGG - Intergenic
972632891 4:40857209-40857231 CCTCCCCAGCAGCCAATGGGCGG - Intronic
974785741 4:66618480-66618502 ACTCCTCAGCCCCCAGGTAGTGG + Intergenic
975623320 4:76315901-76315923 CCTCCCCCTCCCCCAAGGGATGG - Intronic
976595639 4:86892471-86892493 CCTCCCCACCCGCCAGGGAGGGG + Intronic
977873634 4:102123636-102123658 CCTCCCCTTTCCACAAGGAGAGG + Intergenic
982721968 4:158868874-158868896 CCTCACTGGCCTCCAAGGAGGGG - Exonic
983134140 4:164058641-164058663 CCTCCCCATCTCCCTAGGACAGG + Intronic
983579546 4:169293737-169293759 CCTCCCCATGCCAGAAGGAGAGG - Intergenic
985762789 5:1759699-1759721 ACTCCCCAGCCCCACAGTAGAGG - Intergenic
985787431 5:1904684-1904706 CCTCCACAGCCTCCAAGGCAGGG - Intergenic
986668482 5:10123700-10123722 CCTCCCCTGCACTCAAGGAAGGG + Intergenic
988970601 5:36463854-36463876 ACTCCCCAGCCCCCAAGTCCTGG - Intergenic
989339525 5:40357735-40357757 CCTCACCATACCCCAAGAAGTGG + Intergenic
990567226 5:57041867-57041889 GCCACCCAGCCTCCAAGGAGGGG - Intergenic
991215380 5:64153599-64153621 CGACCCCAGCCCACAAGGGGAGG + Intergenic
992551794 5:77866415-77866437 CCCACTCAGCCCCAAAGGAGTGG + Intronic
992995106 5:82324721-82324743 CCTCACCCGCCCCCAAGAAGGGG - Intronic
994028459 5:95113415-95113437 CCTCCCCCATCCCCAAGCAGTGG + Intronic
995491484 5:112696893-112696915 CCTCCCCAACCCCAAATGACGGG + Intergenic
995740452 5:115350456-115350478 CTGCCACAGCCACCAAGGAGAGG + Intergenic
997124441 5:131211868-131211890 CCACCTCAGCCCCCCAGTAGCGG - Intergenic
997437397 5:133885312-133885334 CCTCCTCATCCCCCAACGACAGG + Intergenic
997524127 5:134541635-134541657 GCTCTGCAGCCACCAAGGAGGGG - Intronic
997585401 5:135040359-135040381 CCAGCCCAGCCCCTGAGGAGAGG - Intronic
998007225 5:138665132-138665154 CCTCAGCTGCCCCCAAGGATGGG - Intronic
998175294 5:139898129-139898151 CCTCCCTGGTCCCCAAGGTGAGG - Intronic
998513801 5:142735307-142735329 CCTCCCCAGCTCCTTAGGGGAGG + Intergenic
998788772 5:145743796-145743818 CCTACCCAGCTCCCAGGGGGAGG + Intronic
998878330 5:146622076-146622098 CCTCCCCAGGCCTGTAGGAGAGG - Intronic
999198405 5:149798932-149798954 GGTCCCTAGCCCCCAAGCAGGGG + Intronic
1000980469 5:167811466-167811488 CCTCCCCAGAAGCCAAGCAGAGG + Intronic
1001207966 5:169781779-169781801 CCTCTCCCGCCCCCACAGAGAGG + Intronic
1001454470 5:171850053-171850075 CCTCCCCAGGCTCCAGGGACAGG + Intergenic
1001647846 5:173295432-173295454 CCCCCCCCACCCACAAGGAGGGG - Intergenic
1001774332 5:174317333-174317355 CATCTCCACCCCCCAGGGAGGGG + Intergenic
1001964497 5:175900828-175900850 CTTCCCCAGTTCCCATGGAGAGG + Intergenic
1002052243 5:176577621-176577643 CCTCCCCTGCCCCCAGGTTGTGG + Exonic
1002536685 5:179879766-179879788 CTTCCCCAGCTCCTCAGGAGGGG - Exonic
1002543842 5:179925227-179925249 ACCCCCCAGCCTCCAGGGAGCGG + Intronic
1003266336 6:4567949-4567971 CCTTCCCAGCCTCCAGTGAGAGG + Intergenic
1003552146 6:7108892-7108914 CCTCCCCAGGCCCCCCGGGGCGG - Intronic
1003870588 6:10399561-10399583 CCTCCCCAGCCCCCCAGGCCAGG - Intronic
1005999786 6:30955862-30955884 AGCCCCCAGCCCCCAGGGAGGGG + Intergenic
1006108276 6:31729469-31729491 CCTCACAAGCCCCCAAGCAGGGG - Exonic
1006418383 6:33918699-33918721 TCTCCCCAGCCCTGGAGGAGGGG - Intergenic
1006781731 6:36636860-36636882 CCTCCCAAGCAGTCAAGGAGTGG - Intergenic
1006838741 6:37014875-37014897 GCACCCCAACCCCCTAGGAGCGG + Exonic
1006923431 6:37640863-37640885 CCTCACCAGCCCCAAAGGAACGG - Intronic
1007217873 6:40254804-40254826 TCTACCCAGCCTCCTAGGAGAGG + Intergenic
1007390052 6:41545847-41545869 CACCCCCAGCCCCCACGCAGTGG + Intergenic
1008887583 6:56447711-56447733 TCTCCCCATCCCCCAAGAAAGGG - Intergenic
1009687936 6:66987344-66987366 CCTTCCCAGTCCCCCAGCAGTGG - Intergenic
1010192677 6:73209826-73209848 CCTCCCCACTCCCCAAGGGCTGG - Exonic
1010194304 6:73224387-73224409 CCTCCTCACTCCCCAAGGACTGG - Intronic
1011464338 6:87639882-87639904 CCACCTCAGCCTCCAAGGATGGG - Intronic
1013346363 6:109264294-109264316 CCCCACAAACCCCCAAGGAGGGG + Intergenic
1015010042 6:128334840-128334862 CCTCCTCAGCCCCCAAAGTCCGG - Intronic
1016880397 6:148905545-148905567 CCTCCCCAGCCCCCATTAAGGGG + Intronic
1018736525 6:166690640-166690662 CCCCTCCTGCCCCCAGGGAGCGG - Intronic
1018960948 6:168448296-168448318 CCTCCCCAGCCTCCTGGGAGTGG - Intronic
1019056306 6:169226001-169226023 ACTCCCAAGGCCCCATGGAGGGG + Intronic
1019318825 7:405693-405715 CCCCCACACCCCCCATGGAGGGG + Intergenic
1019345739 7:529894-529916 CCACCCCCGCCCCGAGGGAGAGG + Intergenic
1019522953 7:1468801-1468823 CCTCCCCAGCCCCCAGGGGTGGG - Intergenic
1019533409 7:1514990-1515012 CCACCTCAGCCCCCTAGTAGTGG - Intergenic
1019735045 7:2646458-2646480 CCCCACCAGGCCCCAAGGAGAGG - Intronic
1020080980 7:5285453-5285475 TCTCCCCAGCCCCCAAGACCTGG + Intronic
1020243985 7:6416626-6416648 CCTCCACAGCCCCCGGGGTGGGG + Exonic
1021819367 7:24480827-24480849 CCTCCCCAGCACCCACTGAATGG + Intergenic
1022496003 7:30853600-30853622 TCTCCTCAGCCCCCAACCAGGGG - Intronic
1023843179 7:44107905-44107927 CGGCCCCAGCCCCGGAGGAGAGG + Exonic
1023878902 7:44307568-44307590 CCTCCCCTGCCCACATGGAGAGG + Intronic
1023966799 7:44967042-44967064 CCTCCCCACCCCCCGACCAGGGG - Intronic
1024054565 7:45651688-45651710 CCTTCCCATCTCCAAAGGAGCGG + Intronic
1024672299 7:51607201-51607223 CCTCCCTGGCCACCAAGGACAGG - Intergenic
1024893299 7:54227202-54227224 CCTCCCCATTCCTCTAGGAGTGG - Intergenic
1024900619 7:54315185-54315207 CCTCCCCATTCCTCTAGGAGTGG + Intergenic
1024995636 7:55271413-55271435 CCACCCAAGCCTGCAAGGAGAGG - Intergenic
1025095394 7:56092129-56092151 CCTCCTCAGCCCCCCAGGAAAGG - Intronic
1025674018 7:63630222-63630244 TCTCCCCAGCCCCCAAGACCTGG + Intergenic
1026299960 7:69089329-69089351 CCTGCCCAGGCCTCATGGAGTGG - Intergenic
1027174907 7:75897139-75897161 CCCCTCCACCCCCCCAGGAGAGG + Intergenic
1028401687 7:90431682-90431704 TCTCCCCAGTCCCCTAGGAATGG - Intronic
1029264091 7:99325188-99325210 CATCCCCAGCCCCCACAGATGGG - Intergenic
1029506851 7:100968073-100968095 GTTCCCCAGTCCCCAAGGAAAGG + Exonic
1029539027 7:101172318-101172340 CTTCCCCATCCCGCACGGAGGGG - Exonic
1030039307 7:105435403-105435425 CCACCCCATGCCCAAAGGAGAGG + Intergenic
1030908335 7:115213943-115213965 CCTCCCCAGGAGCCAAGAAGAGG + Intergenic
1031966422 7:128031185-128031207 CCCCCCCTCCGCCCAAGGAGCGG + Intronic
1032192244 7:129771795-129771817 CCTCCCCAGCGCCCAAGCCCAGG - Intergenic
1034338516 7:150338372-150338394 AGACCCCAGCCCCCAGGGAGAGG - Exonic
1034808078 7:154106068-154106090 TCTCCACAGCCCCCATGGAGAGG + Intronic
1035084591 7:156247319-156247341 CCTTCCCTCCCCCTAAGGAGAGG - Intergenic
1035203763 7:157281796-157281818 CCTCTCCAGCCTCCCCGGAGGGG - Intergenic
1035345727 7:158196479-158196501 GGTCCCCAGCCCCTGAGGAGGGG + Intronic
1037825137 8:22156301-22156323 CCTCCCCAACCCCCAAGGCCAGG + Intronic
1038033199 8:23662631-23662653 CCTCACGGGCCCCCAAGGATTGG - Intergenic
1038382781 8:27112677-27112699 CCTCCCCAGAGCCCAGGCAGTGG - Intergenic
1039952633 8:42183770-42183792 CCTCCCCATCCCCCATGGTCTGG - Intronic
1039959807 8:42237666-42237688 CCTCCCCAGGCTACAATGAGGGG + Intergenic
1040529981 8:48258863-48258885 CCAGCCCAGACCCCAAGGATAGG - Intergenic
1040629764 8:49196937-49196959 GGTCCCCAGCCCCCATGCAGTGG + Intergenic
1040908873 8:52497950-52497972 CCTCCCCCACCCCCCAGGTGGGG - Intergenic
1042704374 8:71650853-71650875 GCTCCCCAGCTCCCCAGCAGAGG - Intergenic
1044591263 8:93916676-93916698 CCCCCCCCGCCCCCAGCGAGTGG - Intronic
1044728929 8:95214848-95214870 CCTCCCCTGCCCTCAAAGAGGGG + Intergenic
1045459128 8:102411896-102411918 CTTCCCCCTCCCGCAAGGAGCGG - Intronic
1047309095 8:123677109-123677131 ACTTCCCAGCCCACAGGGAGGGG - Intergenic
1047801963 8:128319272-128319294 CCTCCCCAGCCCCCTAGGCAAGG - Intergenic
1048312752 8:133338402-133338424 CCTGCCCAAGCCACAAGGAGAGG + Intergenic
1048847012 8:138611471-138611493 GCTCCAGAGCCCCCCAGGAGTGG - Intronic
1049530552 8:143152347-143152369 CCTCCCCAGCCCCCGGAGAGGGG + Intergenic
1049816835 8:144607565-144607587 CCCACCCCGCCCCCCAGGAGAGG + Intergenic
1051478069 9:17530660-17530682 CCTCACCAGCCCCACAGGACTGG + Intergenic
1052476722 9:28970519-28970541 CCTCCCCCACCCCCCAGCAGTGG + Intergenic
1052971143 9:34377718-34377740 CTTGCCCAGCCCCCGGGGAGAGG - Intergenic
1053303104 9:36965562-36965584 CCTGCACAGCTCCCATGGAGAGG - Intronic
1053510399 9:38682987-38683009 CCAGCCTGGCCCCCAAGGAGGGG + Intergenic
1053575541 9:39355503-39355525 CCTCCCCACCCCCCAAGCTGGGG - Intergenic
1053840046 9:42183442-42183464 CCTCCCCACCCCCAAAGCTGGGG - Intergenic
1054097101 9:60914190-60914212 CCTCCCCACCCCCCAAGCTGGGG - Intergenic
1054118508 9:61189819-61189841 CCTCCCCACCCCCCAAGCTGGGG - Intergenic
1054589249 9:66992745-66992767 CCTCCCTACCCCCCAAGCTGGGG + Intergenic
1055987242 9:82063857-82063879 CCTCCCCACCCCCCAAGCTGGGG + Intergenic
1056532490 9:87498836-87498858 CCTCTCCACCCCGCGAGGAGGGG + Intronic
1056555423 9:87683855-87683877 CCTCCCCAGACCCCACGGCTGGG - Intronic
1056583665 9:87914342-87914364 CCTCCCCACCCTCCAAGCCGGGG - Intergenic
1056584157 9:87917811-87917833 CCTCCCCACCCTCCAAGCCGGGG - Intergenic
1056612712 9:88135114-88135136 CCTCCCCACCCTCCAAGCCGGGG + Intergenic
1056613209 9:88138604-88138626 CCTCCCCACCCTCCAAGCCGGGG + Intergenic
1056828011 9:89890291-89890313 CCTTCCCAGCCTCCAAGAGGTGG + Intergenic
1056956418 9:91085161-91085183 CATCCCCAGCCTCCAGGGAGGGG + Intergenic
1057159933 9:92882421-92882443 CCTCCCCACCCCCCAAGCCGGGG - Intergenic
1057216116 9:93229876-93229898 CCGCCCCAGCCCTCAGGAAGCGG - Intronic
1057469220 9:95342821-95342843 CCTCCCCAGAGGCCAAGAAGTGG + Intergenic
1057497989 9:95575277-95575299 CCTCCCCACCCCTCAGGGACTGG - Intergenic
1058115757 9:101082400-101082422 CCTCCTCCCCCACCAAGGAGGGG + Intronic
1059157698 9:112004591-112004613 CTTCGACAGCCCCCAATGAGTGG + Intergenic
1060183866 9:121552106-121552128 CCTCCCCAGCACCCAGAGGGTGG + Intergenic
1060399640 9:123340713-123340735 CCCCTCCAGCCCCCAAGGAAAGG - Intergenic
1061168861 9:128940530-128940552 ACTCCCCACCCCCTAGGGAGAGG + Intronic
1061389926 9:130311803-130311825 CCTCCGCAGCTCCCCAGGCGGGG - Intronic
1061594789 9:131621802-131621824 CCGCCCTACCCCCCAAGCAGCGG - Exonic
1061762066 9:132857989-132858011 CCACCCCAGCCCCCAAAGTCTGG + Intronic
1061940690 9:133882301-133882323 CCTTCACAGCCCCAAAGGGGCGG + Intronic
1062277142 9:135736489-135736511 CCTCCCCAGCCCCCCAGCCCCGG + Intronic
1062729843 9:138102758-138102780 CTTCCCCAGCCCCAGAGGCGGGG - Exonic
1185952433 X:4451760-4451782 CCTGCCAAGCTCCCAAGGGGAGG + Intergenic
1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG + Intronic
1186507073 X:10101857-10101879 TTTCTCCAACCCCCAAGGAGAGG - Intronic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1189363412 X:40370400-40370422 GCCCCACAGCCACCAAGGAGGGG - Intergenic
1189515554 X:41710761-41710783 CATCCCCAACCTCCAAGGAGGGG + Intronic
1189709556 X:43795520-43795542 CACCCCCAGCCTCCAGGGAGGGG - Intronic
1192792796 X:74399612-74399634 CCTCCCCAGCCCCGACGGGCGGG - Intergenic
1195310657 X:103629209-103629231 CCTCCCCCGTCCCCCGGGAGGGG + Intronic
1195325667 X:103756323-103756345 CACCCCCAGCCTCCTAGGAGGGG - Intergenic
1195564172 X:106323049-106323071 CCTCTCCTTCCCCCAAGTAGGGG - Intergenic
1196199418 X:112868750-112868772 CATCGACAGTCCCCAAGGAGAGG + Intergenic
1196214631 X:113035941-113035963 CCTCCCCAGTCCCCCAGCAGTGG - Intergenic
1196736529 X:118985521-118985543 CCACCCCAGGGCCCAGGGAGAGG - Intronic
1198214769 X:134545855-134545877 CCTCCCTAACCCCCCAGCAGCGG + Intergenic
1198561673 X:137857137-137857159 CCTCTACAGACCCCTAGGAGAGG + Intergenic
1199746310 X:150773947-150773969 CCACCCCAGCCACCTAGAAGGGG + Intronic
1199977631 X:152903793-152903815 AATCCCGAGGCCCCAAGGAGCGG + Intergenic
1200147550 X:153934565-153934587 CCTGCCCAGCCCCGAGGGAGCGG - Intronic
1200875093 Y:8146223-8146245 CCGCCTCAGCCCCCAAGGATTGG - Intergenic
1201739016 Y:17303825-17303847 CCTGCCAAGCTCCCAAGGGGAGG + Intergenic
1202373386 Y:24213002-24213024 CTTCCCTAGCCCTCAAGGTGGGG - Intergenic
1202497395 Y:25457118-25457140 CTTCCCTAGCCCTCAAGGTGGGG + Intergenic