ID: 904887420

View in Genome Browser
Species Human (GRCh38)
Location 1:33751328-33751350
Sequence GAGGGTTTCCAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 2, 2: 2, 3: 78, 4: 538}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904887420 Original CRISPR GAGGGTTTCCAGAAGGAGGA AGG Intronic
900142804 1:1145611-1145633 GAGGGCTCCCAGAAGGCCGAGGG + Intergenic
900152221 1:1183669-1183691 GAGGGCTGCCTGGAGGAGGAGGG - Intronic
901055651 1:6447702-6447724 GATGGTTTCCAGATGCAGGAGGG + Intronic
901688848 1:10959704-10959726 AAGGGCTTCCAGAAGCAGAAAGG + Intronic
902112754 1:14096691-14096713 GAAGGCTTCAAGAAGGAGGCAGG + Intergenic
902359151 1:15932613-15932635 GAGAGTCCCCAAAAGGAGGATGG + Exonic
902361586 1:15945085-15945107 GAGGGTTCCCAGCTGGAGAACGG - Exonic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
902478737 1:16700935-16700957 GATGGTTTCCAGATGCAGGAGGG - Intergenic
902748856 1:18492602-18492624 GAAGGTTTCCAGAGGCAGCAAGG + Intergenic
902879950 1:19365420-19365442 GTGGATTTCCAGAAAGAGCACGG + Intronic
903166357 1:21523413-21523435 GAGTCTTTACAGAAGGAGGCAGG - Intronic
903348560 1:22703762-22703784 GGAGGTTTCCAGAAGGGGCATGG + Intergenic
904312101 1:29635550-29635572 GAGGGGTCCCAGAAGGGGGCTGG + Intergenic
904322363 1:29706193-29706215 GGGGGCTTCCAGAAGGGTGAGGG - Intergenic
904368795 1:30035397-30035419 GAGGGCTTCCTGAAAGAGGTGGG + Intergenic
904379978 1:30104018-30104040 GAGGCTTCCTGGAAGGAGGAGGG + Intergenic
904476526 1:30768671-30768693 GAAGGCTTCCAGGAGGAGGCGGG + Intergenic
904495665 1:30885182-30885204 TGGGGTTTACAGAAGGAGGCTGG + Intronic
904499252 1:30904776-30904798 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904939111 1:34152453-34152475 GAGGATTTGGAGAAGGGGGATGG - Intronic
905032123 1:34892389-34892411 TGGGAGTTCCAGAAGGAGGAGGG + Intronic
905217737 1:36421321-36421343 GAGTGTTCCCGGGAGGAGGATGG - Intronic
905369880 1:37477299-37477321 GTTTGTATCCAGAAGGAGGAGGG + Intronic
905489486 1:38332436-38332458 GAGGGTTTCCAAAAAAAGGACGG - Intergenic
905516936 1:38568943-38568965 GAGGGCTTCCAGAAGTAAGAGGG + Intergenic
905602821 1:39268902-39268924 GAGAGTCTCCAAAAGGAAGACGG + Intronic
905858641 1:41331323-41331345 GAGGGCTTCCAGGAGGAAGTGGG + Intergenic
906156211 1:43615469-43615491 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
906259700 1:44377777-44377799 GAGGGGTTCAAGAAGGTGTAGGG - Intergenic
906333664 1:44909280-44909302 GTGAGTTTTCAGAAAGAGGATGG - Intronic
906829949 1:49020593-49020615 GGGGGTGTCCTGGAGGAGGAGGG + Intronic
906870365 1:49472822-49472844 TGGGGATTCCAGAAGGAGGGAGG - Intronic
907049802 1:51322222-51322244 GAGGCCTTGGAGAAGGAGGAGGG - Intronic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
908239776 1:62179028-62179050 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
908403017 1:63788565-63788587 GAGGGTTTTCTGAAGGAGGTGGG + Intronic
908746345 1:67380342-67380364 GAAGGCTTCCTGAAGGAGGAAGG - Intronic
909596984 1:77417155-77417177 AGGGGTTTCCAGAAACAGGAAGG - Intronic
910753398 1:90659149-90659171 AAGGGTTTCAAGTAGGAGAAAGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911048417 1:93648811-93648833 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
913171108 1:116233257-116233279 GAGGGCTTCCATAGGGATGATGG + Intergenic
913531010 1:119734338-119734360 CAGGGCTTCCACAATGAGGAGGG - Intronic
915020951 1:152777902-152777924 GAGGGTATCAGGAAGAAGGAGGG - Intronic
915267743 1:154731095-154731117 CAGGGTTGCCAGTAGGTGGATGG - Intronic
915340952 1:155176303-155176325 GTGGGTTTCCAAAAGGAAGTGGG + Intronic
915699826 1:157781272-157781294 TGGGTTTTCCAGAAGGTGGATGG + Intergenic
915709591 1:157882808-157882830 GTGGCTTCCCAGAAGAAGGAAGG - Intronic
915748562 1:158183296-158183318 GAGGGGTTCCAGACACAGGAAGG + Intronic
916512652 1:165486369-165486391 GATGGGTCCCAGAAGGAGTAGGG - Intergenic
916706841 1:167359353-167359375 TAGGGATTCCAAAAGGGGGAAGG - Intronic
916815014 1:168343252-168343274 GAAGGTTTCCTGAAGAAGGAGGG + Intergenic
916815158 1:168344507-168344529 GAAGGTTTCCTGAAGAAGGAGGG - Intergenic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
919670021 1:200329779-200329801 GAGGGCTTCCAGCAGAGGGAGGG + Intergenic
920054256 1:203181139-203181161 GTGAGTTCCCAGAAGGAGGGAGG - Intronic
920249571 1:204614593-204614615 GTGTGTTTCGAGCAGGAGGAAGG - Intergenic
920274682 1:204795358-204795380 GAGGAGTTCTAGAAGGAAGAAGG + Intergenic
920771753 1:208892992-208893014 GAGGGGTTACAGCTGGAGGACGG + Intergenic
920848194 1:209610954-209610976 GAAGGCTTCCAGGAGGAGGTGGG + Intronic
921221489 1:212977033-212977055 GTGGGTTTCAAGGGGGAGGAGGG + Intronic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
923629901 1:235642945-235642967 CAGGGTTTCCAGACTGAGCATGG - Intronic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
924802045 1:247334823-247334845 GAGGGTTTCAAGTAGGAGTGTGG + Intergenic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1062839759 10:661319-661341 GAGCGTCTCCAGGTGGAGGAGGG - Intronic
1063352314 10:5366842-5366864 GAGGGTTTGCAGAGAGAGAAAGG + Intronic
1063902105 10:10744822-10744844 GAGGCTCTCTAGGAGGAGGAGGG + Intergenic
1063993630 10:11594930-11594952 GATGGGTCCCAGAAGGAGGCAGG + Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1067082542 10:43219673-43219695 GAGGGCCTCCAGAGGCAGGAAGG + Intronic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1068282016 10:54885250-54885272 AAGGGCTTCAAGAAGGGGGAAGG + Intronic
1068895719 10:62198201-62198223 GAAGTTTATCAGAAGGAGGAAGG + Exonic
1069200465 10:65608718-65608740 TAGGGATTCCAAAAGGAGGAAGG + Intergenic
1069592533 10:69650927-69650949 GGGGGTCTCCAGATGGGGGACGG - Intergenic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1070590539 10:77797585-77797607 GAGAGTCTCCAGAAAGAGCAGGG + Intronic
1071515038 10:86291557-86291579 GAGGGCTTCCTGGAGGTGGATGG - Intronic
1071666223 10:87561525-87561547 GAGGATTCCCAAAAGAAGGATGG + Intergenic
1071810695 10:89177735-89177757 GAAAGTTGCCAGAAGGAGTAGGG - Intergenic
1071821328 10:89284155-89284177 GAGGGGTTGCTGGAGGAGGAGGG + Intronic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1076268395 10:129129287-129129309 GAGGGACTCCAGAAGGAGCCAGG - Intergenic
1076489222 10:130845715-130845737 GAGACATTCCAGAGGGAGGATGG + Intergenic
1076621839 10:131793991-131794013 CAGGGCTTCCAGAAGGCGAATGG - Intergenic
1077013213 11:388713-388735 GAGGGTTTCCAGACAGTGCAGGG + Intergenic
1077201324 11:1309098-1309120 AATGGTCTCCAGATGGAGGAGGG - Intronic
1077407813 11:2390560-2390582 GAGGGCTTCTAGGAGGAGGCAGG + Intronic
1077504449 11:2923643-2923665 GAGGGCTTCCTGGAGGAGGTTGG + Intronic
1077614482 11:3665303-3665325 GAGGGTTTGCAGCAGGAGATTGG + Intergenic
1077937689 11:6806419-6806441 GTGGGTTACTAGAGGGAGGAGGG - Intergenic
1078112132 11:8404109-8404131 TATGGTTTTCAGAAGAAGGAAGG + Intronic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078682965 11:13497511-13497533 TAGGGTTACCATAAGGAAGAAGG + Intergenic
1079161818 11:18002033-18002055 TATAGTTTCCAGAAGAAGGAAGG - Intronic
1079632393 11:22694012-22694034 GAGGGTAGCGGGAAGGAGGAGGG + Intronic
1081307390 11:41530233-41530255 GAGTGTTTCAAGAAGGAAGTAGG + Intergenic
1081762125 11:45584030-45584052 AATGGTTTCCAGCAGGGGGAGGG - Intergenic
1081840661 11:46199105-46199127 CAGGGTTTCCAGGAAGAGGTTGG - Intergenic
1082059290 11:47846911-47846933 TAGGGATTCCAAAAGGAGGGAGG - Intronic
1082693043 11:56328405-56328427 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1083192560 11:61062797-61062819 AAGCGTTTCCAGTAAGAGGAGGG + Intergenic
1083492200 11:63021328-63021350 AAGGGATTCCAGAAGGTGGGAGG - Intergenic
1083853367 11:65380251-65380273 GAGGGGTTCAGGCAGGAGGAAGG + Intronic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1084680788 11:70665063-70665085 GAGGGGTCCCTGTAGGAGGAAGG - Intronic
1084683567 11:70680842-70680864 GAGAGTCCCCACAAGGAGGACGG - Intronic
1084939315 11:72603899-72603921 CAGGGTTTCCAGCACAAGGAGGG + Intronic
1085802480 11:79603235-79603257 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1087121689 11:94581628-94581650 AATGGTTTACAGAAGGAGGTGGG + Intronic
1087245851 11:95835891-95835913 GAGGTTATCCAGACAGAGGAGGG + Intronic
1087351544 11:97039931-97039953 TAGGGACTCCAAAAGGAGGAAGG + Intergenic
1088849730 11:113695098-113695120 GGGGCTTTCCAGAAGAAAGATGG + Intronic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1090830183 11:130415905-130415927 GAAGGTTGTCTGAAGGAGGAGGG - Intronic
1091292486 11:134449415-134449437 TAGGGTTTCTTGAAGAAGGAGGG + Intergenic
1091386418 12:98856-98878 GAGGGCGTGCAGAAGTAGGAAGG + Intronic
1091676703 12:2496273-2496295 GATAGTTTCCACAGGGAGGAGGG + Intronic
1092077188 12:5683805-5683827 GAGGGCTTCCTGGAGGAGGCAGG + Intronic
1092672714 12:10882297-10882319 GGGGCTTTCCAGGAGGAGGTGGG + Exonic
1092676980 12:10930978-10931000 GGGGCTTTCCAGGAGGAGGTGGG - Exonic
1093348768 12:18071223-18071245 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1093953989 12:25195499-25195521 GAGGGTTTCGAGAAGGAAACAGG + Intronic
1094423533 12:30296566-30296588 GAGGGTTTCCTAAGAGAGGAAGG + Intergenic
1094524293 12:31221512-31221534 GAGGGCTTCCAGGAAGAGGTGGG + Intergenic
1094753435 12:33439500-33439522 ATGAGTTTCCACAAGGAGGACGG - Exonic
1095244819 12:39907688-39907710 GAGGGCTTTCTGCAGGAGGATGG - Intronic
1095342429 12:41107195-41107217 GATGGTTACCAGTAGGATGATGG - Intergenic
1096609523 12:52791686-52791708 GAGGGTGTCAAGAAGCAGGTGGG - Exonic
1098190663 12:67945167-67945189 GAAGGCTTCCTGGAGGAGGAGGG + Intergenic
1098218019 12:68240350-68240372 GAGGGTTTCAAGCATGAGGAAGG - Intergenic
1098331642 12:69359848-69359870 GAGGGTTTCTAGCCGAAGGAGGG - Exonic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1101221626 12:102647240-102647262 GAGAGGTTCAAGAATGAGGAGGG + Intergenic
1102194176 12:111012663-111012685 GAGGGTTTCAGGAAGGAGGTTGG - Intergenic
1102349679 12:112183339-112183361 GAGGGTTTCCAGGAAAAGGTGGG - Intronic
1102622621 12:114208752-114208774 GAAGGAATCCAGAAGGAGGGAGG + Intergenic
1102890342 12:116553782-116553804 GAGGGTTGCCAGGAGTTGGAGGG + Intergenic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103798757 12:123523494-123523516 GAGGAGTTCCAGAAGCATGAAGG - Exonic
1104084229 12:125459503-125459525 GATGGTTACCAGAAGCTGGAAGG + Intronic
1105273948 13:18904052-18904074 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1105925704 13:25005896-25005918 GGGGGTTTAAAGCAGGAGGAGGG - Intergenic
1107359442 13:39603062-39603084 GAGGGTCTCCAGAAGCGGGCTGG + Exonic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1109606528 13:64704969-64704991 AGGGGTTTGCAGAAGGATGAAGG + Intergenic
1110220843 13:73071222-73071244 GAGGCTTTCTAGAAGGAGTGAGG + Intronic
1110813152 13:79832655-79832677 GAAAGTTTCCAGAAGGAGATGGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111717658 13:91899820-91899842 GAGGGTCTTCAGAGGGAGTATGG + Intronic
1111806398 13:93044116-93044138 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1113270287 13:108666029-108666051 AAGGCTTTTCAGAAGCAGGAAGG + Exonic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1115818399 14:37187906-37187928 GAGGGTTAACCAAAGGAGGATGG + Intergenic
1116787474 14:49303538-49303560 GAGGTCTTCCACAAGAAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117454890 14:55886999-55887021 GAAGGTTTCCAAGAGAAGGAAGG - Intergenic
1118800384 14:69184241-69184263 GAGGGATTTTAGAAGGAGGTGGG + Intergenic
1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG + Intergenic
1119552503 14:75525234-75525256 AAGGGTTCCCAGATGGCGGAGGG - Intronic
1120568262 14:86085888-86085910 GAGGGGCTCCAGAAAGAGGAGGG + Intergenic
1120860192 14:89248071-89248093 GAGGGGTTGGAGCAGGAGGAAGG - Intronic
1121380675 14:93463175-93463197 GAGAGTTTCAAGAAGGAGGGAGG + Intronic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1123023535 14:105413045-105413067 GAAGGCTTCCTGAAGGAGGAGGG - Exonic
1123784064 15:23651097-23651119 GAGGGCTTCAGGAAGCAGGAAGG - Intergenic
1124421101 15:29523099-29523121 GAGGCTTTGCACAAGCAGGAAGG + Intronic
1125532785 15:40424439-40424461 GAGGTCTTCCTGAAGGAGGCAGG - Intronic
1126785748 15:52176807-52176829 GAGGGTTTTGAGAGAGAGGATGG - Intronic
1128729913 15:70014128-70014150 GAGGCCTTCCTGGAGGAGGACGG - Intergenic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129168920 15:73796146-73796168 GAGCGCTTCCTGGAGGAGGAAGG - Intergenic
1129234280 15:74214381-74214403 GAGGGGTTCAAGAAGGGGTAAGG - Intergenic
1129707012 15:77800083-77800105 GAAGGCTTCCTGATGGAGGAGGG + Intronic
1129710396 15:77817883-77817905 GAGAGATTCCAGAAGGATAATGG + Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1131837729 15:96408082-96408104 GGGGGGTTCCAAAACGAGGAGGG - Intergenic
1132436488 15:101808660-101808682 GAGAGTTTCCAAAATGAGGAAGG - Intronic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132762924 16:1519717-1519739 GAGGGCTCCCAGGAGGAGGTGGG + Intronic
1132984846 16:2759979-2760001 GAAGGCTTCCTGAAGGAGGTGGG + Intronic
1134017491 16:10899224-10899246 GTGGGTTTGGAGAGGGAGGAAGG - Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1135785412 16:25344544-25344566 GGAGGTTTCAAGAAGGAGGAAGG + Intergenic
1135971381 16:27074390-27074412 GAGGGTTCCCAGGAGAAGCAGGG + Intergenic
1137341745 16:47614122-47614144 GAGGTTTTCCTCATGGAGGAAGG + Intronic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1141148362 16:81547582-81547604 GAGGGTTTGCAGGTGGAGGGTGG + Intronic
1141617404 16:85217799-85217821 GAGGGCTTCGAGGAGGAGGCAGG - Intergenic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1141656305 16:85418481-85418503 GAGGGCTTCCTGGAGGAGGCGGG - Intergenic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1143140899 17:4741181-4741203 GAGGGCTTCCGAAGGGAGGATGG - Intronic
1143387874 17:6542832-6542854 GAGGGTCTTCAGGAGGAGGTGGG - Intronic
1143477448 17:7211027-7211049 CAGGGTTTCCAGAATGTGGCTGG + Intronic
1144282629 17:13741952-13741974 GAAGGTTTCCTGAAGAAAGAGGG + Intergenic
1144519088 17:15942539-15942561 GAAGGTTTCCTGATGGAGGTTGG + Intergenic
1146074792 17:29718166-29718188 GAAAGTTTCAAGAAGGTGGATGG - Intronic
1146185195 17:30720071-30720093 GAGGGCTTCCTGGAGGAGGTGGG + Intergenic
1147015987 17:37491384-37491406 GAGGGTTGCCACGAGGAGGTAGG + Intronic
1148063625 17:44853177-44853199 CGGGGTTTCCAGAGAGAGGAGGG + Intronic
1148155553 17:45423490-45423512 GAGTGCTTCCTGGAGGAGGAAGG - Intronic
1148508490 17:48147601-48147623 GAGATTTTCCAGAAGGAGAAAGG + Intronic
1148543717 17:48501056-48501078 GAGTCTTTCCTGAAGGAGGGCGG + Intergenic
1149680385 17:58503015-58503037 ATGGGTTCCCAGCAGGAGGATGG - Intronic
1150119246 17:62585838-62585860 GATGGTGTCCAGAAAGAGAATGG + Intronic
1150387240 17:64772147-64772169 GAGTGCTTCCTGGAGGAGGAAGG - Intergenic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1151577413 17:74959716-74959738 GAGGGTTTCAAGATGCAGGAAGG - Intronic
1151588852 17:75029923-75029945 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152261570 17:79270054-79270076 GAGGGTGGCAAGAAGGAGGAAGG - Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1154465614 18:14641105-14641127 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1155007881 18:21745394-21745416 GTGGGTTGCCACAAGGAGGTGGG - Intronic
1156263503 18:35466476-35466498 GGGGGTGTCCAGGAGGGGGATGG - Intronic
1156453626 18:37280590-37280612 GATGGCTTCCAGGAGGAGGTGGG + Intronic
1157294790 18:46434810-46434832 GAGGCCTTCCTGGAGGAGGAAGG + Intronic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1158152902 18:54392750-54392772 TCAGGTTTCCAGAAGGAGAAAGG - Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158624036 18:59056572-59056594 GAGAGGATCGAGAAGGAGGATGG - Intergenic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1160710299 19:548359-548381 GAGGGCTTCCTGGAGGAGGTGGG + Intronic
1161509743 19:4663736-4663758 GAGGCTTTGTAGAATGAGGATGG - Intronic
1161614224 19:5261044-5261066 GAGGGTTTCCTGTAGAAGGCGGG + Intronic
1161701064 19:5795605-5795627 GAAGGCTTCCTGTAGGAGGAGGG + Intergenic
1162516738 19:11152764-11152786 GAGGGGTGGAAGAAGGAGGAGGG + Intronic
1162973585 19:14195618-14195640 GAGGGCTTCCTGAAGGAGGCGGG - Intronic
1163221211 19:15922518-15922540 TTGGGTTTCTGGAAGGAGGATGG - Intronic
1163286478 19:16351640-16351662 GGGGTTTTCCTGCAGGAGGAAGG + Intergenic
1163488249 19:17602212-17602234 GAGGGTGTCCTGAAGAAAGAAGG - Exonic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163962592 19:20711216-20711238 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1164322948 19:24167048-24167070 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1165232008 19:34393176-34393198 CAGGGTTTCCGGCAGGAGGTGGG + Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1166340572 19:42134489-42134511 GAGGGGATCTTGAAGGAGGATGG + Intronic
1166717034 19:44975153-44975175 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1202712756 1_KI270714v1_random:26766-26788 GATGGTTTCCAGATGCAGGAGGG - Intergenic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925722523 2:6842812-6842834 GAGGGTTTTGGGAAGGGGGAAGG + Intronic
926223383 2:10950929-10950951 AAGGGTTTCCTGGAAGAGGATGG - Intergenic
926521437 2:13920513-13920535 GATGGTTACCAGAAGCTGGAAGG + Intergenic
927203996 2:20595494-20595516 GAGGGCTTCCTGGAGGAGGGAGG + Intronic
927508546 2:23630009-23630031 GGGAGTTTCCAGAAGGAAGAAGG + Intronic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
927849783 2:26491617-26491639 GTGGATTTTCAGCAGGAGGAAGG + Intronic
927899700 2:26810555-26810577 TAGGATTTCCAGAAGAAGGTGGG + Intergenic
928063733 2:28141599-28141621 GAAGAATTCCAGAAGGAGCAAGG + Intronic
929224099 2:39495163-39495185 GAGTATTTCAAGAAGCAGGAAGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929801549 2:45108758-45108780 GAGTGTTTCAAGAAGGAAGGAGG + Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
930152138 2:48069910-48069932 GAAGGCATCCAGAATGAGGAAGG + Intergenic
931369239 2:61646865-61646887 ATTGGTTGCCAGAAGGAGGAGGG + Intergenic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
931652849 2:64484110-64484132 GTGGTTTTACAGAAGAAGGAGGG - Intergenic
932192411 2:69752063-69752085 GAAGGCTTCCTGGAGGAGGAAGG + Intronic
933264575 2:80168508-80168530 GAAGGTGATCAGAAGGAGGAGGG - Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
934608290 2:95714408-95714430 GTGGGATTCCAGAAGGAGTTGGG + Intergenic
935122247 2:100193175-100193197 GAGGTTTTGCAGTAGGAGAAAGG + Intergenic
935727428 2:106036058-106036080 GAGGCTTTGCTGAAGAAGGAAGG - Intergenic
937058930 2:118967208-118967230 GAAGGTGTCCTGAAGCAGGACGG + Intronic
937239280 2:120449989-120450011 GAGGGCTTCCTGAAGGAGGTGGG + Intergenic
938302697 2:130228285-130228307 GGGGGCTTCCCGGAGGAGGAAGG - Intergenic
938348664 2:130583151-130583173 GGGGGGTTTCAGGAGGAGGATGG - Intronic
938407180 2:131039173-131039195 GTGGCTCTCCAGGAGGAGGAAGG - Intronic
938663240 2:133508318-133508340 GAGGGCTTCCCCAAGGAGGAGGG - Intronic
938934213 2:136115118-136115140 GATGATTTCCAGGAGGATGAAGG + Exonic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
940037302 2:149324266-149324288 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
940534808 2:154927240-154927262 AAGTGTTTCTAGAAGGAGAATGG + Intergenic
940613710 2:156024118-156024140 AAGGGCTTCCAGAAGGAAGCTGG + Intergenic
940905755 2:159167916-159167938 GAGGGTTTTCAGAAGACAGATGG + Intronic
941770529 2:169340563-169340585 GTGGGATTGCAGAAGGAGAAAGG - Intronic
941916914 2:170818910-170818932 GAGGGCTTCGCGGAGGAGGAGGG + Intronic
942395758 2:175547777-175547799 GAGGGTCTGCATAAGCAGGAAGG - Intergenic
943739528 2:191396301-191396323 ATTGGTTTCCAGAAGGAGTATGG + Intronic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
945142156 2:206698472-206698494 GAGGGTTCCCGGAAGGAGAAGGG - Intronic
946784980 2:223234410-223234432 TAGGGACTCCAAAAGGAGGAAGG + Intergenic
947836460 2:233179486-233179508 GAGGCTTTAGAGAAAGAGGAGGG + Intronic
948282704 2:236760230-236760252 GAAAGTTTCAGGAAGGAGGAAGG + Intergenic
948583839 2:239005977-239005999 AAGGGCTTCTAGAAGGAGGCGGG - Intergenic
948902981 2:240965501-240965523 GAGGGTGCCCGGAAGGAGGTGGG + Intronic
949017983 2:241724344-241724366 GAGGGTTTTGAGAAGGGGTACGG + Intronic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170144821 20:13161609-13161631 GAAAGTTTCAAGAAGGAGGAGGG + Intronic
1170599810 20:17832700-17832722 GAGGTGTTCCAGAAGAAGGAAGG + Intergenic
1170827797 20:19811175-19811197 GAGTGATTCCAGAAGGATGGAGG + Intergenic
1171492673 20:25532298-25532320 TAGGATTTCCAGAAGAGGGAAGG + Intronic
1172012933 20:31856924-31856946 GAGTGTTTCAAGGAGGAGGGAGG + Intronic
1172031985 20:31988773-31988795 GAGGGCTTCCTGTAGGAAGAAGG + Intronic
1172042023 20:32052527-32052549 GAGGGGTCCCAGGAGGCGGAGGG + Intronic
1172226629 20:33309726-33309748 CTGGGTTTCCACAAGGAGGCTGG - Exonic
1172272632 20:33663298-33663320 GAGGGTTTCCAGAAAGGAGGCGG + Intronic
1172442601 20:34976732-34976754 GGGGGTCCCCAGAAAGAGGATGG + Intronic
1172588950 20:36104328-36104350 GAGAGTTTCAGGAAGGAGGCGGG + Intronic
1172648575 20:36487104-36487126 GAGGCTCTGCAGATGGAGGAGGG + Intronic
1172669786 20:36627080-36627102 CAGGCTTTCCAGATGGAGGGAGG + Intronic
1173419338 20:42887081-42887103 GAGCGTTTAAAGGAGGAGGATGG - Intronic
1173795746 20:45858037-45858059 GAGGGCTGCCTGGAGGAGGAGGG + Intronic
1174009621 20:47439147-47439169 AGCTGTTTCCAGAAGGAGGAGGG - Intergenic
1174273114 20:49384006-49384028 GTGGGTTTGGAGTAGGAGGAAGG - Intronic
1174474074 20:50783536-50783558 GAGGGTTTAGAGGTGGAGGAAGG - Intergenic
1174924117 20:54738312-54738334 GGGGTCTTCCAGAAGGTGGAGGG + Intergenic
1175249593 20:57601205-57601227 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1175851792 20:62097696-62097718 GAGGGTTCCCAGGAAGAGGGTGG + Intergenic
1175923958 20:62462984-62463006 GAAGGCTTCCAGGAGGAGGTGGG + Intergenic
1176671728 21:9740930-9740952 GCGGGTGTCAAGAAGGAGGTGGG + Intergenic
1176808943 21:13517377-13517399 GAGGGTGGCGAGAGGGAGGAGGG + Intergenic
1177208651 21:18042284-18042306 GAAGGTTTGCAGAAGGGGGTGGG - Intronic
1177864721 21:26499401-26499423 TAGGGATTCCAGAGGGAGTATGG + Intronic
1178182564 21:30179638-30179660 GTGGCTTTCAAGATGGAGGACGG + Intergenic
1179154773 21:38840279-38840301 GGGGATTTCCAGAAGGAGACTGG + Intergenic
1179725388 21:43338859-43338881 GAGGGTCTGCAGAAGCAGGCGGG + Intergenic
1180073534 21:45450403-45450425 TAGGGTGGCCAGAAGCAGGAGGG + Intronic
1180600495 22:17012293-17012315 GAGGGCTTCTTGGAGGAGGAGGG + Intergenic
1180756584 22:18166135-18166157 GAGGTTCTCCAGACTGAGGACGG - Intronic
1180760412 22:18198157-18198179 GAGGGTTGCCACAAGGACGACGG + Intergenic
1180770725 22:18382454-18382476 GAGGGTTGCCACAAGGACGACGG + Intergenic
1180775257 22:18426539-18426561 GAGGGTTGCCACAAGGACGACGG - Intergenic
1180808331 22:18737594-18737616 GAGGGTTGCCACAAGGACGACGG - Intergenic
1180828669 22:18885413-18885435 GAGGGTTGCCACAAGGACGACGG + Intergenic
1181027624 22:20134899-20134921 GAAGGCTTCCTGAAGGAAGAGGG - Intronic
1181071253 22:20342559-20342581 GAGGGTTGCCACAAGGACGACGG - Intergenic
1181075185 22:20371298-20371320 GAGGTTCTCCAGACTGAGGACGG + Intronic
1181150973 22:20883330-20883352 GAGGCTATCCAGAGGGATGAGGG - Intronic
1181194328 22:21171508-21171530 GAGGGTTGCCACAAGGACGACGG - Intergenic
1181215115 22:21321270-21321292 GAGGGTTGCCACAAGGACGACGG + Intergenic
1181414022 22:22746469-22746491 GAGTGTCTCCTGAAGGAGGCTGG - Intronic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181812866 22:25414798-25414820 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1182026664 22:27124499-27124521 GAGGGCTCCCAGAAGGCGGCAGG + Intergenic
1182102350 22:27667167-27667189 GCTGGCTTCCAGAAGGAGCATGG - Intergenic
1182491613 22:30676003-30676025 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1182679024 22:32063851-32063873 GAGGGAGTCCAGAATGAGGAAGG + Intronic
1182851428 22:33477962-33477984 GAGGGCTTCCAGGAAAAGGAAGG - Intronic
1183279887 22:36926288-36926310 GAGGGTTTCTTGAGGGATGAGGG + Intronic
1183616682 22:38950101-38950123 GAAGGGTTCCACATGGAGGATGG + Intergenic
1184402346 22:44281326-44281348 TAGGGAGTCCAGCAGGAGGACGG + Intronic
1184684800 22:46091415-46091437 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684836 22:46091559-46091581 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684845 22:46091595-46091617 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184886138 22:47345408-47345430 GAGGGTGTCCTGCATGAGGAGGG + Intergenic
1203232561 22_KI270731v1_random:123626-123648 GAGGGTTGCCACAAGGACGACGG + Intergenic
1203278760 22_KI270734v1_random:111401-111423 GAGGGTTGCCACAAGGACGACGG + Intergenic
949495713 3:4629806-4629828 GAGGGCTTCCTGGAGGAAGAAGG + Intronic
950457247 3:13100044-13100066 GAGAGTTCCGAGTAGGAGGATGG + Intergenic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952171401 3:30811046-30811068 GAGGGTTTCTGGAAGGGGAAGGG - Intronic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
952440175 3:33318950-33318972 GTGTGTTTCCTGAAGGAGAAGGG + Intronic
952704402 3:36362780-36362802 GAGGGTGTCAAGAGGAAGGAGGG - Intergenic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
953469651 3:43155813-43155835 AAGGATTTCCAGAAGAAGAAGGG - Intergenic
954156419 3:48687336-48687358 GAGGGCTTCTGGGAGGAGGAAGG - Intergenic
954486116 3:50853192-50853214 GATGGTTACCAGAAGCTGGAAGG - Intronic
955126306 3:56115886-56115908 GAGGGATTACAGCAGGGGGAGGG - Intronic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
955675288 3:61442013-61442035 TAAGGTTGCCACAAGGAGGATGG - Intergenic
955789229 3:62571434-62571456 GAGCTTTTGGAGAAGGAGGAAGG - Intronic
956703299 3:71977745-71977767 GAGGGTTTCAAGAGGGGGCAGGG + Intergenic
959720531 3:109482148-109482170 TAGGGTTTATTGAAGGAGGAAGG + Intergenic
959829849 3:110847796-110847818 GAGGTTTGCCAGAAGAAAGAAGG + Intergenic
960740702 3:120830405-120830427 GAGGGTTTTCAGTGGGAGAAGGG + Intergenic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
962202358 3:133412469-133412491 GGGAGTTTCCAGAAAGAGCAGGG + Intronic
962950124 3:140210756-140210778 GTGGGTTTGAAGGAGGAGGAGGG + Intronic
963035324 3:141020651-141020673 GATGGCTTCCAAGAGGAGGAAGG + Intergenic
963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964524924 3:157607931-157607953 GATGGTTGGCAGAAGGAGGGAGG - Intronic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
969607157 4:8208084-8208106 GAGGGTTGCCAGGTGGAGGATGG - Intronic
969620505 4:8276536-8276558 GAGGGCTTCCTGTAAGAGGAGGG + Intronic
971656658 4:29355172-29355194 GATGGTTTCCAGAGTAAGGAAGG - Intergenic
972050583 4:34727767-34727789 GATGTTTTCCTGGAGGAGGAGGG + Intergenic
972584005 4:40419924-40419946 GGGAGTTTCCAGAAGGCAGAGGG + Intergenic
972952739 4:44348847-44348869 GAGAGTTTCAATAAGCAGGAGGG - Intronic
973553199 4:52055976-52055998 GATGGTTTCAAGAAGCAGAAGGG - Intronic
973697723 4:53507216-53507238 GAGGGGTCACAGAAGGTGGAAGG + Intronic
974328739 4:60449029-60449051 GGTGGTTTCCAGGAGCAGGAGGG + Intergenic
975137926 4:70892598-70892620 GGAGGTTGCCAGAAGGAGGAAGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975618748 4:76274687-76274709 TAGGTTTTCCAGGAGGAAGAAGG + Intronic
976647731 4:87402749-87402771 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
977101153 4:92816528-92816550 AAAGGTTTCCACAAGGAGAAGGG + Intronic
979130894 4:117043755-117043777 GAAGGTTTCCATATGGGGGAGGG - Intergenic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
980127453 4:128787606-128787628 GATGGTGTCCAGATGCAGGAAGG + Intergenic
981115238 4:140982376-140982398 GAAGGTTTTCAAGAGGAGGAAGG - Intronic
982464206 4:155710134-155710156 GAGGGTTTCCAGCAGCAAAAGGG - Intronic
984938383 4:184909721-184909743 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
985403013 4:189610897-189610919 GCGGGTGTCAAGAAGGAGGTGGG - Intergenic
985497861 5:219674-219696 GAGGGCGTCCACAAGCAGGAAGG + Intronic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986295659 5:6435948-6435970 AATGCTTTCCAAAAGGAGGATGG + Intergenic
986428037 5:7654233-7654255 CAGGGTTTCAGGAAGGAAGAAGG + Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987123316 5:14788263-14788285 GGAGGTTTCCTGAGGGAGGAAGG - Intronic
987691063 5:21267733-21267755 GAGGTTTTTAAGAAGGAGGAGGG + Intergenic
987956494 5:24748216-24748238 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988456867 5:31394514-31394536 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
988483308 5:31647464-31647486 TAGAGCTTCCAGAAGGAGCACGG - Intronic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
988780209 5:34513797-34513819 GAGCTCTTCTAGAAGGAGGAAGG + Intergenic
988859969 5:35267513-35267535 GAAGGTTTCTAGAAGGAGGTGGG + Intergenic
989241061 5:39203150-39203172 GAGAGTTTCTTGAAAGAGGAAGG + Intronic
990047690 5:51454758-51454780 GAAGGTTTCCAGAAGAAAGCGGG - Intergenic
990168085 5:53017615-53017637 GTGGGGCTCCAGAAGGAGCAGGG + Intronic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
991894952 5:71385513-71385535 GAGGAATTCCAGAACGAGGTGGG - Intergenic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993996146 5:94725618-94725640 GAGAGTTTAGAGAAGGAGGTGGG + Intronic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
994771462 5:103987075-103987097 GCAGGTTTTCAGAAGCAGGAGGG + Intergenic
995142616 5:108749536-108749558 GCGGGGCTCCAGAAGCAGGAAGG - Intronic
995449945 5:112289568-112289590 GAAGGATACCAGAAGGAGCATGG - Intronic
996105778 5:119500811-119500833 AAGTGTGTCAAGAAGGAGGAGGG + Intronic
996633733 5:125666340-125666362 GAGGGTTTCCATTAAGAAGAAGG + Intergenic
996926862 5:128837700-128837722 AAGGGATTAGAGAAGGAGGAAGG + Intronic
997025853 5:130060054-130060076 CAGGTTTTCCAGAAGGAGTTAGG - Intronic
997436629 5:133880387-133880409 GAGGGCTTCCTGGAGGAGGCAGG - Intergenic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
998401865 5:141852547-141852569 GGGGGTTTCTGGAAGGAAGAGGG + Intergenic
998707721 5:144782929-144782951 AAGGGTTTGCAGCAGGAGGTGGG + Intergenic
999247369 5:150162292-150162314 GAGGGCTTCCAGGGGGAAGAGGG + Intergenic
999538159 5:152541483-152541505 GAGGGTTTTATGAAGGAGAAGGG + Intergenic
1000073990 5:157767733-157767755 GAGGGTGGCCAAATGGAGGAAGG + Intergenic
1001155789 5:169271538-169271560 GAGGGTTTCAGGAAGGAGGCAGG + Intronic
1001411346 5:171514660-171514682 GCAGGTTTCAAGAAGGAGGGAGG + Intergenic
1001791852 5:174464502-174464524 GAGTGGTTCTGGAAGGAGGAAGG - Intergenic
1001817822 5:174685283-174685305 GGGGGTTGCCAGAAGCTGGAGGG + Intergenic
1002058283 5:176610741-176610763 GAGGGTATCCAGGGGGAGGGGGG - Intergenic
1002342456 5:178526094-178526116 GAGGGCTTCCTGAAGGAGAGAGG + Intronic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002479045 5:179487265-179487287 GAGGGTTTCACAAAGGAGGAAGG - Intergenic
1002591887 5:180296123-180296145 GGGGGATTCCCGGAGGAGGAGGG - Intergenic
1003565980 6:7222576-7222598 GAAGGTGTCCAGAAACAGGAGGG + Intronic
1003601608 6:7522632-7522654 GAGTTTTTCCTGAATGAGGATGG + Intergenic
1004288548 6:14345738-14345760 TAGAGTTTCCAGAAGGAAGGAGG + Intergenic
1004351947 6:14897948-14897970 TAGTGTTTCCAGAAGAAGAAAGG - Intergenic
1006431950 6:34002539-34002561 GAAGGCTTCCTGAAGGAGGTAGG + Intergenic
1007826935 6:44607650-44607672 GGTGGTTTCCAGGAGGAGGTGGG + Intergenic
1007836883 6:44680903-44680925 GAAGGCTTCCTGAAGGAGGTGGG - Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1010686264 6:78858065-78858087 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1010722004 6:79293446-79293468 TAGTGATTCCAAAAGGAGGAGGG - Intergenic
1012018851 6:93890197-93890219 GAGTGTTGCAAGAAGGTGGAAGG - Intergenic
1012469355 6:99553594-99553616 GAAGATTTACTGAAGGAGGAAGG - Intronic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1013774996 6:113669708-113669730 GAGAGTTTCCAGAAGCAGCCAGG + Intergenic
1014249113 6:119097986-119098008 GAGGTTTTGCATCAGGAGGAGGG + Intronic
1014813623 6:125911588-125911610 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1015455529 6:133423129-133423151 GAGGGTTTGCAGGAGGATCAGGG + Intronic
1015568839 6:134601370-134601392 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1015613044 6:135046206-135046228 GAAGGCTTCTAGAAGGAGGTGGG - Intronic
1015691031 6:135923029-135923051 GAGGTTTTCCAGAAGGTGGTTGG - Intronic
1016353802 6:143195725-143195747 GAGCACTTCCAGAAGGAGGCAGG + Intronic
1017983310 6:159421589-159421611 GAGGGTCTCCAGCAGGACCATGG - Intergenic
1018108628 6:160513532-160513554 GAGGGTTAGCAGAAGCAGGCTGG + Intergenic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1018452121 6:163919099-163919121 GAGGGGATCCAGCAGCAGGAAGG + Intergenic
1018486758 6:164248484-164248506 GAATGTTTCCAGAAAAAGGAAGG + Intergenic
1018691194 6:166345460-166345482 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1018788852 6:167130974-167130996 GAGGGGGTCCAGAGGGAGGGTGG - Intronic
1018939973 6:168302623-168302645 AAGGGTTTGCAGCAGGAGGGAGG + Intronic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019455308 7:1123729-1123751 GAGGGTTTTCAGATGGAGTGTGG - Intronic
1019777251 7:2919192-2919214 AAGGGCTTCCTGGAGGAGGAGGG + Intronic
1020508297 7:9020414-9020436 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1021927320 7:25546020-25546042 GATGGTTTCCAGAGGCTGGAGGG + Intergenic
1022454352 7:30545553-30545575 TAGGGGTTGCAGAAGGATGAAGG - Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024134574 7:46393223-46393245 GTGGGTTTTCAGAAGGAGCTTGG - Intergenic
1025101098 7:56135904-56135926 GAGGTTTTGCAGCAGGAGAAAGG + Intergenic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1026317767 7:69241948-69241970 GAGGTTTTGCAGCAGGAGAAAGG + Intergenic
1026318251 7:69246161-69246183 GAGGTTTTGCAGCAGGAGAAAGG - Intergenic
1026569656 7:71518165-71518187 GAGGGTTTTAAGCAGGAGCATGG + Intronic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1028922886 7:96326405-96326427 GAGGAATTCTAGAATGAGGAGGG - Intergenic
1029179279 7:98688266-98688288 GGGGGCTTCCAGGAGGAGGTGGG + Intergenic
1029623825 7:101707268-101707290 GAAGGCTTCCTGAAGGAGGTGGG - Intergenic
1030143281 7:106327261-106327283 GACAGTTCCTAGAAGGAGGAGGG - Intergenic
1030436146 7:109523227-109523249 ACGGGTTTCCAAAAGGGGGAAGG + Intergenic
1030883663 7:114913164-114913186 TAGGGCCTCCAGATGGAGGATGG - Intergenic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1031187656 7:118503089-118503111 GATGGATTCCAGATGGAGTAAGG + Intergenic
1031361031 7:120848508-120848530 GAAGTTTTCCAGAAGAAAGATGG + Intronic
1033086317 7:138345267-138345289 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1033597474 7:142867674-142867696 GATGGCTGCCAGCAGGAGGAAGG - Exonic
1033717856 7:144021444-144021466 GAGAGTTTTGATAAGGAGGATGG - Intergenic
1034224316 7:149471065-149471087 GAGTGATTCCTGTAGGAGGAAGG + Intergenic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1035688991 8:1547523-1547545 GGGGCCTGCCAGAAGGAGGAAGG + Intronic
1036017259 8:4799021-4799043 GGGGGTTTCCAGCAGGAGCGTGG + Intronic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1036381178 8:8237442-8237464 GGGGGCTTGCAGCAGGAGGAGGG + Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037764029 8:21760886-21760908 AAGAGTTTCGAAAAGGAGGATGG + Intronic
1038722962 8:30054509-30054531 GATGGTTTCCTGAGGGATGATGG + Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040301397 8:46189824-46189846 GAGGGTTTCCAAAATGAGAGAGG - Intergenic
1040309591 8:46229849-46229871 GAGGGATTCCGGAATGAGGGAGG - Intergenic
1041686020 8:60645260-60645282 GCAGGTTTCCAGAAAGTGGAAGG - Intergenic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1041903584 8:63008214-63008236 TAGAGTTTCCAGGAGGAGGGGGG - Intergenic
1042083995 8:65088374-65088396 GTGAGTTTCCAGAAGCAAGAAGG + Intergenic
1043214168 8:77564571-77564593 GAGGCCTTCCAGAAGGTGGAAGG + Intergenic
1044705395 8:95003696-95003718 GAATGTTTGCAGAAGGAGAAAGG - Intronic
1045976692 8:108137725-108137747 GAGGGCCTCAAGAAGCAGGAAGG + Intergenic
1046388989 8:113542860-113542882 CAGGGTTTCTATTAGGAGGATGG + Intergenic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1049268973 8:141684144-141684166 GAGGGCTTCCCCAAGGAGGGTGG - Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1049405616 8:142450683-142450705 GAGGGCTTCGAGAAGGAGTCTGG - Intronic
1049794148 8:144488871-144488893 GAGGGTTTCAGGATGGAGGGTGG + Intronic
1050416539 9:5423603-5423625 GAGTGTTTCAAGAAGAAAGAAGG - Intronic
1051355968 9:16239996-16240018 GAGGGTTGCGGGGAGGAGGAGGG - Intronic
1051589831 9:18766440-18766462 TGGGGTTTCCAACAGGAGGAAGG + Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052041683 9:23746440-23746462 GAGCGTTTTCAGAATGAGTAAGG + Intronic
1052528786 9:29655743-29655765 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1052736140 9:32344569-32344591 GAAGGCTTCCAGAAGGCAGAAGG - Intergenic
1052856051 9:33407250-33407272 GAAGGCTTCCTGAAGGAAGAGGG + Intergenic
1053298854 9:36934660-36934682 GAGGGCTTCCTGGAAGAGGAAGG - Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055582077 9:77716482-77716504 AAGGGTTTCCAACAGGATGATGG + Exonic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1056847719 9:90055261-90055283 GATGCTTTCCAGAAGGAGGGTGG + Intergenic
1057079667 9:92163480-92163502 GCAGGTTTTCAGAGGGAGGAAGG - Intergenic
1057370198 9:94464535-94464557 TAGAGTATCCAGAAGGAAGAAGG + Intergenic
1057809940 9:98250111-98250133 GAAGGCTTCCAGGAGGAGGCTGG + Intronic
1057891591 9:98874110-98874132 GATGGCACCCAGAAGGAGGAAGG - Intergenic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059365192 9:113781388-113781410 GAAGGCTTCCTGAAGGAGGAGGG - Intergenic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1059603357 9:115805928-115805950 TGGGGATTCCAGAAGGGGGAAGG + Intergenic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060736130 9:126067526-126067548 GAGGCCTTCCTGGAGGAGGAGGG - Intergenic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1062277616 9:135738164-135738186 GAGGGCTTCCTGGAGGAGGTGGG - Intronic
1062325199 9:136009520-136009542 GTTGCTTTCCAGAAGGAGGTGGG - Exonic
1062407331 9:136403183-136403205 GAGGGTTTCCAGAGCGGGGAGGG + Intronic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1187188390 X:17009768-17009790 GAGGGTTTAAAGGATGAGGATGG - Intronic
1188115759 X:26240310-26240332 GATGGTTTCCCAAAGGAGAATGG - Intergenic
1188365643 X:29312096-29312118 GAAAGTTTCCAGAGGGAGAATGG + Intronic
1188575522 X:31645273-31645295 GAGACTTCCCACAAGGAGGATGG - Intronic
1190284042 X:48950428-48950450 GAGAGCTTCCAGAAGGAGTGTGG + Intronic
1191086377 X:56571819-56571841 CATGGTTTCCAGAACAAGGAAGG + Intergenic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1191971307 X:66819751-66819773 GGGGGGTTCCAGAGGGAGGAGGG + Intergenic
1192564541 X:72152775-72152797 TAGGATTTCCAGAATTAGGAAGG + Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1194596245 X:95862151-95862173 GAGGGTATCAAGCAGGAGGAAGG + Intergenic
1194675002 X:96783740-96783762 GAGTGATTCCCAAAGGAGGAAGG - Intronic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197290372 X:124649037-124649059 GAGGGACTCCAGGAGGAAGATGG + Intronic
1197923847 X:131626064-131626086 GAGAATTTAAAGAAGGAGGAGGG + Intergenic
1198162576 X:134022194-134022216 GAGTGTTTCAAGAATGAGGAAGG - Intergenic
1198344542 X:135746803-135746825 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1198640525 X:138751012-138751034 GAGAGTTTCAGGAAGGAAGAAGG + Intronic
1199104607 X:143849140-143849162 GAAGGTTTTCAGAAGGAGTTTGG + Intergenic
1200033208 X:153312651-153312673 GGGGCTTTCCAGGAGGAGAATGG + Intergenic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic
1200819317 Y:7566067-7566089 TAGGGATTCCAAAAGCAGGAAGG + Intergenic
1201453283 Y:14140168-14140190 AAGGCTTTCCTGAAGAAGGATGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1202127283 Y:21579793-21579815 GACGCTTTCCACAATGAGGAAGG - Intergenic