ID: 904892225

View in Genome Browser
Species Human (GRCh38)
Location 1:33788115-33788137
Sequence AGGGCCTTCTGGTTGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 294}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904892225_904892233 -1 Left 904892225 1:33788115-33788137 CCTCAAAACAACCAGAAGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 294
Right 904892233 1:33788137-33788159 TCAGAACAAAGAGGTGGCTGGGG 0: 1
1: 0
2: 4
3: 38
4: 371
904892225_904892231 -3 Left 904892225 1:33788115-33788137 CCTCAAAACAACCAGAAGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 294
Right 904892231 1:33788135-33788157 CCTCAGAACAAAGAGGTGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 265
904892225_904892228 -7 Left 904892225 1:33788115-33788137 CCTCAAAACAACCAGAAGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 294
Right 904892228 1:33788131-33788153 AGGCCCTCAGAACAAAGAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 242
904892225_904892227 -10 Left 904892225 1:33788115-33788137 CCTCAAAACAACCAGAAGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 294
Right 904892227 1:33788128-33788150 AGAAGGCCCTCAGAACAAAGAGG 0: 1
1: 0
2: 0
3: 17
4: 243
904892225_904892234 12 Left 904892225 1:33788115-33788137 CCTCAAAACAACCAGAAGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 294
Right 904892234 1:33788150-33788172 GTGGCTGGGGCTCAGAGAAGTGG 0: 1
1: 0
2: 27
3: 78
4: 712
904892225_904892237 30 Left 904892225 1:33788115-33788137 CCTCAAAACAACCAGAAGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 294
Right 904892237 1:33788168-33788190 AGTGGAATAACATGCCTAAGGGG 0: 1
1: 0
2: 1
3: 14
4: 96
904892225_904892236 29 Left 904892225 1:33788115-33788137 CCTCAAAACAACCAGAAGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 294
Right 904892236 1:33788167-33788189 AAGTGGAATAACATGCCTAAGGG 0: 1
1: 0
2: 2
3: 17
4: 187
904892225_904892232 -2 Left 904892225 1:33788115-33788137 CCTCAAAACAACCAGAAGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 294
Right 904892232 1:33788136-33788158 CTCAGAACAAAGAGGTGGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 294
904892225_904892235 28 Left 904892225 1:33788115-33788137 CCTCAAAACAACCAGAAGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 294
Right 904892235 1:33788166-33788188 GAAGTGGAATAACATGCCTAAGG 0: 1
1: 0
2: 10
3: 55
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904892225 Original CRISPR AGGGCCTTCTGGTTGTTTTG AGG (reversed) Intronic
901425232 1:9178486-9178508 AGGGCTTTCTATTTGCTTTGGGG + Intergenic
901720252 1:11191703-11191725 AGGTTCTTCTGAGTGTTTTGAGG + Intronic
901940101 1:12655480-12655502 TGGGCCTTCTGCTTGTAGTGAGG + Intronic
901988226 1:13092393-13092415 TGGGCCTTCTTGATGCTTTGGGG + Intergenic
901993586 1:13134374-13134396 TGGGCCTTCTTGATGCTTTGGGG - Intergenic
902153085 1:14460659-14460681 TGGGACTTCTGGTTGATGTGTGG - Intergenic
903442410 1:23397903-23397925 AGGGGCTGCTAGGTGTTTTGGGG + Exonic
903925749 1:26829311-26829333 AGGGCACTCTGGCTGTTGTGTGG - Intronic
904892225 1:33788115-33788137 AGGGCCTTCTGGTTGTTTTGAGG - Intronic
905026145 1:34851133-34851155 AGTACCTACTGGTTGTTGTGAGG + Intronic
905997842 1:42397218-42397240 AGGGCCATGTAGTAGTTTTGTGG + Intronic
908650658 1:66329140-66329162 AGGGCCTTCAGGTTGCTGTGAGG + Intronic
910620761 1:89251175-89251197 ATTGTTTTCTGGTTGTTTTGTGG - Intergenic
911823520 1:102449753-102449775 AGGTCTTTTTGTTTGTTTTGGGG + Intergenic
913121797 1:115749321-115749343 ATGGCCTTCTGGTTATCTTATGG + Intronic
917300357 1:173567702-173567724 TTTGCTTTCTGGTTGTTTTGTGG + Intronic
917306539 1:173630920-173630942 TTGGTTTTCTGGTTGTTTTGTGG - Intronic
917416679 1:174817692-174817714 AGGTCATTCTGGTTGCTGTGTGG + Intronic
917664882 1:177216158-177216180 ATTGTTTTCTGGTTGTTTTGTGG + Intronic
920594303 1:207253429-207253451 TGGCTCTTCTGGTTCTTTTGTGG + Intergenic
921103099 1:211948480-211948502 AGGGACTTCAGGCTGTTTTCAGG + Intronic
922219429 1:223546864-223546886 AGGGGTTTTTGTTTGTTTTGTGG + Intronic
922762793 1:228142828-228142850 AGGGTCTTGTGGTAGTTTGGTGG + Intronic
923713574 1:236406215-236406237 AGGGACTTCGGGCTATTTTGTGG + Intronic
1063787357 10:9400863-9400885 GGGGCCTTTTTGTTCTTTTGAGG + Intergenic
1064141025 10:12790391-12790413 AGGGCCTTCTGGGTGCTGTGGGG - Intronic
1064540490 10:16399989-16400011 ATGGCTTTGTAGTTGTTTTGTGG + Intergenic
1065898570 10:30185355-30185377 TGGGGCTTTTGTTTGTTTTGGGG - Intergenic
1066362164 10:34741623-34741645 AGGGCATTCTCTTTGTTCTGTGG - Intronic
1067766573 10:49091669-49091691 AGGGGCCTCTGGTTCTTTCGGGG + Intronic
1069027142 10:63554915-63554937 AGGCCCTTGTGGTTGTAGTGGGG + Intronic
1069802959 10:71093646-71093668 AGGGCCTGATGGTGGTTTTTTGG - Intergenic
1070749833 10:78957458-78957480 AGGGCCTTCTGGCTTTGTGGTGG - Intergenic
1071051366 10:81452979-81453001 AGTGCTTTGTGTTTGTTTTGAGG + Intergenic
1072862990 10:99026070-99026092 TGTGTTTTCTGGTTGTTTTGTGG - Intronic
1077433357 11:2526768-2526790 GGGGCCTTCTGGCTGTCCTGGGG + Intronic
1077892809 11:6431615-6431637 AGGGGCTTCTGGGTGCTTAGAGG - Intronic
1083135636 11:60673451-60673473 AGTGCTTGCTGGTTGTTCTGAGG + Intergenic
1084498910 11:69523110-69523132 AGGGCATTATGGCTGTTGTGAGG + Intergenic
1086272340 11:85082508-85082530 AGGGTCTTCTGCTTTTTTGGTGG - Intronic
1086303837 11:85459207-85459229 AGGGCCTTTTGGTTGACTTCAGG + Intronic
1088269803 11:108022220-108022242 AGGGATTTCTGGGTGTTTTCGGG + Intronic
1090111416 11:123913503-123913525 TGGTTTTTCTGGTTGTTTTGTGG - Intergenic
1090314588 11:125774007-125774029 AAGGCCATGTGGTTGTGTTGTGG - Intergenic
1090865563 11:130697810-130697832 AGGGCCTTCTGGGTCTGCTGGGG + Intronic
1094828318 12:34288484-34288506 AGGGCCTTCTTGCCGCTTTGGGG - Intergenic
1094830862 12:34299617-34299639 TGGGCCTTCTTGATGCTTTGGGG - Intergenic
1094832612 12:34307337-34307359 CGGGCCTTCTTGCTGATTTGGGG - Intergenic
1094834691 12:34316794-34316816 CGGGCCTTCTTGCTGATTTGAGG + Intergenic
1094837080 12:34327169-34327191 TGGGCCTTCTTGCTGCTTTGAGG + Intergenic
1095098122 12:38158714-38158736 GGGGCCTTCTTGCTGCTTTGTGG - Intergenic
1095639512 12:44471521-44471543 TGTGTTTTCTGGTTGTTTTGTGG + Intergenic
1095953951 12:47796075-47796097 AGAGCCTCCTGGGTGTTCTGGGG - Intronic
1097309755 12:58105632-58105654 AGGGCCATGTGGTTGCTGTGTGG + Intergenic
1097596406 12:61637736-61637758 AGGGTTTTTTGTTTGTTTTGTGG + Intergenic
1097684896 12:62682101-62682123 ATGGCCTCCAGGTTTTTTTGAGG + Intronic
1100052514 12:90466471-90466493 TGGCCCTTTTTGTTGTTTTGAGG + Intergenic
1101868028 12:108537117-108537139 GGGGTTTTCTGGTTGTTTTCGGG + Intronic
1102469333 12:113150684-113150706 GGGCCCTTCTGGCTGCTTTGAGG - Intronic
1104206465 12:126643331-126643353 GGGGCCTTCTGGCTGCTTCGTGG + Intergenic
1106963839 13:35036054-35036076 TTGGTTTTCTGGTTGTTTTGTGG + Intronic
1107348346 13:39487665-39487687 AGTGCATTCAGGTTATTTTGTGG + Intronic
1107583921 13:41823421-41823443 AAGGGCTTCTGGTTATCTTGGGG - Intronic
1112618598 13:101031985-101032007 ATTGTTTTCTGGTTGTTTTGTGG + Intergenic
1113063902 13:106355082-106355104 AGAGCCTTGTGTTAGTTTTGTGG - Intergenic
1114072428 14:19124712-19124734 TTGGTTTTCTGGTTGTTTTGTGG + Intergenic
1114089831 14:19275263-19275285 TTGGTTTTCTGGTTGTTTTGTGG - Intergenic
1116225796 14:42150830-42150852 AGGGGCTTTTGGCTATTTTGAGG - Intergenic
1116231847 14:42228591-42228613 AGGGCCTCTTGGTTGTTTCTTGG + Intergenic
1116985989 14:51221017-51221039 AGGGCCTTCTATTTGTTTCTTGG + Intergenic
1117161157 14:52991617-52991639 TGTGTTTTCTGGTTGTTTTGTGG + Intergenic
1119609832 14:76052398-76052420 AGGGAATCCAGGTTGTTTTGCGG + Intronic
1119883656 14:78122321-78122343 TGGGCCTTCTGGTCCTATTGAGG + Intergenic
1120219055 14:81712334-81712356 AGTTCCTTCTGGTGGTTTCGTGG - Intergenic
1121376931 14:93420057-93420079 TTTGCTTTCTGGTTGTTTTGTGG - Intronic
1123137736 14:106045209-106045231 AGTGTCTCCTGGTTGTCTTGTGG + Intergenic
1202899444 14_GL000194v1_random:27033-27055 TGGGCCTTCTGCCTGCTTTGGGG + Intergenic
1123626496 15:22230310-22230332 GGGGCCTTCTGGAAGTTTTCAGG + Intergenic
1123895371 15:24823683-24823705 AGAGCCTTCTGTGTGGTTTGCGG + Exonic
1124808089 15:32906629-32906651 AAGGCCATTTGGTTGTATTGGGG - Intronic
1124955143 15:34355571-34355593 AAGTCCTTCTGGTTCTGTTGAGG + Exonic
1127024537 15:54789169-54789191 AGGGCATTCTGGGGGTCTTGGGG - Intergenic
1127499752 15:59544906-59544928 AGGGCCTTCTCCTTGGTTGGGGG + Intergenic
1128364730 15:66990548-66990570 GTTGCTTTCTGGTTGTTTTGTGG - Intergenic
1133395768 16:5446290-5446312 CGGGTCTTCTGCATGTTTTGAGG - Intergenic
1134026002 16:10954394-10954416 AGGGCCTTCTGGTAGTTACTAGG + Intronic
1135681482 16:24460962-24460984 CAGGCTGTCTGGTTGTTTTGGGG - Intergenic
1137622333 16:49884086-49884108 AGGTCCCTCTGGCTGTTTTGTGG - Intergenic
1138531829 16:57638664-57638686 AGGGTGTTCAGCTTGTTTTGAGG + Intronic
1141724974 16:85782009-85782031 AGGGCTTTCTGGTTGGAATGAGG - Intronic
1142029202 16:87830058-87830080 AGGGTGTTCTGGCTTTTTTGTGG - Exonic
1142547359 17:714384-714406 TGGGGGTTCTGGTGGTTTTGGGG - Intronic
1143498051 17:7323621-7323643 AGGGCCGTCTGTGTGTGTTGGGG - Intronic
1144512193 17:15886835-15886857 AGGGGCCTCTGGTTCTTCTGTGG - Intergenic
1146018249 17:29250606-29250628 AGGGTCTTGTGGCTGTTCTGAGG - Intronic
1148367346 17:47066014-47066036 AGGGTCTGCTGCTTCTTTTGTGG + Intergenic
1149001381 17:51761211-51761233 AGGGCTATCTGTCTGTTTTGGGG - Intronic
1150185842 17:63180593-63180615 AGGTTCTTCTGGTTGCATTGAGG - Intronic
1150998059 17:70341800-70341822 AGGGCCGTGTGGTTGTTGTAAGG - Intergenic
1151694619 17:75707827-75707849 AGGGCACTGTGGATGTTTTGTGG + Exonic
1153304712 18:3621063-3621085 AGGTCCTTCTGGTAATTCTGAGG + Intronic
1155063144 18:22246403-22246425 AGAACTTTCTGGTTATTTTGAGG + Intergenic
1155198412 18:23496538-23496560 AGTGCCTACTGGTAGTTCTGTGG + Intergenic
1158203233 18:54962749-54962771 AGGGCACTCTGGGTGGTTTGGGG - Intergenic
1160014289 18:75128572-75128594 TGTGCCTTCTGGTTGTCTTTAGG - Intergenic
1160910575 19:1472037-1472059 AAGGCTGTCAGGTTGTTTTGGGG + Exonic
1163720809 19:18897323-18897345 AGGGCCACCTGGATGTGTTGTGG - Intergenic
1165246220 19:34500003-34500025 AGAGTCTTCATGTTGTTTTGCGG + Intronic
1165874646 19:38997487-38997509 AGAGCCCTCTGGTTGCTCTGTGG + Intronic
1167696982 19:51020568-51020590 AGGGCCTTCTGGTTGTCAAGTGG - Intergenic
1202648250 1_KI270706v1_random:159712-159734 TGGGCCTTCTGCTTGCTTTTGGG - Intergenic
1202648297 1_KI270706v1_random:159909-159931 TGGGCCTTCTGTCTGTCTTGGGG - Intergenic
925884650 2:8384238-8384260 AGGTCATTCTGGCTGCTTTGGGG + Intergenic
926029060 2:9569761-9569783 AGGGTTTTTTGTTTGTTTTGAGG - Intergenic
927055238 2:19360615-19360637 AGGGCTTTCTGGAAGTTCTGAGG - Intergenic
927062898 2:19440915-19440937 AGGCCCATCTGCTTGCTTTGGGG - Intergenic
927706824 2:25301617-25301639 AGGGACTTGTGGGTGGTTTGTGG - Intronic
928749487 2:34455141-34455163 ATTGTTTTCTGGTTGTTTTGTGG + Intergenic
929574986 2:43045924-43045946 AGGCCCTGCTGGTTGAGTTGGGG - Intergenic
930475710 2:51878601-51878623 CTGGGTTTCTGGTTGTTTTGTGG - Intergenic
930764302 2:55069374-55069396 GGGGCTTTCTGATTTTTTTGAGG - Intronic
931427470 2:62184298-62184320 AGGGGCTGTTGGTTGTCTTGGGG - Intergenic
931644392 2:64408405-64408427 AGGGACTTCTGCTTGTTTTGTGG - Intergenic
931810308 2:65848463-65848485 AGGTCACTCTGGTTGTTGTGTGG + Intergenic
933617922 2:84503038-84503060 TTTGCTTTCTGGTTGTTTTGTGG + Intergenic
933915184 2:86984051-86984073 AAGGTCTTTTGGTTGTTTTCTGG + Intronic
934007809 2:87785849-87785871 AAGGTCTTTTGGTTGTTTTCTGG - Intronic
935850094 2:107209330-107209352 AGGAACTTCAGGTTATTTTGAGG - Intergenic
935995031 2:108761396-108761418 AAGGTCTTTTGGTTGTTTTCTGG + Intronic
936130412 2:109834299-109834321 AAGGTCTTTTGGTTGTTTTCTGG + Intronic
936214285 2:110537186-110537208 AAGGTCTTTTGGTTGTTTTCTGG - Intronic
936374223 2:111927064-111927086 AGGGCCTTCTGTGTGCTTTAGGG - Intronic
936423422 2:112391749-112391771 AAGGTCTTTTGGTTGTTTTCTGG - Intronic
937108604 2:119343420-119343442 AGGGCTTTTTTGTTGTTTTAGGG - Intronic
938486669 2:131718197-131718219 TTGGTTTTCTGGTTGTTTTGTGG + Intergenic
939120832 2:138114273-138114295 AGGGGCTTCTGGCTGATTTTTGG - Intergenic
940077718 2:149761865-149761887 AGGGCATTTTGGTTGTTTCTAGG + Intergenic
940314845 2:152317565-152317587 TTTGTCTTCTGGTTGTTTTGTGG + Intergenic
941086284 2:161121876-161121898 ATGGACATCTGTTTGTTTTGTGG - Intergenic
941751373 2:169138289-169138311 AGAGCTTTCTGGTTTTTTTGAGG - Intronic
942412398 2:175724512-175724534 AGGGCCTGCAGATTTTTTTGTGG - Intergenic
942552231 2:177131439-177131461 AGACCCTTCTGGTTGCTGTGTGG + Intergenic
947467556 2:230366679-230366701 ATTGTTTTCTGGTTGTTTTGTGG + Intronic
947664059 2:231892097-231892119 AGGGACTTTTGTTTGTTTAGGGG - Intergenic
948926006 2:241098481-241098503 AGGGCCTTCTGGAGGAGTTGGGG - Intronic
1168786547 20:544457-544479 AGTGCTTTGTGGCTGTTTTGGGG - Intergenic
1169326724 20:4682657-4682679 AGTCCACTCTGGTTGTTTTGTGG - Intergenic
1169644609 20:7796046-7796068 AGGTCCTTCTGGCTGTGATGTGG + Intergenic
1170612125 20:17923308-17923330 AGGGTCTTCTGGGGGTTCTGTGG + Intergenic
1171262823 20:23748363-23748385 AGGACCTGCTGGTTCTTGTGAGG - Intronic
1171311807 20:24150801-24150823 AGGGCCTGGCGGTGGTTTTGGGG - Intergenic
1172419239 20:34800319-34800341 TTGGTTTTCTGGTTGTTTTGTGG - Intronic
1173373090 20:42457751-42457773 AGGGCTTTTTAGGTGTTTTGAGG + Intronic
1175744065 20:61441564-61441586 AGGGCCTTTGGGTGGTTATGAGG + Intronic
1175747786 20:61472411-61472433 TGTGCTTTATGGTTGTTTTGTGG + Intronic
1176603551 21:8812782-8812804 TGGGCCTTCTGTCTGTCTTGGGG + Intergenic
1176603597 21:8812982-8813004 TGGGCCTTCTGCTTGCTTTTGGG + Intergenic
1176618437 21:9040133-9040155 AGTGCCTTCTGCATGCTTTGGGG + Intergenic
1176618821 21:9041805-9041827 TGGGCCTTCTGCCTGCTTTGGGG + Intergenic
1177508985 21:22058674-22058696 AGGCTTTTCAGGTTGTTTTGTGG - Intergenic
1180345836 22:11704339-11704361 TGGGCCTTCTGTCTGTCTTGGGG + Intergenic
1180345882 22:11704533-11704555 TGGGCCTTCTGCTTGCTTTTGGG + Intergenic
1180353603 22:11822584-11822606 TGGGCCTTCTGTCTGTCTTGGGG + Intergenic
1180384640 22:12169774-12169796 TGGGCCTTCTGTCTGTCTTGGGG - Intergenic
1180490873 22:15847084-15847106 TTGGTTTTCTGGTTGTTTTGTGG + Intergenic
1180755242 22:18156511-18156533 AGTCCCTCCTGGTTGGTTTGTGG - Intronic
1180787492 22:18554965-18554987 ATGGCTTTCTGGCTTTTTTGTGG - Intergenic
1181244400 22:21494491-21494513 ATGGCTTTCTGGCTTTTTTGTGG - Intergenic
1181966476 22:26659478-26659500 AAGGGGTTATGGTTGTTTTGGGG - Intergenic
1182201662 22:28578005-28578027 TGTGTTTTCTGGTTGTTTTGTGG + Intronic
1182602384 22:31476423-31476445 AGGCTTTTCTGGATGTTTTGTGG - Intronic
1184594368 22:45504855-45504877 TGGGCCTTTTGTTTCTTTTGGGG + Intronic
1184830224 22:46981314-46981336 AGTGCCTTATGGTTGCTGTGAGG - Intronic
949829009 3:8194459-8194481 TGAGTTTTCTGGTTGTTTTGTGG + Intergenic
951102549 3:18705785-18705807 TTTGTCTTCTGGTTGTTTTGTGG - Intergenic
952977394 3:38707889-38707911 AGGGACCTCTGGTTCTCTTGAGG + Intronic
953396663 3:42578145-42578167 AGGACATTTTGGTTGTTTTCAGG - Intronic
957778792 3:84791900-84791922 TCTGCTTTCTGGTTGTTTTGTGG - Intergenic
958846951 3:99276384-99276406 TGGGTCTTCTGGGTCTTTTGTGG + Intergenic
959588578 3:108050503-108050525 AGGGCATTCTAACTGTTTTGCGG + Intronic
960895817 3:122503926-122503948 AGTGGCTGCTGGGTGTTTTGGGG + Intronic
961977233 3:131039339-131039361 AGGGTGTTGTGCTTGTTTTGGGG - Intronic
964140544 3:153394295-153394317 TGTGTTTTCTGGTTGTTTTGTGG + Intergenic
964936389 3:162093992-162094014 TGGTTATTCTGGTTGTTTTGTGG + Intergenic
965619290 3:170626260-170626282 AGGGCTTTCTCCTTGTCTTGTGG - Intronic
965964880 3:174475827-174475849 TGGGCCTTGTGGTAGTTGTGGGG + Intronic
967245500 3:187482635-187482657 AGATCATTCTGGTTGCTTTGGGG - Intergenic
968968849 4:3783117-3783139 AGGGCTTTATTGTTGTTTTGAGG + Intergenic
969576108 4:8036627-8036649 AAGGCCTACTGGCTCTTTTGTGG - Intronic
970213800 4:13737814-13737836 AGGTCATTCTGGCTGTTTTGTGG + Intergenic
971567605 4:28165704-28165726 TTCGCTTTCTGGTTGTTTTGTGG + Intergenic
972327787 4:38034128-38034150 TGGGAGTTCTTGTTGTTTTGTGG + Intronic
973374277 4:49276788-49276810 TGGGCCTTCTGCCCGTTTTGGGG - Intergenic
973374526 4:49277864-49277886 TGGGCCTTCTGTCTGTCTTGGGG - Intergenic
973382885 4:49332377-49332399 TGGGCCTTCTGTCTGTCTTGGGG + Intergenic
973383135 4:49333451-49333473 TGGGCCTTCTGCCCGTTTTGGGG + Intergenic
973386509 4:49517420-49517442 TGGGCCTTCTGTCTGTCTTGGGG + Intergenic
974301232 4:60069752-60069774 TTTGCTTTCTGGTTGTTTTGTGG - Intergenic
974791570 4:66696724-66696746 AGGACTTTTTGTTTGTTTTGTGG - Intergenic
975285711 4:72616941-72616963 TTTGCCTTCTGGTTGTTTTGTGG - Intergenic
975675021 4:76818830-76818852 TGGTTGTTCTGGTTGTTTTGTGG + Intergenic
981880610 4:149606403-149606425 AGGGCCTTCTAGTAGTTTAAAGG - Intergenic
982212382 4:153048881-153048903 AGGGCATTCTGAGTGGTTTGAGG + Intergenic
983333327 4:166359479-166359501 AGTGCCTGATGGTTGGTTTGTGG + Intergenic
984626068 4:182009317-182009339 AGAGCCTCCTGGTAGTTCTGAGG - Intergenic
987428369 5:17799712-17799734 AGGGCTGTTTAGTTGTTTTGTGG + Intergenic
988120393 5:26953844-26953866 GGATCATTCTGGTTGTTTTGTGG - Intronic
988433903 5:31150809-31150831 TGTGCCCTCTGCTTGTTTTGTGG + Intergenic
989428049 5:41318693-41318715 TGTGTCTTCTGGTTGTGTTGTGG - Intronic
991394970 5:66195587-66195609 TTTGCTTTCTGGTTGTTTTGCGG + Intergenic
991481450 5:67085387-67085409 AGAGCCTTCTAGCTGTTCTGTGG - Intronic
991981047 5:72231030-72231052 AGGTCCTTCTGGCTGTACTGTGG - Intronic
992499221 5:77325144-77325166 CTGGTCTTTTGGTTGTTTTGGGG + Intronic
992577527 5:78132730-78132752 TGTGTCTTCTGGTTGTTGTGTGG + Intronic
995406550 5:111803979-111804001 AGGGACTACTAGTTGTATTGGGG - Intronic
995594096 5:113730402-113730424 GGGGCCTTATTTTTGTTTTGTGG + Intergenic
997224540 5:132199019-132199041 TGGGAGTTCTGGTTGTTTTCAGG - Intronic
997652330 5:135531696-135531718 AGTGCCTCCTGGTTGCTTAGTGG + Intergenic
997832907 5:137166914-137166936 TTTGCCTCCTGGTTGTTTTGTGG - Intronic
999424579 5:151476245-151476267 AGGGCCTTCTGGTTGCCATGTGG + Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1000648813 5:163790231-163790253 AAGGCCTTCTGTTTGTCTTTTGG + Intergenic
1001465733 5:171964235-171964257 AGGGCCTGGTGGAAGTTTTGTGG - Intronic
1002418914 5:179135320-179135342 AGAGACTTCCGGTTGTTTTCGGG + Intronic
1003254141 6:4459673-4459695 AGGGCCAGCTGGTTGTTAAGAGG + Intergenic
1003720867 6:8700797-8700819 AGGTCACTCTGGATGTTTTGGGG - Intergenic
1004066946 6:12256364-12256386 GGGGTCTTTTGTTTGTTTTGCGG - Intergenic
1006374367 6:33663704-33663726 AGGGCCTTCTACCTGATTTGGGG + Intronic
1006509299 6:34513312-34513334 AGGGCCTTTTGCTTAATTTGTGG + Intronic
1006893496 6:37450155-37450177 AGTCCCTTTTGATTGTTTTGGGG + Intronic
1007462764 6:42030371-42030393 GGAGCCTTCTGGTTGTTCTGTGG + Intronic
1007497830 6:42273301-42273323 TGGGCATTATGGTTGGTTTGAGG - Intronic
1008665464 6:53711600-53711622 AGGTATTTCAGGTTGTTTTGGGG - Intergenic
1008781016 6:55105059-55105081 AGGGACATATGGTTGTTATGGGG + Intergenic
1011447182 6:87453833-87453855 TTTGCTTTCTGGTTGTTTTGTGG - Intronic
1012053368 6:94372257-94372279 AGGATCCTATGGTTGTTTTGAGG - Intergenic
1012140964 6:95626086-95626108 AGAGCCTTGTGATTATTTTGGGG - Intergenic
1014379136 6:120716770-120716792 TTTGTCTTCTGGTTGTTTTGTGG - Intergenic
1014832387 6:126118238-126118260 AGGGCCTGCTGCTGGTTTTGTGG - Intergenic
1015409292 6:132874126-132874148 AGAGCCTTCAGGTTACTTTGAGG - Intergenic
1015912775 6:138185294-138185316 AGGGCCTCCTGGCTGTGTTAAGG + Intronic
1016185259 6:141190736-141190758 AGGCCATTCTGGGTCTTTTGTGG + Intergenic
1016420907 6:143881947-143881969 AGGGACTTCTAGTTGTTTTCAGG + Intronic
1017068691 6:150552605-150552627 AGCCCCTTCTGCTTGTTTTTAGG + Intergenic
1017162766 6:151381171-151381193 AGGTCATTCTGGCTGTTGTGTGG - Intronic
1017535935 6:155348496-155348518 AGGGTCTTCTGCTTGTTTCTTGG + Intergenic
1017998168 6:159553114-159553136 ATTGTTTTCTGGTTGTTTTGTGG + Intergenic
1019660936 7:2223677-2223699 AGGGTCTCTTGGTTGTTGTGAGG - Intronic
1020356481 7:7281020-7281042 AGGGGCTTCTGGCTGATTTTTGG - Intergenic
1021130768 7:16910841-16910863 TGTGTTTTCTGGTTGTTTTGTGG + Intergenic
1023636914 7:42221136-42221158 GTGGCTTTCTGGTTGTTGTGGGG + Intronic
1026042837 7:66882902-66882924 AGGGCTTCATGGTTTTTTTGGGG - Intergenic
1027201569 7:76067150-76067172 AGGGACTTCTTGTTGTACTGAGG + Exonic
1027718194 7:81701913-81701935 AGAGATTTCTGGTTTTTTTGAGG + Exonic
1028752383 7:94395105-94395127 AGTGCCTTCAGCTTGTTTGGGGG + Intronic
1029796881 7:102905660-102905682 TCTGTCTTCTGGTTGTTTTGTGG + Intronic
1030752749 7:113250646-113250668 ATTGTTTTCTGGTTGTTTTGTGG - Intergenic
1031333367 7:120495220-120495242 AGGTAATTCTGGTTGTTTTTAGG + Intronic
1032851175 7:135796857-135796879 TTGCCCTTCTGGTTGTTGTGAGG + Intergenic
1032863933 7:135907031-135907053 AGGGTCTTCTGCTTGTTCTCAGG + Intergenic
1036066372 8:5385452-5385474 AAGGCCTGTTGGGTGTTTTGTGG + Intergenic
1037523921 8:19706530-19706552 ATGTCCTTCTGGGTGTTTTGTGG - Intronic
1039762098 8:40588872-40588894 TGGGCATTGGGGTTGTTTTGAGG - Intronic
1040110371 8:43564538-43564560 GGGGACTTCTTGCTGTTTTGGGG + Intergenic
1040277761 8:46022644-46022666 GGGGCCTTCTTATTGCTTTGTGG + Intergenic
1040278610 8:46026342-46026364 GGGGCCTTCTTGCTGCTTTGGGG + Intergenic
1041464231 8:58142864-58142886 AGGGGCTTCGTGTTGTTTTGAGG - Intronic
1041556362 8:59160852-59160874 AGGGCTTTCTGGTTCGTTTATGG - Intergenic
1041795718 8:61745646-61745668 AGGGCCATGTGTATGTTTTGGGG + Intergenic
1043561410 8:81498216-81498238 TGGGCTTTCTTCTTGTTTTGGGG - Intergenic
1043627211 8:82276232-82276254 TTTGCTTTCTGGTTGTTTTGTGG - Intergenic
1043760294 8:84060312-84060334 TTTGCTTTCTGGTTGTTTTGTGG + Intergenic
1045426471 8:102071198-102071220 AGGCCATTCTGCTTGGTTTGTGG - Intronic
1047300057 8:123606294-123606316 AGGGGCTTTTGACTGTTTTGAGG + Intergenic
1047762512 8:127964487-127964509 AGGCCCTTATTGTTTTTTTGTGG + Intergenic
1049610065 8:143550777-143550799 AGGGCATGCTGATTGGTTTGTGG - Intergenic
1049856271 8:144863934-144863956 ACGACAGTCTGGTTGTTTTGAGG + Intergenic
1051793968 9:20842762-20842784 ATTGTTTTCTGGTTGTTTTGTGG + Intronic
1052861499 9:33440632-33440654 AGATCCCTCTGGTTGCTTTGTGG + Intergenic
1056453891 9:86741976-86741998 GTGGGCTTCTGGTTGCTTTGTGG + Intergenic
1056457889 9:86781159-86781181 AGTGCCTTCAGGTGGCTTTGGGG - Intergenic
1056778879 9:89534478-89534500 AGGGCCTTATGTCTGATTTGAGG + Intergenic
1057863253 9:98658823-98658845 AGGGTCTTCTGGGTGAGTTGGGG - Intronic
1059946975 9:119419059-119419081 AGGGCCTGCTGGGTGGTATGAGG + Intergenic
1203698238 Un_GL000214v1:115972-115994 TGGGCCTTCTGTCTGTCTTGGGG - Intergenic
1203551007 Un_KI270743v1:165208-165230 TGGGCCTTCTGTCTGTCTTGGGG + Intergenic
1186121865 X:6371922-6371944 AGTGCTTTCTGATTGTTTTATGG + Intergenic
1186362438 X:8856563-8856585 GGGGCCTTCAGTTTGTTCTGTGG + Intergenic
1187440023 X:19309970-19309992 TTGGCCTTCTTGTTGTTTTTGGG - Intergenic
1187618329 X:21022235-21022257 ATTGTTTTCTGGTTGTTTTGTGG - Intergenic
1191250529 X:58258040-58258062 GGGGCCTTCTTGCTGCTTTGGGG - Intergenic
1191251941 X:58263982-58264004 AGGGCATTCTTGGTGCTTTGGGG - Intergenic
1191251999 X:58264198-58264220 GGGGCCTTCTTGCTGCTTTGTGG - Intergenic
1191252762 X:58267277-58267299 AGGGACTTCTTGCTGCTTTGGGG + Intergenic
1191253248 X:58269182-58269204 AGGGACTTCTTGATGCTTTGGGG + Intergenic
1191255116 X:58276348-58276370 GGGGACTTCTTGTTGCTTTGGGG + Intergenic
1194166038 X:90517988-90518010 TGGTTCTTCTGGGTGTTTTGTGG - Intergenic
1194563474 X:95451416-95451438 TGGGTATTCTGGTTCTTTTGGGG + Intergenic
1195016085 X:100782374-100782396 AGGGTCTTCCGGGTCTTTTGTGG + Intergenic
1195848915 X:109261942-109261964 TTGGTTTTCTGGTTGTTTTGTGG + Intergenic
1195968518 X:110450678-110450700 AAGGCCATCTGCTTGTTTTGGGG - Exonic
1196564795 X:117192223-117192245 TGTGTTTTCTGGTTGTTTTGTGG - Intergenic
1198090358 X:133322752-133322774 GAGGCCATTTGGTTGTTTTGAGG - Intronic
1200124343 X:153806212-153806234 AGAGCCTTCAGCTTGCTTTGGGG - Intronic
1200512307 Y:4095756-4095778 TGGTTCTTCTGGGTGTTTTGTGG - Intergenic
1200911289 Y:8533612-8533634 ATGGCCTTCTCTTTGTGTTGGGG + Intergenic
1201152527 Y:11101894-11101916 TGGGCCTTCTGCCTGCTTTGGGG + Intergenic
1201764442 Y:17565124-17565146 TGGGCCTTCTGGCCGCTTTGGGG + Intergenic
1201764498 Y:17565339-17565361 GGGGCCTTCTTGTCGCTTTGGGG + Intergenic
1201837055 Y:18340651-18340673 GGGGCCTTCTTGTCGCTTTGGGG - Intergenic
1201837111 Y:18340866-18340888 TGGGCCTTCTGGCCGCTTTGGGG - Intergenic