ID: 904886206

View in Genome Browser
Species Human (GRCh38)
Location 1:33740457-33740479
Sequence CAGAAACAGCAGTGGCCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904886203_904886206 3 Left 904886203 1:33740431-33740453 CCTAGTGATAGAAACATTTGCAC 0: 1
1: 0
2: 0
3: 12
4: 169
Right 904886206 1:33740457-33740479 CAGAAACAGCAGTGGCCCTAGGG 0: 1
1: 0
2: 0
3: 33
4: 303
904886201_904886206 15 Left 904886201 1:33740419-33740441 CCTCTGAAATTCCCTAGTGATAG 0: 1
1: 0
2: 1
3: 8
4: 171
Right 904886206 1:33740457-33740479 CAGAAACAGCAGTGGCCCTAGGG 0: 1
1: 0
2: 0
3: 33
4: 303
904886202_904886206 4 Left 904886202 1:33740430-33740452 CCCTAGTGATAGAAACATTTGCA 0: 1
1: 0
2: 0
3: 17
4: 248
Right 904886206 1:33740457-33740479 CAGAAACAGCAGTGGCCCTAGGG 0: 1
1: 0
2: 0
3: 33
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904886206 Original CRISPR CAGAAACAGCAGTGGCCCTA GGG Intronic
900805257 1:4763349-4763371 CAGAAACAGAACTCCCCCTAAGG - Intronic
902173267 1:14630058-14630080 CAGAAACATCATTGGCCCTCAGG + Intronic
903247222 1:22025034-22025056 CGCAAACAGCAGTGGGCATATGG - Intergenic
904886206 1:33740457-33740479 CAGAAACAGCAGTGGCCCTAGGG + Intronic
905291387 1:36924077-36924099 CAGAGACAGCGGTGGGGCTAAGG + Intronic
905589845 1:39153759-39153781 CAGAGGCAGCTGTGGCCCTGGGG + Intronic
905751907 1:40472643-40472665 GAGAAACAACAGTGGGCCCAGGG - Intergenic
906932689 1:50185113-50185135 CTAAAACATCAGTGGCCCTGCGG + Intronic
907254495 1:53168331-53168353 GAGAAACAACAGTGGGCCCAAGG + Intergenic
908024672 1:59938251-59938273 GAGAAAGAACAGTGGCCCCAGGG + Intergenic
909040256 1:70640918-70640940 CATCAACAGCAGTGGCCCCCAGG + Intergenic
910025939 1:82652477-82652499 CAGTAACAGTAGTGGCACAAAGG + Intergenic
910239844 1:85074470-85074492 CAGCAAAAGCAATGGCCCTGAGG - Intronic
910653854 1:89600120-89600142 CAGAAAGACAAGTGGGCCTAGGG + Intergenic
915679801 1:157570250-157570272 CAGTAGCAGCAGAGGCCCCATGG + Intergenic
915815786 1:158963215-158963237 AAGGAACTGCAGTTGCCCTAAGG + Intronic
916098155 1:161369750-161369772 GAGTAACAGCAGTTGCCCTGAGG - Exonic
916106257 1:161434810-161434832 GAGAAACAACAGTGGGCCCAGGG - Intergenic
916291769 1:163174750-163174772 AAGAAACAGAAGTAGCCCTGGGG + Intronic
917174701 1:172220610-172220632 CAGAAACAGCAGTGATTCTCAGG + Intronic
917923736 1:179771726-179771748 CAGTAACAGCAGTGGAGCTGGGG - Intronic
920380361 1:205531513-205531535 AAGAAACAGCCGTGGCCAGAAGG - Exonic
923725926 1:236505410-236505432 GAGAAACAACAGTGGGCCCAGGG - Intergenic
924331784 1:242946808-242946830 CAGAAGCAGCAGTGGCAGTATGG - Intergenic
1064965993 10:21015694-21015716 TAGAAACAGGAGTCTCCCTATGG + Intronic
1065453336 10:25881197-25881219 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1065809405 10:29427624-29427646 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1065869383 10:29943415-29943437 CAGAAACATCAGTGACCGGAGGG - Intergenic
1066515755 10:36158476-36158498 CAGAAACAGCAGGGTTTCTAAGG - Intergenic
1066634684 10:37489089-37489111 CAGAAATAGAAGTGGCTCTCTGG + Intergenic
1069069288 10:63977093-63977115 CAGAAAAAGCAGAGGCACTGGGG - Intergenic
1069121775 10:64576846-64576868 CAGAAACAGCTTGGGCACTATGG + Intergenic
1069409982 10:68143481-68143503 CAGCAAGTGCAGTGGCCCTGAGG + Intronic
1070276563 10:75012931-75012953 AAGAAAAATCAGTGGCCCTTTGG + Intronic
1070998378 10:80806795-80806817 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1072410444 10:95197288-95197310 GAGAAACAACAGTGGGCCCAGGG + Intronic
1072541833 10:96404152-96404174 GAGAAACAACAGTGGGCCCAGGG - Intronic
1072947018 10:99819560-99819582 AAGAAACACCAGTGGCACAACGG + Intronic
1073106242 10:101033627-101033649 GAGAAACAACAGTGGGCCCAGGG + Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1076461008 10:130647442-130647464 CAGGAGCAGGAGTGGCCCTGTGG - Intergenic
1076725925 10:132413104-132413126 TAGAAACAGCAGCGGCCCGAGGG - Intronic
1076941270 10:133610891-133610913 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1076941290 10:133611066-133611088 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1077597445 11:3546261-3546283 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1077603866 11:3593753-3593775 GAGAAACAACAGTGGGCCTAGGG + Intergenic
1080030839 11:27659035-27659057 CAGGAACAGCAGTGGCCTGAGGG + Intronic
1080556052 11:33418461-33418483 CAGACACAGCAGAGCCCCAAAGG - Intergenic
1081019826 11:37931473-37931495 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1082716304 11:56618412-56618434 GAGAAAGAACAGTGGCCCCAGGG + Intergenic
1083259361 11:61514885-61514907 CTGAAACTACAGTGGCCCCATGG + Intergenic
1083426839 11:62592427-62592449 CGCAAAGAGCAGTGGACCTAAGG + Intergenic
1084230656 11:67750311-67750333 AAGAAACAGAAGTGGAGCTAAGG + Intergenic
1084259762 11:67968342-67968364 GAGAAAAAACAGTGGGCCTAGGG + Intergenic
1084685756 11:70694195-70694217 GTCAAACAGCAGAGGCCCTAAGG - Intronic
1085319474 11:75565168-75565190 CAGCAGTAGCAGTGGCCCCAAGG - Intronic
1085710717 11:78826676-78826698 CATAAACAGAAGTGTCCATAGGG - Intronic
1086174287 11:83871298-83871320 TAAAAACAGCAGTGACTCTATGG + Intronic
1088473064 11:110207495-110207517 AAGACACAGCACTGGCCCTTAGG + Intronic
1088858453 11:113777940-113777962 TAGAAACAACAGTGGGCCCAGGG - Intergenic
1089116939 11:116103025-116103047 CAGGGGCAGGAGTGGCCCTAGGG - Intergenic
1090972159 11:131653295-131653317 CAGAAACAGATGTGGCCCACTGG + Intronic
1091333981 11:134753080-134753102 CAGCAGCAGCAGAGGCCCCACGG + Intergenic
1092431063 12:8409312-8409334 GAGAAACAACAGTGGACCTAGGG + Intergenic
1092632298 12:10395073-10395095 GAGAAACAACAGTGGGCCCAGGG - Intronic
1094815580 12:34180367-34180389 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1096804940 12:54134848-54134870 CAGACACAGAAGTGGCTCTGAGG - Intergenic
1097132509 12:56823019-56823041 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1098360026 12:69645601-69645623 CAGAATCAGCAATGAGCCTAGGG + Intronic
1098386806 12:69928402-69928424 CTGATCCAGCAGTGGCCCAAAGG + Intronic
1100115201 12:91295110-91295132 AGCAAACTGCAGTGGCCCTACGG + Intergenic
1100184888 12:92128386-92128408 CAGAAATACAACTGGCCCTAAGG - Intronic
1101514401 12:105420868-105420890 CAGAAACAGCATTGGCCCAGAGG - Intergenic
1103705289 12:122867986-122868008 CAGAAACACCTGTGCCCCCAGGG + Intronic
1103870124 12:124085423-124085445 CTGGAACAGCCGTGGCACTAGGG - Intronic
1104648466 12:130513910-130513932 CAGAAACAACAGTGTCCTTCTGG - Intronic
1105055021 12:133090630-133090652 GAGAAACAACAGTGGGCCCAGGG + Intronic
1105055550 12:133095566-133095588 GAGAAACAACAGTGGGCCCAGGG + Intronic
1106827614 13:33541596-33541618 AAGAAACAGCAGTGGGCCGGAGG - Intergenic
1107667902 13:42711687-42711709 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1107704454 13:43086391-43086413 CAGAAACAGCAATGAACATATGG - Intronic
1108754312 13:53481459-53481481 CAGAAACAGCAGTGTGTCCAAGG - Intergenic
1112023971 13:95395691-95395713 CAGAAAGATCAGTGCCTCTATGG - Intergenic
1112367185 13:98765235-98765257 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1112369556 13:98782783-98782805 CAGAGACAGCTGTGGACCCAAGG + Intergenic
1112849144 13:103682862-103682884 TAGAAAGAGCAGAGGCCCTCAGG + Intergenic
1113030192 13:105984701-105984723 AAGAAACAGTAGTGGCCTGAAGG + Intergenic
1114297528 14:21343163-21343185 CAGAGACTCCAGTGTCCCTAAGG + Exonic
1114608158 14:24015147-24015169 GAGAAACAACAGTGGGCCGAGGG + Intergenic
1117335350 14:54752699-54752721 GAGAAACAACAGTGGGCCCAGGG + Intronic
1119512708 14:75223967-75223989 TAGCAACTGCAGTGTCCCTAAGG - Intergenic
1120223679 14:81765880-81765902 CAGAAACAACAGAGGCCAGAAGG + Intergenic
1121527134 14:94627026-94627048 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1123136389 14:106031323-106031345 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1124077849 15:26462493-26462515 CAGCAACAGCAGTGGCAACACGG - Intergenic
1125562256 15:40644046-40644068 GAGAAACAACAGTGGGCCCAGGG + Intronic
1126378595 15:48022167-48022189 CAGAACTAGCAGTTGCTCTAGGG + Intergenic
1128506412 15:68276215-68276237 CAAAAACAGCATTGGCAATAAGG - Intergenic
1128911046 15:71515406-71515428 CAGAAACAGAAGTGATCCTGGGG + Intronic
1131194753 15:90346655-90346677 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1131223773 15:90607372-90607394 CAGAATCAGAATTGGTCCTAAGG - Exonic
1131946616 15:97629196-97629218 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1132831713 16:1931741-1931763 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1132863310 16:2082007-2082029 CAGAAGCAGTAGGGGCCCTGTGG + Intronic
1133183890 16:4081334-4081356 CAGAACCAGCAGTGGCTCCATGG + Intronic
1134249411 16:12563878-12563900 CAGAGACGGCAGAGGCCCAAGGG - Intronic
1138083933 16:54116673-54116695 CAAACACAGCAGTGGCCCAGGGG - Exonic
1140443943 16:75009059-75009081 CAGAAAGAAAAGTGGCTCTAGGG - Intronic
1141030482 16:80583575-80583597 CAAACACAGCAGTGGCACAATGG + Intergenic
1141095397 16:81159500-81159522 CAGGAACAGCAAAGGCCCCACGG + Intergenic
1141447319 16:84069475-84069497 CAGCAACAGCAGTGGCACTCAGG + Intronic
1141888585 16:86910686-86910708 GACAAACAGCAGTGGCCCGCAGG + Intergenic
1143055354 17:4158163-4158185 AAGGAACAGCTGTGGCCATAGGG - Intronic
1143433918 17:6908700-6908722 CAGCAACAGCAGTGGCACCATGG + Intronic
1143747553 17:9004812-9004834 GAGAAAGAGCTGTGGCTCTATGG + Intergenic
1143927912 17:10389379-10389401 CAGAAAATGCAAAGGCCCTAAGG - Intergenic
1144043079 17:11430241-11430263 CAGAAACTGCAGTTCTCCTATGG - Intronic
1144484713 17:15655226-15655248 CAGAGAGATCAGAGGCCCTATGG - Intronic
1145937845 17:28725738-28725760 CAAAAGCCGCAGTGGCCCCAGGG - Intronic
1146595857 17:34168080-34168102 CTGCACCAGCAGTGGCACTATGG - Intronic
1149465254 17:56873452-56873474 GAGAAAAAACAGTGGCACTAGGG + Intergenic
1149529257 17:57381468-57381490 AAGAACCAGCAGAGGCCATAGGG - Intronic
1152133617 17:78491682-78491704 GAGGAACAGCAGAGGCCCTCGGG + Intronic
1152162069 17:78675033-78675055 CAGAAAAAGCTGAAGCCCTACGG + Exonic
1152261559 17:79269972-79269994 GAGAAGCAGCAGAGGCCCTGAGG - Intronic
1152941468 17:83174898-83174920 CAGAGACAGAAGTGGCCCAGGGG - Intergenic
1155844980 18:30695021-30695043 CAGCAACAACAGTGGCAGTATGG + Intergenic
1156139113 18:34083919-34083941 AACAAACCGCAGTAGCCCTAAGG - Intronic
1156560457 18:38119431-38119453 TAAAAAGAGCAGTGGCCATAAGG - Intergenic
1157303961 18:46502945-46502967 CAGAAATAGCAGAGACCCAAAGG - Intronic
1158234081 18:55293660-55293682 CTGAAATAGTAGGGGCCCTAAGG + Intronic
1158971339 18:62669743-62669765 CAGAAAAAGCAGTGTCCAGAGGG - Intergenic
1159606520 18:70480031-70480053 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1161204122 19:3031717-3031739 CAGAAAGTGCAATGGCCCTGAGG - Intronic
1161592203 19:5133928-5133950 CAGAGACAGCAGCGGCCTCAAGG - Exonic
1161937548 19:7381380-7381402 CCGAAACAGCAGTGGGGCTTGGG + Intronic
1161979523 19:7623446-7623468 AAGAGAGAGCTGTGGCCCTAAGG + Intronic
1163217539 19:15892196-15892218 GAGAAAGAGCAATGGCCCAATGG + Intronic
1164055685 19:21620305-21620327 GAGAAACAACAGTGGACCCAGGG + Intergenic
1164782770 19:30906697-30906719 GAGGAAAAGCAGTGGCCCTCTGG + Intergenic
1166172132 19:41036140-41036162 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1167023943 19:46900789-46900811 CAGCAACTGCAAGGGCCCTAAGG - Intergenic
1167814701 19:51869580-51869602 GAGAAAGAACAGTGGCCCCAGGG - Intronic
1168235498 19:55060579-55060601 GAGAAACAACAGTGGGCCCAGGG - Intronic
924967907 2:94939-94961 GAGAAACAACAGTGGGCCCAGGG - Intergenic
926684139 2:15685531-15685553 CAGATACAGCTGATGCCCTATGG - Intergenic
927567807 2:24128844-24128866 CTGAAACAAAATTGGCCCTACGG - Intronic
927861342 2:26562150-26562172 CAGAAACCTGAGTGGCCTTAGGG - Intergenic
928280992 2:29946335-29946357 CAGAAATACCAGTGTCCCTCAGG + Intergenic
928605137 2:32938553-32938575 CAAATCAAGCAGTGGCCCTAGGG - Intergenic
929223008 2:39484722-39484744 CTAAAACTTCAGTGGCCCTAGGG - Intergenic
929424570 2:41830889-41830911 CAGACACATCAGTGGCTCTGGGG - Intergenic
929872419 2:45770459-45770481 CAGAAACACAAGTGGCCGAAGGG - Intronic
930265146 2:49191010-49191032 CAGAAACAAAAGTGTCACTAAGG - Intergenic
931654269 2:64496781-64496803 TAGCAACAGCAGGGGACCTATGG + Intergenic
932497061 2:72150931-72150953 CAGACACAGCACTGGCCACAAGG + Intergenic
935224325 2:101039977-101039999 CAGAAAAAGCAATGGCCGAATGG + Intronic
935702184 2:105822257-105822279 CAGGAGCAGCAGAGGCCCTCGGG - Intronic
936107423 2:109636933-109636955 GAGAAACAACAGTGGGCCCAGGG + Intergenic
937884459 2:126890367-126890389 CAGAAACAGCAGGGGGCCTGGGG - Intergenic
938713558 2:133997590-133997612 CAGAAACAGCAGTGGTCTCAAGG + Intergenic
938821799 2:134967805-134967827 GAGAAACAACAGTGGGCCTAGGG - Intronic
940452556 2:153858215-153858237 CAGAAAATGCAAAGGCCCTAAGG + Intergenic
941690586 2:168497566-168497588 CAGTAAGTGCAGTGGCCCCATGG + Intronic
941696865 2:168562339-168562361 GAGAAACAACAGTGGGCCCAGGG + Intronic
945025892 2:205619601-205619623 CAGAAAGAGGAGTCGCCTTAAGG + Intronic
946107401 2:217383652-217383674 CAGAAACAGTCGTGGACCTCAGG - Intronic
946615294 2:221502434-221502456 CAGAAACAGCAGTGGGGAGAAGG + Intronic
946901715 2:224379704-224379726 CAAAAACAACAGTGTCCTTAAGG - Exonic
947361277 2:229347867-229347889 CAGACACAGCAGAGGGCCTAAGG - Intergenic
1170456000 20:16533306-16533328 CAGCAACATCAGTGGCTCCAGGG + Intronic
1171183022 20:23104954-23104976 CAGAGACAGGAGTGGGCCAAGGG + Intergenic
1171272802 20:23829416-23829438 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1171968282 20:31547008-31547030 CATATACAGCACTGGCCCTCGGG + Intronic
1173124428 20:40323648-40323670 CACACACAGCAGTGGCCCTTAGG - Intergenic
1173690632 20:44958442-44958464 CAGAAACAGCAGTGGTGCGGTGG + Intronic
1174051965 20:47773178-47773200 AAGAAACAGCAGTGGCCACAAGG + Intronic
1175189470 20:57201516-57201538 CAGAAACAGCAGTTGTCCCTGGG + Intronic
1175382558 20:58573836-58573858 CACAAACAGCAGTCGCCGCATGG + Intergenic
1176201058 20:63860756-63860778 CAGCAACAGCAGTGACCTTCTGG - Intergenic
1176310701 21:5147464-5147486 CAAGACCAGCAATGGCCCTAAGG + Intronic
1177891430 21:26808622-26808644 CAGAAACATCAGAGAACCTATGG + Intergenic
1179846354 21:44114571-44114593 CAAGACCAGCAATGGCCCTAAGG - Intronic
1182876613 22:33697273-33697295 CAGATACAGCAGGGTCCGTAAGG + Intronic
1184840187 22:47048093-47048115 CAGCAACAGCAGTGGAGCTGGGG - Intronic
1185064577 22:48624748-48624770 CAGAAACAGCCGTTACCCCAGGG + Intronic
949804742 3:7942581-7942603 GAGAAACAACAGTGGGCCCAGGG - Intergenic
953382902 3:42487423-42487445 CAGAAGCAGCAGTGGCCATGTGG + Intergenic
953488115 3:43322089-43322111 AAGATACAGCAGTGCCCCTGGGG - Intronic
955878350 3:63518037-63518059 CAAGTACAGCAGTGGCCCCAGGG + Intronic
957067610 3:75538633-75538655 GAGAAACAACAGTGGGCCCAGGG - Intergenic
957069951 3:75559883-75559905 GAGAAACAACAGTGGGCCCATGG - Intergenic
957074712 3:75592766-75592788 GAGAAACAACAGTGGGCCCATGG + Intergenic
960809067 3:121611198-121611220 GAGAAACAACAGTGGGCCCAGGG + Intronic
961159547 3:124711614-124711636 CAGATACAGCTGTTGCCCTGTGG - Intronic
961285538 3:125799343-125799365 GAGAAACAACAGTGGGCCCAGGG + Intergenic
961875009 3:130015669-130015691 GAGACACAACAGTGGGCCTAGGG + Intergenic
963113701 3:141707844-141707866 CAGAAATACCAGTGGCATTAAGG + Intergenic
964212786 3:154246633-154246655 CAGGAACAACAGGGGCCCTGGGG + Intronic
965006352 3:163031214-163031236 CAGAAAAAGGAGGGGCTCTAAGG - Intergenic
968061338 3:195728193-195728215 GAGAAACAACAGTGGGCCCAGGG + Intronic
968725917 4:2247740-2247762 CAGACAGAGCAGGGACCCTAGGG + Exonic
968987359 4:3883444-3883466 GAGAAACAACAGTGGGCTTAGGG + Intergenic
969001479 4:3985998-3986020 GAGAAACAACAGTGGGCCCAGGG + Intergenic
969012188 4:4075199-4075221 GAGAAACAGCAGTGGGCCCAGGG - Intergenic
969018322 4:4120403-4120425 GAGAAACAACAATGGACCTAGGG + Intergenic
969023003 4:4150604-4150626 GAGAAACAACAGTGAGCCTAGGG + Intergenic
969628849 4:8323516-8323538 CAGGAACAGCTGAGGACCTAGGG + Intergenic
969688574 4:8690661-8690683 CAGAAGCAGCAAAGGCCCTGGGG + Intergenic
969735664 4:8988310-8988332 GAGAAACAACAGTTGGCCTAGGG - Intergenic
969741897 4:9034509-9034531 GAGAAACAACAGTGGGCCCAGGG + Intergenic
969794880 4:9519770-9519792 GAGAAACAACAGTAGACCTAGGG - Intergenic
969801266 4:9567406-9567428 GAGAAACAACAGTGGGCCCAGGG + Intergenic
971300989 4:25442314-25442336 CAGCAATAGCAAAGGCCCTAAGG + Intergenic
971353499 4:25873408-25873430 CAGACACAGAAGTCGCTCTAGGG - Intronic
973147097 4:46840766-46840788 CAGTAACAGAAGTGGACATAAGG + Intronic
974723798 4:65773929-65773951 CAGATTCAGCAGTTCCCCTAGGG + Intergenic
975746901 4:77483712-77483734 GAGAAACAGCAGCTGCCCCAAGG - Intergenic
976731120 4:88262990-88263012 CAGAAACACCAGTGGACTAAGGG + Intronic
977296239 4:95212723-95212745 GAGAAGCAGCAGTGGCTCCAGGG - Intronic
978048986 4:104171878-104171900 GAGAAACAACAGTGGGCCCATGG - Intergenic
980951860 4:139387638-139387660 CAGAAACAGGAATGGGACTATGG - Intronic
981739962 4:147991231-147991253 CAGACAAAGACGTGGCCCTAAGG - Intronic
981977655 4:150750000-150750022 CAGCAAGAGCAGAGGCCATAAGG - Intronic
983212819 4:164976268-164976290 GAGAAACAACAGTGGGCCCAGGG - Intronic
983335894 4:166391643-166391665 CAGATATAGCAGTGTCCTTAGGG + Intergenic
985494513 5:196872-196894 GAGAAACAACAGTGGGCCCAGGG + Exonic
986571854 5:9173835-9173857 TAGGAACAGCATTGCCCCTAGGG + Intronic
988062233 5:26186079-26186101 GAGAAACAACAGTGGGCCCAGGG + Intergenic
988063060 5:26198308-26198330 GAGAAACAACAGTGGGCCCAGGG - Intergenic
989049180 5:37301948-37301970 AAGATAAAGCAGAGGCCCTAGGG + Intronic
989296061 5:39828148-39828170 GAGAAACAACAGTGGGCCCAGGG + Intergenic
990619807 5:57547548-57547570 GAGAAACAACAGTGGACCCAGGG - Intergenic
991478281 5:67047405-67047427 CAGCAAGAGCAGAGGCCCTGAGG - Intronic
993313996 5:86375921-86375943 CAGAAAAAGAAGTGGCACAAAGG - Intergenic
994404655 5:99329301-99329323 GAGAAACAACAGTGGGCCCAGGG - Intergenic
994503265 5:100606932-100606954 GAGAAACAACAGTGGGCCCAGGG - Intergenic
996314200 5:122142944-122142966 CAAAAACAGCAGAGTCCATAAGG - Intronic
997228078 5:132224440-132224462 GAGAAACATCAGTGGACCTGAGG + Intronic
998137252 5:139680595-139680617 CAGTGGCAGCAGTGGCCCAAAGG + Exonic
999216856 5:149942570-149942592 GAGAAAGAGCAGTGGGCCCAGGG + Intronic
999372782 5:151066289-151066311 CAGTAAGGGCAGAGGCCCTAAGG + Intronic
999419979 5:151432405-151432427 CAAAAACAGCAGTGACCTCACGG - Intergenic
999560598 5:152797384-152797406 GAGAAACAACAGTGGGCCCAGGG + Intergenic
999989218 5:157034094-157034116 GAGAAAGAGCAGTGGGCCCAAGG + Intronic
1000381243 5:160631455-160631477 CACAAACAGCAATGCCCATAAGG + Intronic
1000527081 5:162371008-162371030 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1000749561 5:165076851-165076873 CAGAAACAACAGAGGCCAGAAGG - Intergenic
1001302597 5:170546557-170546579 CAGAATCAGCAGTTGCCCACAGG + Intronic
1002650554 5:180689646-180689668 GAGAAATAACAGTGGGCCTAGGG + Intergenic
1002669069 5:180850603-180850625 CAGTAACAGCTCTGGCCTTAGGG - Exonic
1002844740 6:936400-936422 CAGCACCAGGAGTGACCCTAAGG - Intergenic
1003265979 6:4565400-4565422 CAGAGTCAGCAGGGGCCCTGGGG + Intergenic
1003574778 6:7282711-7282733 CAGACACAGCAGTGGCCAAAAGG - Exonic
1007751925 6:44076237-44076259 CAGAAAAAGCAGGTGCCCTGGGG + Intergenic
1008585802 6:52947792-52947814 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1009193368 6:60655896-60655918 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1009193779 6:60660859-60660881 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1009540232 6:64945098-64945120 GAGAAACAACAGTGGGCCCAGGG - Intronic
1009866671 6:69406595-69406617 GTGAAGCAGCACTGGCCCTATGG - Intergenic
1009878770 6:69539265-69539287 CAAAAACATCAGTGCCCATATGG - Intergenic
1010301324 6:74263743-74263765 CAGACACAACAGTGGCCATTTGG + Intergenic
1011682173 6:89793803-89793825 CACAAACAGCTGTCACCCTAGGG + Exonic
1012120533 6:95361304-95361326 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1013825042 6:114201558-114201580 CAGAGGGAGCAGTGACCCTAAGG - Intronic
1018060040 6:160083005-160083027 GAGAAACAACAGTGGGCCCAGGG + Intronic
1018198603 6:161376121-161376143 CTGAAGCAGCAGTGGCTCCAGGG - Intronic
1018595829 6:165479406-165479428 CAGGAACTGCAGAGGCCCTGAGG - Intronic
1019355487 7:576703-576725 GAGAAACAGCAGAGGCCAGAGGG - Intronic
1019408901 7:898196-898218 CAGAGGCAGGAGTGGCCCTGGGG - Exonic
1024023502 7:45391691-45391713 CAGAAGCAGCAGTGCCCCTTGGG - Intergenic
1024042545 7:45566561-45566583 GAGAAACAGCAGCTGCCCTAGGG - Intergenic
1024101034 7:46033198-46033220 CAGAAACACCAAAGGCCCTGAGG + Intergenic
1024364202 7:48502479-48502501 CAGAAACAGCAGTGTTCTTTTGG + Intronic
1024385095 7:48741893-48741915 CAGAATCAGCAGATGCCCTAGGG + Intergenic
1025076270 7:55945962-55945984 CAGAATCATCTGTGACCCTAAGG - Intergenic
1026188594 7:68103847-68103869 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1027257713 7:76441863-76441885 CAGGAAGATCAGTGGCCCCACGG - Exonic
1027281135 7:76610172-76610194 CAGGAAGATCAGTGGCCCCACGG + Exonic
1028378843 7:90176135-90176157 GAGAGACAGCTGTGGCCCTTTGG - Intronic
1029076806 7:97941111-97941133 GAGAAACAACAGTGGGCCTAGGG + Intergenic
1029280693 7:99433547-99433569 CAGAAACAGCTGGGGGCCCAGGG - Intronic
1030009230 7:105149549-105149571 GAGAAACAACAGTGGGCCCAGGG - Intronic
1030350365 7:108478251-108478273 CAGCAACTGCAGAGGCCCTGAGG + Intronic
1031648635 7:124258527-124258549 GAGAAACAGAAGTGGCTTTAGGG + Intergenic
1032848698 7:135773778-135773800 TAGAAGCAGCAGTGGCCCTCGGG + Intergenic
1033068563 7:138180244-138180266 CAAAGACAGCAGTGGCCCGTGGG - Intergenic
1033441678 7:141385794-141385816 CAGAAATAGAAGTGGACCCAAGG - Intronic
1033684257 7:143624125-143624147 CAGAACCAGGAGAGCCCCTAGGG + Intronic
1033687434 7:143703344-143703366 CAGAACCAGGAGAGCCCCTAGGG + Exonic
1033700354 7:143833498-143833520 CAGAACCAGGAGAGCCCCTAGGG - Intergenic
1035201254 7:157268176-157268198 CATAAGCAGCAGCGGCCCCATGG - Exonic
1035584966 8:765599-765621 CTGAAACAACAGTGACCCTAGGG + Intergenic
1036240973 8:7080831-7080853 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1036253702 8:7187290-7187312 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1036261086 8:7240748-7240770 GAGAAACAACAGTGGGCCTAGGG + Intergenic
1036274711 8:7340218-7340240 AAGAAACAGCCGTGGCCTCAGGG - Intergenic
1036305523 8:7598799-7598821 GAGAAACAACAGTGGGCCTAGGG - Intergenic
1036313125 8:7699292-7699314 GAGAAACAACAGTGGGCCTAGGG + Intergenic
1036346642 8:7970128-7970150 AAGAAACAGCCGTGGCCTCAGGG + Intergenic
1036356373 8:8046796-8046818 GAGAAACAACAGTGGGCCTAGGG - Intergenic
1036363790 8:8100190-8100212 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1036647462 8:10620618-10620640 AAGACACAACAGTGGCCCCATGG + Intronic
1036863796 8:12377133-12377155 AAGAAACAGCCGTGGCCTCAGGG + Intergenic
1036864417 8:12382177-12382199 AAGAAACAGCCGTGGCCTCAGGG + Intergenic
1036894765 8:12624990-12625012 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1036922713 8:12873178-12873200 CTGTAGCAACAGTGGCCCTAAGG - Intergenic
1037421744 8:18709733-18709755 CAGAAACCACAGCAGCCCTATGG + Intronic
1037907328 8:22723269-22723291 CAGAAACCACAGTGGCCTGAGGG - Intronic
1038021978 8:23558452-23558474 CAGAAGCAACAATGGCCCTAGGG - Intronic
1040042535 8:42931156-42931178 CAGCAACAGCAGTGGGGCAAAGG - Intronic
1040339107 8:46431070-46431092 GAGAAACAACAGTGGGCCCAGGG + Intergenic
1041346313 8:56902129-56902151 CAGCAACAGCAGAGCTCCTAGGG + Intergenic
1041830495 8:62147779-62147801 CAGCAACAGCCCTGGCTCTAGGG - Intergenic
1042045014 8:64640924-64640946 CACAAATAGAAGTTGCCCTATGG - Intronic
1046559850 8:115822272-115822294 CAGAAACAACAGAGGCCAAAAGG - Intergenic
1047610072 8:126512260-126512282 CAGAAACAGCACAGGCCACAGGG - Intergenic
1049540058 8:143204512-143204534 GAGAGACAGGAGTGGCCCTAGGG + Intergenic
1049725957 8:144146598-144146620 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1049743170 8:144250611-144250633 CAGAAACAGCAGCTTCCCTGTGG - Intronic
1052469933 9:28881098-28881120 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1055540828 9:77303517-77303539 GAGAAACAACAGTGGACCCAGGG + Intronic
1057327928 9:94083191-94083213 CAGAAACAGCAGTTGCACAGAGG - Intronic
1060309664 9:122448021-122448043 GAGAAAGAACAGTGGGCCTAGGG + Intergenic
1060938426 9:127529159-127529181 CAGAGACAGCACAGGCCCCAAGG + Intronic
1062230340 9:135479090-135479112 CAGAAACAGCAGCGGCCTCAAGG + Intronic
1185575870 X:1171823-1171845 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1187646234 X:21349508-21349530 AAAAAACTGCAGTAGCCCTATGG + Intergenic
1193087104 X:77456556-77456578 CAGAGACAACCGTGGCCCCAGGG - Intronic
1193240326 X:79161580-79161602 CCTGAACACCAGTGGCCCTATGG - Intergenic
1193894684 X:87098673-87098695 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1195544491 X:106100104-106100126 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1197509595 X:127354828-127354850 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1200555792 Y:4634936-4634958 GAGAAACAACAGTGGGCCCAGGG - Intergenic
1200752399 Y:6958492-6958514 GAGAAACAACAGTGGGCCCAGGG + Intronic
1201229125 Y:11845973-11845995 CAGAAGCAGCAGTGGCAGTATGG - Intergenic
1201452759 Y:14134082-14134104 GAGAAACAACAGTGGGCCCAGGG - Intergenic