ID: 904897912

View in Genome Browser
Species Human (GRCh38)
Location 1:33831084-33831106
Sequence TCTCCTGGATAGTATCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 38, 2: 52, 3: 34, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904897912_904897915 1 Left 904897912 1:33831084-33831106 CCTGCAGGATACTATCCAGGAGA 0: 1
1: 38
2: 52
3: 34
4: 134
Right 904897915 1:33831108-33831130 CTTCTCCAATCTAGCAAGGCAGG 0: 41
1: 3848
2: 2692
3: 2296
4: 1552
904897912_904897917 19 Left 904897912 1:33831084-33831106 CCTGCAGGATACTATCCAGGAGA 0: 1
1: 38
2: 52
3: 34
4: 134
Right 904897917 1:33831126-33831148 GCAGGCCAACGTTCAGATTCAGG 0: 1438
1: 1904
2: 3236
3: 2654
4: 1725
904897912_904897914 -3 Left 904897912 1:33831084-33831106 CCTGCAGGATACTATCCAGGAGA 0: 1
1: 38
2: 52
3: 34
4: 134
Right 904897914 1:33831104-33831126 AGAACTTCTCCAATCTAGCAAGG 0: 43
1: 3989
2: 2590
3: 1196
4: 579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904897912 Original CRISPR TCTCCTGGATAGTATCCTGC AGG (reversed) Intronic
904897912 1:33831084-33831106 TCTCCTGGATAGTATCCTGCAGG - Intronic
909176589 1:72369620-72369642 TATCTTGTATAGTATCTTGCAGG + Intergenic
909349183 1:74629606-74629628 TCTCCTGGTCATTTTCCTGCTGG + Intronic
911342221 1:96652844-96652866 TCTCCTGGATAATATCCTGAAGG - Intergenic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
917572777 1:176286740-176286762 TGTCTTGTATAGTATCTTGCAGG + Intergenic
918802093 1:188985539-188985561 TCTCCTGGATAATATCCTGAAGG + Intergenic
918955392 1:191200286-191200308 TCCCCTGCATAATATCCTGAAGG - Intergenic
921626354 1:217381220-217381242 TCTGCTGGATAATATCCCGAAGG - Intergenic
921842279 1:219840896-219840918 TCTCCTGGATAATATCCTGAAGG - Intronic
921846465 1:219888266-219888288 TCTCCTGGATAATATCCTGAAGG - Intronic
1063338151 10:5236343-5236365 TCTTCTGGATAATATCCTGAAGG - Intergenic
1064150264 10:12857201-12857223 TTTCCTGGATAATATCCTGAAGG - Intergenic
1065174191 10:23061151-23061173 TCTCATGGCTAAGATCCTGCAGG - Intergenic
1066699038 10:38106928-38106950 TCTCCTGGATAATATCCTGAAGG - Intronic
1066993326 10:42538276-42538298 TCTCCTGGATAATATCCTGAAGG + Intergenic
1069093319 10:64228553-64228575 TCTTCTGGATAATATCCTGAAGG + Intergenic
1070455460 10:76610070-76610092 TCTCCTGGATAATATCCTGAAGG - Intergenic
1071323613 10:84490308-84490330 TCTCCTGGATAATATCTTGCAGG + Intronic
1071459462 10:85878193-85878215 TCTCCTGGATAATACCCTGCAGG - Intronic
1072024622 10:91442651-91442673 TCTCCTGGATAATATCCTGAAGG + Intronic
1072025075 10:91446944-91446966 TCTCCTGGATAATATCCTGAAGG - Intronic
1073920852 10:108457045-108457067 TCTCATGGAAAGTATTCTTCTGG + Intergenic
1077888835 11:6404757-6404779 TTTCCTGGCCATTATCCTGCAGG - Intronic
1077907238 11:6544131-6544153 TTTCCTGGATGGAATCCTGCAGG - Exonic
1078834663 11:15015769-15015791 TCTCCTGGATGATATCCTGCTGG - Intronic
1082596303 11:55085942-55085964 TCTCTGGGATAATATCGTGCAGG - Intergenic
1082681086 11:56171418-56171440 TTTCCTGGATATTGTCCTACTGG + Intergenic
1082876957 11:57998729-57998751 TCTCCTGGATAATATCCTGCCGG + Intergenic
1086129369 11:83384544-83384566 TCTCCTGGATAATATCCTGAAGG - Intergenic
1087561354 11:99794910-99794932 TGTCCTGTATAATATCTTGCAGG + Intronic
1090574318 11:128084854-128084876 TGTCCTGTATAGTATCTTGCAGG + Intergenic
1092441271 12:8507163-8507185 TGTCTTGTATAGTATCTTGCAGG + Intergenic
1093318678 12:17684593-17684615 TATCCTGGATAATATTCTGGAGG - Intergenic
1094758020 12:33494146-33494168 TCTCCTGGATAATATCCTGAAGG - Intergenic
1095186760 12:39209304-39209326 TCTCCTGGATAATGTCCTGAAGG - Intergenic
1095483272 12:42657935-42657957 TCGCCTGGATAATATCCTGTGGG + Intergenic
1096044753 12:48552767-48552789 TCTCCTGGATAATATCCTGCAGG + Intergenic
1096931216 12:55211991-55212013 CCTCCTGGATAATATCCTGCAGG - Intergenic
1098680707 12:73349921-73349943 TCTCCTGGATAATATCCTGAAGG + Intergenic
1100276242 12:93074359-93074381 TTTCCTGGATATAATTCTGCTGG - Intergenic
1101552739 12:105777503-105777525 TCTCCTGGATAATATCCTGCAGG - Intergenic
1102674034 12:114644272-114644294 TCTCTTGGAATGTATCCTGGGGG + Intergenic
1103008892 12:117442477-117442499 TCCCCTTTATAGCATCCTGCTGG - Intronic
1109034011 13:57231499-57231521 TCTCCTGGATAATATCCTAAAGG - Intergenic
1109188070 13:59293272-59293294 TCTATTGGATAATATCCTGAAGG - Intergenic
1110818678 13:79888627-79888649 TCTCCTGGATAATATCCTGAAGG - Intergenic
1111056199 13:82953807-82953829 TATCCTGGATAATATCCTGAAGG + Intergenic
1111058065 13:82975057-82975079 TCTCGTGGATAGTACATTGCTGG + Intergenic
1111269072 13:85856175-85856197 TCTCCTGGAATATATCCTGAAGG + Intergenic
1113276784 13:108739704-108739726 TCTTCTGGATAATATCCTGCAGG + Intronic
1115847097 14:37550785-37550807 TCTTCTGGAACGTATGCTGCTGG - Exonic
1116984120 14:51202035-51202057 CATCTTGGATAGTATCTTGCAGG + Intergenic
1117668969 14:58086568-58086590 TCTCCTGGATAGTAATGTGGGGG - Intronic
1117859531 14:60075034-60075056 TCTCCTGGATAATATCCTGAAGG - Intergenic
1117900492 14:60527820-60527842 TCTCCTGGATAATATCCTGAAGG + Intergenic
1118104101 14:62638115-62638137 TCTCCTGGATAATATCCTGCAGG - Intergenic
1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG + Intergenic
1120256162 14:82122056-82122078 TCTCCACAATAGTATTCTGCTGG - Intergenic
1120553952 14:85906485-85906507 TCTCCTGGATAATATCCTGAAGG + Intergenic
1124724532 15:32144483-32144505 TCTCCTGGATAATATCCTGAAGG + Intronic
1126168730 15:45676181-45676203 GCTCCTGGATGATCTCCTGCAGG - Exonic
1126264901 15:46742588-46742610 TCTCCTGGATAATATCCCGAAGG - Intergenic
1126554247 15:49967697-49967719 TCTCCTGGATAATATCCTGAAGG - Intronic
1127049449 15:55065428-55065450 TCTCCTGGATAATATCCTGCAGG - Intergenic
1131652352 15:94414597-94414619 TGTCCTGCAGAGTAACCTGCAGG + Intronic
1131821205 15:96275786-96275808 GCTCATGGATATTATCCTGAAGG - Intergenic
1131950027 15:97672213-97672235 TCTCCAGGATTGGTTCCTGCTGG + Intergenic
1132716089 16:1290459-1290481 TCGCCAGGGTAGTATCCTCCAGG + Intergenic
1134213582 16:12298343-12298365 TCCCCTGGATGGTTTTCTGCAGG + Intronic
1134693902 16:16208904-16208926 TCGCCTGGCCAGGATCCTGCAGG - Intronic
1136288125 16:29255932-29255954 TCTTCTGGAGAGTTTCCTTCCGG + Intergenic
1137326166 16:47439258-47439280 TCTCCTGGATAATATCCTGCAGG - Intronic
1138743459 16:59336508-59336530 TGGCATGGATAGGATCCTGCTGG - Intergenic
1139441753 16:66971500-66971522 TCCTCTGCATAGTTTCCTGCTGG - Intronic
1139490714 16:67284607-67284629 TGTCCTGGACAGCATCCTGTGGG + Intronic
1142093797 16:88228699-88228721 TCTTCTGGAGAGTTTCCTTCCGG + Intergenic
1144672303 17:17139729-17139751 TATCCTGGAGACTAACCTGCAGG - Intronic
1145861367 17:28213149-28213171 TCTCCTGGATAATATCCTCAAGG - Intergenic
1146743965 17:35312070-35312092 TGTCTTGTATAGTATCTTGCAGG + Intergenic
1154320527 18:13347640-13347662 TCTTCTGGATAATATCCTGCAGG + Intronic
1156855499 18:41776452-41776474 TCTCCTGGATAATATCCTGCAGG - Intergenic
1158168882 18:54574067-54574089 TCTCCTGGATAATATCCTGCAGG + Intergenic
1159645634 18:70915334-70915356 TCTCCTGGATAACACCCTGGAGG + Intergenic
1160161155 18:76471911-76471933 TATCCTGGGTAGGACCCTGCAGG - Intronic
1160415570 18:78707506-78707528 ATTCCTGGGTAGTATCCTGCTGG + Intergenic
1160561880 18:79764141-79764163 GCTCCTGGACAGTTCCCTGCAGG + Intergenic
1163995882 19:21046901-21046923 TCTTCTGGATGATATCCTGAAGG + Intronic
1164246480 19:23434700-23434722 TCTCCTGGATAATATCCTGCAGG + Intergenic
1165123593 19:33578994-33579016 TATCCTGGATATTGTCCTGTGGG - Intergenic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925205744 2:2004043-2004065 TTTCCTGCATACTTTCCTGCAGG + Intronic
926943812 2:18166754-18166776 TCTCCTGGATAATATCCTGAAGG + Intronic
927280215 2:21298415-21298437 TTTCCCGGATGGTATCCTGTGGG + Intergenic
929688951 2:44058870-44058892 TCTTCTGGAAAGTTTCCTGGAGG + Intergenic
930290012 2:49481898-49481920 TCTCCTGGATAATATCCTGCAGG - Intergenic
933087827 2:78077849-78077871 ACTGCTGGTTAGTCTCCTGCTGG - Intergenic
938220729 2:129565066-129565088 TGTCCTGGATTGTATCATGGAGG - Intergenic
939072132 2:137556115-137556137 TCTCCTGGATAATATCCTGCAGG - Intronic
939374184 2:141342796-141342818 TCTCCTGGATAATATCCTGAAGG - Intronic
940080436 2:149795178-149795200 TCTCCTGGATAATATCCTGCAGG + Intergenic
940464591 2:154012553-154012575 TGTCTTGCATAGTATCGTGCAGG + Intronic
940600948 2:155859560-155859582 TCTACTGGCTAGAATCTTGCTGG - Intergenic
941239230 2:163016182-163016204 TCTCCTGCATAATATCCTGAAGG + Intergenic
942958573 2:181803115-181803137 TCTCCTGGATAATATCCTGAAGG + Intergenic
943233865 2:185292503-185292525 TCTCCTGGATAATATCCTGAAGG - Intergenic
944048076 2:195437051-195437073 TCTGCTGGAGAGTCTACTGCAGG - Intergenic
946135479 2:217643334-217643356 ACTACTGGATAGTGACCTGCAGG + Intronic
947086200 2:226455502-226455524 TCTCCTGGATAATATCCTGAAGG - Intergenic
947491181 2:230595642-230595664 TGTCTTGTATAGTATCTTGCAGG - Intergenic
1171042567 20:21778982-21779004 TCTCCTGGCCAGTGTCCTGTGGG - Intergenic
1171194157 20:23184456-23184478 TCTCCTGGACAATACCCTGAAGG + Intergenic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1177593170 21:23200538-23200560 TTGGCTGTATAGTATCCTGCGGG - Intergenic
1178898935 21:36583726-36583748 TCCCCTGGATGGGATCCTGTGGG - Intergenic
1179401954 21:41092275-41092297 TCTCTTGGACAGTAGCCTCCTGG - Intergenic
1182392798 22:30013334-30013356 TCTCCTGGATGCTTCCCTGCAGG + Exonic
1185311455 22:50157988-50158010 GCTCCTGGATTGTAGCCTTCTGG + Intronic
949456485 3:4244815-4244837 TCTCCTGGATAATATCCTGAAGG + Intronic
951157658 3:19375174-19375196 TCTCCTGGATAATATCCTGCAGG + Intronic
951311064 3:21126437-21126459 TCTCCTGGATAATATCCTGAAGG - Intergenic
952079994 3:29746523-29746545 TCTGCTGGAGAGTATACTCCTGG + Intronic
952229952 3:31419398-31419420 TCTCCTGGCTAGTTTCCATCTGG + Intergenic
953391682 3:42537427-42537449 TCATCTGGATAGGAGCCTGCTGG + Exonic
953464654 3:43109039-43109061 TCTCCTGGATAGGATCTAACAGG + Intergenic
953669243 3:44948682-44948704 TCTCCTGCTTAGTATCCACCAGG - Intronic
953720706 3:45352397-45352419 TATACTGAATAGCATCCTGCTGG - Intergenic
954986191 3:54795039-54795061 TCTACTTGATATTATCCTACTGG + Intronic
957205987 3:77199102-77199124 TCCACTGAATATTATCCTGCTGG - Intronic
957918990 3:86724037-86724059 TTTCTTGTATAGTATCTTGCTGG + Intergenic
959218400 3:103482742-103482764 TCTCCTGGATAATATCCTGCAGG + Intergenic
959290554 3:104468389-104468411 TCCCCTGGATAATATCCTGAAGG + Intergenic
960512924 3:118571997-118572019 TCTCCTGGCTAGAACTCTGCCGG - Intergenic
963620339 3:147598400-147598422 TCTCCTGGATAGTATTGTGAAGG + Intergenic
965323746 3:167276667-167276689 TCTCCTGGATAATATCCTGCAGG - Intronic
966512534 3:180780220-180780242 CATCCTGGATAGTATCTTGATGG + Intronic
966796314 3:183717224-183717246 TGTCCTGGACTGGATCCTGCGGG - Intronic
966826030 3:183965813-183965835 TCTCCTGGAGAGGATGCTGTAGG + Intronic
967481128 3:189974593-189974615 TCTCCTGGATAACGTCCTGTCGG - Exonic
967638772 3:191836026-191836048 TCTCCTGGATAATATCCTGAAGG - Intergenic
968272174 3:197411481-197411503 TCTCCTGGATAATATCCTGCAGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969909026 4:10426676-10426698 TCTCCTGGATAATATCCTGAAGG + Intergenic
970494462 4:16610788-16610810 TCTCCTGGATAATATTGTGAAGG - Intronic
970864233 4:20740158-20740180 TCTCCTGGATAATATCCTGAAGG - Intronic
971441843 4:26695432-26695454 TCTCCTGGATAATATCCTGCAGG - Intronic
972255718 4:37353411-37353433 TCTCCTGGATAATATCCTAAAGG + Intronic
972332161 4:38074012-38074034 CCTCTTGGATAGTGTGCTGCTGG + Intronic
975154673 4:71058402-71058424 TCTCCTGGATAATATCCTGCAGG + Intergenic
976837396 4:89390767-89390789 TCTCCTGGATAATATCCTGCAGG - Intergenic
977110159 4:92943138-92943160 TCTCCTGGATAATATCCTGCAGG + Intronic
977668884 4:99672382-99672404 TCTCCTGGATGATATACTGACGG - Intergenic
978650619 4:110999854-110999876 TCTTCAGGATAGAATCCTGGAGG + Intergenic
981618262 4:146665048-146665070 TCTCCTGGATAATATCCTGCAGG - Intergenic
982651089 4:158088812-158088834 TCTCCTGGATAATATCCTGCAGG + Intergenic
983173101 4:164558065-164558087 TCTCCTGGATAATATCCTGCAGG + Intergenic
983326724 4:166266961-166266983 TCTCCTGGATAATATCCTGCAGG - Intergenic
983716464 4:170787555-170787577 TCTCCTGGATAATATCCTGCAGG + Intergenic
983744407 4:171178294-171178316 TCTCCTGTAGAGTATCTTGAAGG - Intergenic
983879211 4:172913815-172913837 TCTCCTGAATAATATCCTGAAGG - Intronic
983896065 4:173083393-173083415 TCTCCTGGATAATTTCCTGAAGG + Intergenic
984330294 4:178306757-178306779 TCTCCTGGCAAGTACCCAGCTGG - Intergenic
984786440 4:183571709-183571731 TTTCCTGGAAAGCATGCTGCTGG + Intergenic
988839157 5:35066250-35066272 TCTGCTGAATAGTATCCAGAAGG - Intronic
990369051 5:55098094-55098116 TCTCCTGGATAATATCCTGAAGG - Intergenic
990837970 5:60043369-60043391 TCTACTGGATAATATCCTGAAGG - Intronic
991022057 5:61989671-61989693 TCTCCTGGAAAGTTTCTTCCTGG + Intergenic
991396779 5:66212115-66212137 TATCCTGGATAATATCCCTCAGG - Intergenic
991538959 5:67705232-67705254 TCTCCTGGATTATATCCTGCAGG - Intergenic
991543817 5:67759110-67759132 TCTCCTGGATAATATCCTGCAGG - Intergenic
992284124 5:75215118-75215140 TCTCCCGGATGATTTCCTGCTGG - Intronic
993380692 5:87203760-87203782 TCTCCTGGATAATATCCTGAAGG + Intergenic
994142694 5:96359901-96359923 TCTCCTGGATAATATCCTGAAGG + Intergenic
994721408 5:103384758-103384780 TCTCCTGGATAATGTCCTTAAGG + Intergenic
995475812 5:112547258-112547280 TCTCATGGATACTCTCCTCCTGG - Intergenic
995790485 5:115881767-115881789 CCTCCTGGATAATATCCTGAAGG + Intronic
997915139 5:137917116-137917138 TCTACTTGATGGTGTCCTGCAGG + Intronic
999382039 5:151128100-151128122 TCTCCTGGCTCGCATCCTGATGG - Intronic
999416770 5:151404879-151404901 TGTCTTGTATAGTATCTTGCAGG + Intergenic
1003115680 6:3282414-3282436 TCTCTTGGATCGTATCCTACAGG - Intronic
1005150308 6:22741332-22741354 TCTCCTGGGAAGAATCCGGCAGG + Intergenic
1005208370 6:23431329-23431351 TCTCCTGGAAAATATCCGGAAGG + Intergenic
1008829183 6:55737094-55737116 TCTCCTGGGTAATATCCTGCAGG - Intergenic
1009264272 6:61533361-61533383 TTTCCTGGATAATATCTTGAAGG - Intergenic
1009290259 6:61871431-61871453 TCTCCTGGATAATATCCTGAAGG - Intronic
1009531133 6:64817180-64817202 TCTCCTGGAAAGCATTCTGATGG + Intronic
1010319050 6:74485441-74485463 TCTCCTGGATAATATCCTGCAGG - Intergenic
1010755538 6:79662714-79662736 TCTCCTGGATAATATCCTGAAGG + Intronic
1011338011 6:86282702-86282724 TCTCCTGGACAATATCCTGTAGG + Intergenic
1012603507 6:101128656-101128678 TAACCTTGGTAGTATCCTGCTGG - Intergenic
1013909035 6:115251645-115251667 TCTCCGGGATAATATCCTGCAGG - Intergenic
1013939758 6:115646737-115646759 TCTCCTGGATAATATCCTGAAGG - Intergenic
1014084942 6:117331415-117331437 TCTCCTGGATAATATCCCGAAGG - Intronic
1014676156 6:124369097-124369119 ATTCCAAGATAGTATCCTGCTGG + Intronic
1015291247 6:131540132-131540154 TCTCCTGGATAACATCCTGAAGG - Intergenic
1020771098 7:12396410-12396432 TCTTCTGTATATTATCCTACAGG + Intronic
1023373870 7:39537164-39537186 TGTACTGGAGATTATCCTGCAGG - Intergenic
1024868792 7:53937350-53937372 TCTCCTTCATATTAACCTGCAGG + Intergenic
1028508045 7:91591215-91591237 TCTCCTGGATAATATCCTGCAGG - Intergenic
1030121660 7:106116005-106116027 TTTCCTGGATTGGATCCTGGGGG - Intergenic
1031314468 7:120239398-120239420 TCTCCTGGATAATACCCTGCAGG + Intergenic
1032445827 7:131982909-131982931 TCTCCTGGATAATATCCTGCAGG + Intergenic
1034703754 7:153121600-153121622 TCTCCTGGATAATATCCTGCAGG + Intergenic
1034836934 7:154361191-154361213 CCTACTGGATAGTTACCTGCTGG + Intronic
1037596468 8:20358401-20358423 TGTCCTGGATGGCATCCAGCAGG - Intergenic
1039319449 8:36412686-36412708 TCTCCTGGATAATATCCTGCAGG + Intergenic
1040738640 8:50543475-50543497 TCTCCAGGAAATTATCCTGTGGG - Intronic
1042752072 8:72169195-72169217 TGTCTTGTATAGTATCTTGCAGG + Intergenic
1043223696 8:77698267-77698289 TCTCCTGGATAATATCTTAAAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045177421 8:99740396-99740418 TCTCCTGGATAATATCCTGCAGG - Intronic
1046338740 8:112824872-112824894 TTACCTGGATAATATCCTGAAGG + Intronic
1046821384 8:118637716-118637738 TATCCTGGATACAATCCTGTAGG + Intergenic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1051484641 9:17594721-17594743 TCTCCTTGATGGTATCCTCTAGG + Intronic
1051958412 9:22727505-22727527 TCTCCTGGATAATATCCTGCAGG - Intergenic
1052277744 9:26696932-26696954 TGTTTTGTATAGTATCCTGCAGG - Intergenic
1052372886 9:27685753-27685775 TCACCTGGTTAGAAGCCTGCTGG + Intergenic
1052515170 9:29471312-29471334 TCTCCTGGATGGTACTCTGAAGG + Intergenic
1055185198 9:73443200-73443222 TCTCCAGAAATGTATCCTGCTGG + Intergenic
1056717968 9:89048850-89048872 GCTCTCGGATAGTACCCTGCGGG + Intronic
1058224107 9:102338782-102338804 TCTCCTGGATAATATCCTGCAGG - Intergenic
1058323729 9:103668478-103668500 TTTTCTGCATAGTATCCTTCGGG + Intergenic
1058374471 9:104306488-104306510 TATCCTGTATAATATCCTGAAGG - Intergenic
1058408624 9:104705030-104705052 TCTCCTGGATGATATCGTGAAGG - Intergenic
1059510529 9:114840915-114840937 TGTCTTGTATAGTATCTTGCAGG - Intergenic
1059513526 9:114871254-114871276 TCTCCTGGATAATATCCTGAAGG - Intergenic
1060235928 9:121862651-121862673 TGTCCTGGACAGGATCGTGCTGG + Intronic
1061816426 9:133199970-133199992 TCTCCTGCAGAGAATCCTGGAGG - Intergenic
1186354380 X:8774515-8774537 TCTCCTAGGTAATATCCTGAAGG - Intergenic
1189576860 X:42363183-42363205 TCTGCTTGATACCATCCTGCAGG + Intergenic
1190341290 X:49298580-49298602 TCTACTGGATAATATCCTGAAGG + Intronic
1190604645 X:52128136-52128158 TGTCTTGTATAGTATCTTGCAGG - Intergenic
1191938836 X:66455397-66455419 TCTCCTGGATAATATCTTGCAGG - Intergenic
1192701880 X:73482701-73482723 TCTCCTGGATAATATCCCTAAGG - Intergenic
1192712466 X:73606061-73606083 TCTCCTGGCTTATATCCTGAAGG + Intronic
1192900425 X:75490163-75490185 TCTCCTGGATAATATCCTTCAGG - Intronic
1192984424 X:76381294-76381316 TCTCCTGGATAATATCCTGAAGG - Intergenic
1193171357 X:78340273-78340295 TATCTTGTATAGTATCTTGCTGG + Intergenic
1193243172 X:79196846-79196868 TCTCCTGGATAATATCCTGAAGG - Intergenic
1193338721 X:80320858-80320880 TCTCGGGGATAATATCCTGATGG - Intergenic
1193510171 X:82389656-82389678 TCTCTTGGATAATATCCTGAAGG - Intergenic
1193528256 X:82620149-82620171 TCTCCTGGATGATACCCTGAAGG - Intergenic
1194958897 X:100213342-100213364 TCTCCTGGAAAATATCGTGAAGG + Intergenic
1195810467 X:108823781-108823803 TCTCCTGGATAATATCCTTATGG + Intergenic
1196474624 X:116068464-116068486 TCTCCTGGATAATATCCTGCTGG + Intergenic
1196944803 X:120813084-120813106 TCTCCTGGATAATATCCTGCAGG - Intergenic
1197649164 X:129045803-129045825 TCTCCTGGATAATATCCTGCAGG - Intergenic
1198376784 X:136048705-136048727 TCTCATGGAGAGTATTCTACGGG + Intergenic
1198704836 X:139437242-139437264 TCTCCTGCATAATATCCTGCAGG - Intergenic
1199245723 X:145601302-145601324 CTTCCTGTGTAGTATCCTGCAGG - Intergenic
1200106589 X:153716810-153716832 ACTCCTAGCTGGTATCCTGCAGG - Intronic
1200365250 X:155656165-155656187 TCTCCTGGATAATATACTGAAGG + Intronic
1200977111 Y:9224827-9224849 TCTCCTTGATCGTGTCCTACTGG - Intergenic
1201541430 Y:15109350-15109372 TCTCCTGGATAATATCCTGAAGG + Intergenic
1201990305 Y:20016511-20016533 TGTCCTGGCTTGTATCCAGCTGG - Intergenic
1202020666 Y:20461841-20461863 TCTCCTGGGTAATATCCTGATGG + Intergenic
1202041888 Y:20694445-20694467 TCTCCTGGATAGTATCCTGAAGG + Intergenic