ID: 904893942

View in Genome Browser
Species Human (GRCh38)
Location 1:33800139-33800161
Sequence CATTGTAAACTGAGGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904893942_904893949 16 Left 904893942 1:33800139-33800161 CCACCCAGCCTCAGTTTACAATG 0: 1
1: 1
2: 1
3: 20
4: 235
Right 904893949 1:33800178-33800200 TATTAGCTCCATGAAAGGAAGGG 0: 1
1: 0
2: 3
3: 49
4: 360
904893942_904893947 11 Left 904893942 1:33800139-33800161 CCACCCAGCCTCAGTTTACAATG 0: 1
1: 1
2: 1
3: 20
4: 235
Right 904893947 1:33800173-33800195 GTAACTATTAGCTCCATGAAAGG 0: 1
1: 0
2: 1
3: 17
4: 109
904893942_904893948 15 Left 904893942 1:33800139-33800161 CCACCCAGCCTCAGTTTACAATG 0: 1
1: 1
2: 1
3: 20
4: 235
Right 904893948 1:33800177-33800199 CTATTAGCTCCATGAAAGGAAGG 0: 1
1: 1
2: 9
3: 45
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904893942 Original CRISPR CATTGTAAACTGAGGCTGGG TGG (reversed) Intronic
901424823 1:9175461-9175483 CATAGGAAACTGAGGCTTAGAGG - Intergenic
903918601 1:26783102-26783124 AAATGTAAACTGAGGGTGGTGGG + Intergenic
904893942 1:33800139-33800161 CATTGTAAACTGAGGCTGGGTGG - Intronic
905011924 1:34753423-34753445 CATTGTAAACAGAAGCTTGCAGG + Intronic
905294061 1:36942934-36942956 CCTTGTAATCTGAAGGTGGGGGG - Intronic
906005042 1:42461843-42461865 CATTGTCAAAGGAGCCTGGGTGG - Intronic
906338795 1:44959432-44959454 CTTAGGAGACTGAGGCTGGGAGG + Intronic
906851133 1:49251379-49251401 CATTGCAAATGGAGGCTTGGTGG + Intronic
906934015 1:50195919-50195941 GAATGGAAACTGAGGCTCGGGGG - Intronic
907972188 1:59393859-59393881 CATTGTGTCCTGAGCCTGGGAGG - Intronic
909688879 1:78382690-78382712 TATTCTAGAGTGAGGCTGGGGGG - Intronic
913978233 1:143482863-143482885 CACTGAAAGCTGAGGCTGAGAGG + Intergenic
914072639 1:144308492-144308514 CACTGAAAGCTGAGGCTGAGAGG + Intergenic
914106515 1:144657864-144657886 CACTGAAAGCTGAGGCTGAGAGG - Intergenic
914765831 1:150636918-150636940 CATTGTTTACTGAGACGGGGAGG + Intergenic
915514818 1:156406567-156406589 CATTCTCAACTGAGGAAGGGTGG - Intronic
916064191 1:161122942-161122964 CATTGCAAAGTGAGGCTGAATGG - Intronic
916934211 1:169611006-169611028 CCTTATAAACTGAGGGTGTGAGG + Intronic
918134898 1:181663037-181663059 AATTGTAAAATGAGATTGGGGGG - Intronic
919426545 1:197439452-197439474 ATGTGTAAACTGAGGCTGAGAGG + Intronic
920755270 1:208724477-208724499 GATTGGAAACTGAGGCTTAGAGG - Intergenic
922536621 1:226385832-226385854 CATTGTAAACCAAGGGTGGGTGG - Intronic
923070382 1:230558838-230558860 CATTGTAGACTGAAGGAGGGTGG - Intergenic
924784508 1:247183102-247183124 ACTTGTGAAATGAGGCTGGGTGG - Intergenic
1062961984 10:1579071-1579093 CAGGGTAAACTGAGGCAGTGTGG - Intronic
1065628610 10:27655188-27655210 CATTGGAGGCTGAGGGTGGGAGG + Intergenic
1066706622 10:38186737-38186759 CATTGTAAGATGAGGCTGGCTGG - Intergenic
1066982675 10:42433265-42433287 CATTGTAAGATGAGGCTGGCTGG + Intergenic
1069477141 10:68744795-68744817 CATTTTAAAATGAGTCTAGGAGG + Intronic
1070395990 10:76011652-76011674 CAATGAAGACTGAGGCTCGGAGG - Intronic
1072067282 10:91883495-91883517 CATGGGAAACTGAGGCTCAGAGG - Intergenic
1072182047 10:92993774-92993796 CCTTTTAAACTGAGGGTTGGTGG + Intronic
1072618551 10:97065308-97065330 CAGAGTAAACTGAAGCTGTGAGG + Intronic
1073804058 10:107076818-107076840 CATTGTAAAATGTGGCTTCGGGG - Intronic
1074965035 10:118483479-118483501 CATTGTACACTGAGGTTTGGTGG + Intergenic
1075170962 10:120113988-120114010 AAGTGTAATGTGAGGCTGGGAGG - Intergenic
1075554992 10:123424137-123424159 GATGGTTACCTGAGGCTGGGGGG + Intergenic
1075784782 10:125041729-125041751 CATTATAATCTGAGGCAAGGGGG + Intronic
1076322631 10:129594796-129594818 CCTTGTCAACTGAGGATGGAGGG - Intronic
1076660681 10:132054215-132054237 CTGTGTAAACTGTGGCTCGGAGG + Intergenic
1077883233 11:6367311-6367333 CATTGGGAACAGAGACTGGGGGG - Intergenic
1079032910 11:16998930-16998952 GATTGTATGGTGAGGCTGGGAGG - Intronic
1081063102 11:38504343-38504365 GATTGTTAACTGGGGCCGGGAGG - Intergenic
1081486392 11:43533219-43533241 AATTGTAACATGAGGCTGGTAGG - Intergenic
1081538816 11:44015293-44015315 GATGGGAAACTGAGGCTGGGAGG + Intergenic
1083332862 11:61907088-61907110 CTTTGTAAAGTGGGGCTGGGAGG + Intronic
1083564832 11:63705082-63705104 TAAAGTAAAATGAGGCTGGGTGG + Intronic
1084174926 11:67418122-67418144 ACTTGGAAACTGAGGCTTGGAGG + Intronic
1085794285 11:79523215-79523237 TATTGGAAAATAAGGCTGGGGGG + Intergenic
1086952567 11:92905847-92905869 CCTAGTAGCCTGAGGCTGGGGGG + Intergenic
1087120230 11:94566852-94566874 CCTTGTAAACTGAGGACAGGTGG + Intronic
1089083785 11:115799714-115799736 CAATGTAAAATGAGGCTGGAGGG + Intergenic
1090353699 11:126124656-126124678 CAGTGCAAACTGAGCCTGGGTGG + Intergenic
1090483205 11:127086242-127086264 CATAGCAAACTGGGGGTGGGAGG + Intergenic
1091002696 11:131923846-131923868 CATTTGAAACTGGGGATGGGAGG - Intronic
1091104089 11:132902204-132902226 CATTGCAAACTGAGGCTGAATGG + Intronic
1092297352 12:7210918-7210940 GCTTGTGAAATGAGGCTGGGTGG + Intronic
1094528519 12:31250131-31250153 TATTGCAAACTGAGGCATGGTGG + Intergenic
1094532351 12:31288571-31288593 CATTGACATCTGAGGTTGGGGGG - Intronic
1101852748 12:108417352-108417374 CAGGATAAATTGAGGCTGGGAGG - Intergenic
1103561136 12:121793767-121793789 GAAAGGAAACTGAGGCTGGGAGG - Exonic
1107686878 13:42909753-42909775 CATGGTTACCAGAGGCTGGGGGG + Intronic
1108716960 13:53090350-53090372 CATTGTAGATGGAGGCTGGGGGG + Intergenic
1109119225 13:58433048-58433070 CCTTTTAAATTGAGGCAGGGTGG - Intergenic
1109744179 13:66599634-66599656 CAATTTAACCTGAGCCTGGGAGG - Intronic
1113239113 13:108316487-108316509 CATTGTAAAGGGAGGCTGTGGGG - Intergenic
1115000192 14:28412572-28412594 CAATGTTAACTGAAGCTGTGGGG + Intergenic
1115890509 14:38022513-38022535 CATACCAAACTCAGGCTGGGAGG + Intronic
1117567433 14:57009299-57009321 CATTTTAAACTGAGACTTGTTGG - Intergenic
1118142070 14:63094950-63094972 CATTGTGAACTGTGCCTGCGAGG - Intronic
1119249455 14:73138981-73139003 AAATGTAAAAAGAGGCTGGGTGG + Intronic
1120950980 14:90041659-90041681 CATTGTAAACTGCTTCTTGGCGG - Intronic
1121630768 14:95420357-95420379 CAGTGGAAACCCAGGCTGGGTGG - Intronic
1122707236 14:103629093-103629115 CTGGGGAAACTGAGGCTGGGTGG - Intronic
1123660329 15:22559101-22559123 CAATGGAAGCTGAGGCTTGGAGG - Intergenic
1125717752 15:41828758-41828780 GAATGCAAACTGGGGCTGGGAGG - Intronic
1127549769 15:60025408-60025430 CGTTGTAAATTGATGCTGGATGG - Intronic
1129178885 15:73859219-73859241 GATGGGAAACTGAGGCTCGGAGG - Intergenic
1131447623 15:92513034-92513056 CATTGGGAACAGAGACTGGGGGG - Intergenic
1131652952 15:94422035-94422057 CATTTTAAACTGAGAGTGGCTGG + Intronic
1133896008 16:9929608-9929630 GAGTGTATACTGGGGCTGGGAGG - Intronic
1134488338 16:14676959-14676981 CATTGGAGACTGAGGTGGGGAGG + Intronic
1134910665 16:18023389-18023411 CATGACCAACTGAGGCTGGGCGG - Intergenic
1135509609 16:23070884-23070906 CATTGTATAATGGTGCTGGGTGG - Intronic
1136139567 16:28279868-28279890 CTTTGTAAACTGAAGCACGGGGG + Intergenic
1137647754 16:50090842-50090864 TATTGAAAATTCAGGCTGGGTGG + Intronic
1137988071 16:53127470-53127492 AATTGGAAACTCAGGCTGAGGGG + Intronic
1138308020 16:55996080-55996102 CATTGTGAAATGAGGATGTGAGG - Intergenic
1138757036 16:59500278-59500300 CATTTTAAACAGAGGCTGTCAGG - Intergenic
1139754837 16:69133850-69133872 CATTGGAAACTGAGGTTTGCTGG + Intronic
1141600839 16:85125317-85125339 CATGGTTGCCTGAGGCTGGGGGG + Intergenic
1141616138 16:85210682-85210704 CTGTGTAAGTTGAGGCTGGGAGG + Intergenic
1141631144 16:85288747-85288769 CATTGGAATCTGGGGGTGGGGGG + Intergenic
1143732600 17:8889467-8889489 CATTGTAAAATGAGGCTCAGAGG - Intronic
1143813480 17:9491502-9491524 CTTTGTACACTGAGGCTGTGTGG - Intronic
1144430292 17:15185132-15185154 CAGTGGAAACTTAGGCTGTGAGG - Intergenic
1146647459 17:34584663-34584685 CCTTTTCAACTGATGCTGGGAGG - Intronic
1146928614 17:36762224-36762246 CCCTCTAAATTGAGGCTGGGAGG - Intergenic
1147385134 17:40076723-40076745 CATTGTCAGCTGACCCTGGGGGG + Intronic
1147721587 17:42543025-42543047 CAGTGGATACTGAGGCTGTGTGG + Exonic
1147728130 17:42579549-42579571 CACTGTGAACTGAGGAGGGGAGG - Exonic
1149582342 17:57759574-57759596 TATAGGAAACTGAGTCTGGGAGG + Intergenic
1152134186 17:78494382-78494404 CTCTCTCAACTGAGGCTGGGGGG - Intronic
1152160283 17:78664519-78664541 CATCCTAAGCTGGGGCTGGGTGG - Intergenic
1152342733 17:79734146-79734168 CATTGCAAACTGGGGGTGGGTGG - Intronic
1155298791 18:24409807-24409829 CATGGGAAGCTGAGGCTGGAGGG + Intergenic
1156834584 18:41537364-41537386 CATAGAACACTGGGGCTGGGGGG - Intergenic
1157158036 18:45286920-45286942 GATTTTACACTGGGGCTGGGTGG - Intronic
1157402398 18:47399546-47399568 CATTCTAACCTGAGACTTGGTGG + Intergenic
1159893968 18:73979217-73979239 ATATGAAAACTGAGGCTGGGAGG - Intergenic
1160429513 18:78801768-78801790 CATTGCCAAGGGAGGCTGGGAGG + Intergenic
1160606814 18:80057833-80057855 TATTGTAAACTGTGCGTGGGAGG + Intronic
1160813787 19:1026371-1026393 CACGGGAAACTGAGGCAGGGAGG - Intergenic
1160904770 19:1446907-1446929 GAGGGGAAACTGAGGCTGGGGGG + Intronic
1161329887 19:3681674-3681696 CTATGTAAACTGAGGCTCAGAGG + Intronic
1161790498 19:6356788-6356810 CTTGGTAGACTGAGGTTGGGAGG + Intergenic
1162021029 19:7868742-7868764 TATTGCAAACTCAGGCTGTGCGG + Exonic
1162857719 19:13481887-13481909 CACCTTAACCTGAGGCTGGGTGG - Intronic
1162883066 19:13674678-13674700 TAATGAAAATTGAGGCTGGGCGG - Intergenic
1164407379 19:27963333-27963355 GATTGTAAGATGAGGCTGGCTGG - Intergenic
1164477193 19:28584952-28584974 CATTGGGACCTGAGGCTGGGGGG + Intergenic
1164789066 19:30960592-30960614 ATTAGAAAACTGAGGCTGGGGGG + Intergenic
1166855485 19:45780944-45780966 CAGGGTAAACTGAGACCGGGTGG - Intronic
1167285842 19:48598596-48598618 AATGGAAAACTGAGGCTTGGAGG + Intronic
1168108424 19:54178732-54178754 CAGTGTCACCTGAGACTGGGCGG + Intronic
926159497 2:10477653-10477675 CGTTGAAAACTGAGTGTGGGAGG - Intergenic
926322943 2:11761540-11761562 AATTGTAAAATGAACCTGGGAGG + Intronic
927884812 2:26711888-26711910 CACTGTAAGCTGCAGCTGGGGGG + Intronic
930169075 2:48232554-48232576 CATTGCAAACTGAGGCCCGCAGG + Intergenic
931855900 2:66301625-66301647 AAATGCAAGCTGAGGCTGGGTGG + Intergenic
932546446 2:72715738-72715760 CATTGTATATTGGGGGTGGGAGG + Intronic
933375075 2:81468544-81468566 GATTGTAAATTGAGGATGGGTGG - Intergenic
934293230 2:91718060-91718082 CACTGAAAGCTGAGGCTGAGAGG + Intergenic
936079666 2:109423686-109423708 CACTGTCAAAGGAGGCTGGGCGG - Intronic
940051442 2:149469339-149469361 CAGTGTAAAATGAGCTTGGGAGG + Intronic
940247661 2:151636968-151636990 CATGGTAAAATGTGGGTGGGAGG + Intronic
943725613 2:191248269-191248291 CAGTGGAAACTGAGGCCTGGAGG + Intronic
945028040 2:205637944-205637966 CATTGTGGAGAGAGGCTGGGAGG - Intergenic
946180320 2:217945199-217945221 CAGAGGAAACTGAGGCTCGGAGG - Intronic
946655862 2:221946424-221946446 TATTGTAAACTGTGCCTGCGAGG - Intergenic
946806409 2:223475151-223475173 TATTGCAAACTGAGGGTGTGAGG + Intergenic
947753502 2:232544899-232544921 CAATGTAAGCTGAGTCAGGGTGG + Exonic
948441563 2:237994047-237994069 TATGGTAAACTCTGGCTGGGTGG + Intronic
948507986 2:238443785-238443807 CATTGTAAAATGAGGCTGAGGGG - Intronic
1169004685 20:2196794-2196816 CATTGGAAACTGAGGATCAGAGG + Intergenic
1170579627 20:17687943-17687965 CATGGGAAGCTGAGGTTGGGTGG + Intergenic
1172127436 20:32633246-32633268 AAAGGTAAACTGAGGCTTGGAGG + Intergenic
1172567381 20:35941119-35941141 CCCTGTAAACTCAGACTGGGGGG - Intronic
1172915017 20:38436903-38436925 AACTGGAAACTGAGGCGGGGCGG - Intergenic
1175165575 20:57041590-57041612 AATGGGAAACTGAGGCTTGGAGG - Intergenic
1176116530 20:63434062-63434084 GAGGGTAAACTGAGGCTGTGGGG - Intronic
1176259106 20:64169864-64169886 TACTGGACACTGAGGCTGGGAGG + Intronic
1177474303 21:21598657-21598679 CTTTGTAGACTGAATCTGGGAGG - Intergenic
1177600065 21:23299268-23299290 CATTGTGAACTGAGCATGCGAGG + Intergenic
1178144490 21:29722630-29722652 CATTGTAAACTAAGATTAGGTGG + Intronic
1179919345 21:44499188-44499210 ACGGGTAAACTGAGGCTGGGAGG + Exonic
1181645851 22:24231562-24231584 GATGGGAAACTGAGGCGGGGAGG + Intronic
1183572877 22:38667414-38667436 CTTGGGAAGCTGAGGCTGGGGGG - Intronic
1183622389 22:38982106-38982128 CATTGCAGCCTGAGCCTGGGAGG - Intronic
1183741495 22:39670970-39670992 CCTTGTAACCTTGGGCTGGGAGG - Intronic
1184403735 22:44288179-44288201 GATGGAAAACTGAGGCTCGGTGG + Intronic
1184660109 22:45961718-45961740 GATGGGAAACTGAGGCAGGGAGG - Intronic
1184839664 22:47045200-47045222 GATTGTGAACTGTGGCTGCGTGG + Intronic
950252614 3:11479559-11479581 ACTTGAAATCTGAGGCTGGGAGG - Intronic
950568957 3:13788200-13788222 AATTGGAAACTGAGGCCTGGAGG + Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
950923074 3:16715193-16715215 CATTGTAGACAGAGCCTTGGTGG - Intergenic
954223932 3:49171079-49171101 CAGTGTACACTGAGGCTAGCGGG - Intergenic
955871031 3:63438469-63438491 AATTCTAAACTGAAGCTGAGAGG - Intronic
962876018 3:139536618-139536640 CATTGTAAAATAAAGCAGGGAGG - Intronic
964732304 3:159880278-159880300 CTTGGTGAACTGAGGTTGGGCGG - Intronic
965160730 3:165129749-165129771 CTTTGTAACCTGGGGTTGGGAGG + Intergenic
966061356 3:175760352-175760374 CCTTGAAAACAGAGGCTGTGAGG - Intronic
966818033 3:183905221-183905243 CATTGTACACTGGGTCTGAGAGG + Intergenic
967115557 3:186334346-186334368 GATTGTAAACTGATGGAGGGTGG + Intronic
969521713 4:7681852-7681874 CATGGGAAACTGAGGCTCAGAGG - Intronic
969868975 4:10093211-10093233 CAGGGTCAGCTGAGGCTGGGGGG - Intronic
971300084 4:25434692-25434714 CTGAGTAAACTGAGGCTGAGTGG + Intergenic
975407949 4:74013591-74013613 CATTGTAAGCTGACACTGGAAGG - Intergenic
977073138 4:92418316-92418338 CACTGCAAAATGAGGCTGAGTGG + Intronic
977780119 4:100971025-100971047 TAATGTCAACTGATGCTGGGTGG - Intergenic
981012121 4:139936044-139936066 GATGGTTATCTGAGGCTGGGAGG - Intronic
983653155 4:170053485-170053507 CTTTGCAAACTGAGGCTGGCAGG + Intergenic
985800636 5:2003538-2003560 CAGTGTAGGGTGAGGCTGGGAGG + Intergenic
985878333 5:2618047-2618069 TATTTAAAACTAAGGCTGGGAGG - Intergenic
990868785 5:60408428-60408450 CATTGCCAACTGAGGCTCTGAGG + Intronic
991718553 5:69474650-69474672 CATGGAAGACTGTGGCTGGGTGG + Intergenic
991991311 5:72342564-72342586 CATTGGAAATGGAGGCTGGCAGG - Intronic
992147035 5:73860853-73860875 GACTGTAAACTGAGGCTGAAGGG - Intronic
992497513 5:77308379-77308401 CACAGTGAAGTGAGGCTGGGAGG + Intronic
993709037 5:91204865-91204887 CATTGTGAAGTAAGGCTGTGTGG - Intergenic
994820525 5:104645082-104645104 CATAGGAATCTGAGGGTGGGAGG - Intergenic
995097764 5:108259544-108259566 CATTTCTAACTGAGGCTGTGTGG - Intronic
1000137599 5:158367868-158367890 TATTGTCCTCTGAGGCTGGGTGG + Intergenic
1001654147 5:173336518-173336540 CAGAGTTAACTGAGGCTTGGAGG - Intergenic
1003772020 6:9316220-9316242 CTTTGAAAACTGTGGGTGGGCGG + Intergenic
1005281836 6:24282757-24282779 CATTATAAGCTGGGGGTGGGGGG + Intronic
1006749124 6:36365598-36365620 CACTGAAAACTGAGGATGAGGGG + Intronic
1007772569 6:44203004-44203026 CTATGGAAACTGAGGCTGGGAGG + Intergenic
1008430305 6:51408946-51408968 CATTTTAATTTGGGGCTGGGAGG - Intergenic
1011880476 6:92017613-92017635 AATTTTAAACTGAGGCTTGAAGG - Intergenic
1013439430 6:110147853-110147875 CTTGGGAAACTGAGGGTGGGAGG - Intronic
1013771171 6:113629760-113629782 CATGGTAAACTGTGGCCTGGTGG - Intergenic
1013992085 6:116265390-116265412 CATTGTAGACAGAGCCTTGGTGG - Intronic
1014104021 6:117542892-117542914 CATTGGAAACTGTCTCTGGGGGG + Intronic
1019070177 6:169339058-169339080 CCTTGTAAACTGAGAAAGGGGGG + Intergenic
1021957886 7:25844498-25844520 AATTATAAACTGAGACTGAGTGG + Intergenic
1022505317 7:30905902-30905924 CATGGGAAACTGAGGCTCAGAGG - Intergenic
1024829382 7:53431104-53431126 CATTGGAGACTCAGACTGGGGGG + Intergenic
1026376645 7:69758192-69758214 CATTGCAAACACAGCCTGGGTGG + Intronic
1027160602 7:75799628-75799650 CATTGTAACCCGAGGCTAGGAGG - Intergenic
1028976131 7:96916394-96916416 CCTTGTAGACTCAAGCTGGGTGG - Intergenic
1032199565 7:129809844-129809866 CATTGTAGAATGGGGGTGGGAGG + Intergenic
1032203414 7:129840292-129840314 CTTGGAAGACTGAGGCTGGGAGG - Intronic
1032586637 7:133152945-133152967 GAGTGGAAACTGAGGCTTGGGGG + Intergenic
1034467585 7:151238937-151238959 CATTGGAAACTGGGGAGGGGAGG - Intronic
1038154829 8:24979490-24979512 TGGTGTGAACTGAGGCTGGGGGG - Intergenic
1039842453 8:41303780-41303802 CAGCATAACCTGAGGCTGGGTGG + Intronic
1041394914 8:57380370-57380392 CTTTGTCCACTGAGGCTGAGAGG - Intergenic
1041765139 8:61411407-61411429 CAGTGGAGACAGAGGCTGGGTGG + Intronic
1042595174 8:70439708-70439730 GATTGTAAACTGAGCCAGGTGGG - Intergenic
1044675891 8:94728268-94728290 CAGTGTATACTGAGAGTGGGGGG - Intronic
1044992023 8:97804530-97804552 CATAGCAAACTGAGGCTCAGAGG - Intronic
1046920385 8:119721631-119721653 CATTGTGAATTGATCCTGGGGGG + Intergenic
1047039518 8:120977342-120977364 CTTTCCTAACTGAGGCTGGGAGG - Intergenic
1047888319 8:129278008-129278030 TATTGAAAACTGAGGCTTAGTGG - Intergenic
1048209157 8:132440574-132440596 CGTGGGAAACTGAGGCTTGGAGG + Intronic
1048463509 8:134642344-134642366 CATTGGAAACGGAGGCTCAGGGG - Intronic
1049038830 8:140097517-140097539 CCTTGTAGACTGTGGCAGGGCGG - Intronic
1049688191 8:143947459-143947481 CAATGTAAATTAGGGCTGGGCGG + Intronic
1050627862 9:7524750-7524772 CAGTGTAAGCTAAGGCCGGGAGG - Intergenic
1051810877 9:21048348-21048370 AATTGTACACACAGGCTGGGAGG + Intergenic
1053300643 9:36946873-36946895 CATTTTACACTGTGGCTTGGGGG - Intronic
1057986127 9:99715778-99715800 AATTGTAACATGAGTCTGGGAGG - Intergenic
1059422389 9:114200295-114200317 CATTGTAAACTGAGGCTTGGGGG - Intronic
1059936668 9:119318711-119318733 TATTGTAAACTGGTGCAGGGTGG + Intronic
1060714281 9:125908178-125908200 TATTGTGAACTGGGTCTGGGAGG + Intronic
1061415633 9:130445495-130445517 CAGGGTAAACTGAGGCTGCGGGG - Intronic
1062005858 9:134238099-134238121 AAAGGGAAACTGAGGCTGGGAGG - Intergenic
1185531096 X:819817-819839 CCTTGTAAACGGAGACAGGGGGG + Intergenic
1187845407 X:23531405-23531427 GATGGTTAACAGAGGCTGGGAGG + Intergenic
1187983095 X:24780201-24780223 CCTTGTAAAATGAGGTTGGAAGG + Intronic
1189416451 X:40818498-40818520 CATTGTAACCTGAGGCTTCTAGG - Intergenic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1190829329 X:54045991-54046013 CTCTGTCAACTCAGGCTGGGCGG + Intronic
1194226688 X:91269104-91269126 CATTGTTGCCAGAGGCTGGGAGG - Intergenic
1196352672 X:114750721-114750743 AATTTTAAACTGAGGCTCTGTGG + Intronic
1197198775 X:123731294-123731316 CATTCTAAGCATAGGCTGGGGGG + Intronic
1197297109 X:124732509-124732531 CATAGTCAACTGAGGCTACGGGG - Intronic
1197458572 X:126709345-126709367 TATTGTGAACTGAGCATGGGAGG - Intergenic
1200695412 Y:6354333-6354355 CATTTCAACCTGAGGCTTGGAGG - Intergenic
1200908202 Y:8507454-8507476 CATTTCAACCTGAGGCTTGGTGG - Intergenic
1201039865 Y:9820377-9820399 CATTTCAACCTGAGGCTTGGAGG + Intergenic
1201935948 Y:19411238-19411260 CATTGTTGACTGTGGCTGGCTGG - Intergenic
1202198735 Y:22325135-22325157 CATTTCAACCTGAGGCTTGGAGG - Intronic
1202231381 Y:22662703-22662725 CATTTCAACCTGAGGCTTGGAGG - Intergenic
1202311777 Y:23533462-23533484 CATTTCAACCTGAGGCTTGGAGG + Intergenic
1202559025 Y:26137132-26137154 CATTTCAACCTGAGGCTTGGAGG - Intergenic