ID: 904900051

View in Genome Browser
Species Human (GRCh38)
Location 1:33849980-33850002
Sequence AAGGGTAAAGAGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1151
Summary {0: 1, 1: 1, 2: 8, 3: 112, 4: 1029}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904900051_904900061 18 Left 904900051 1:33849980-33850002 CCTGCCTCCTCCTCTTTACCCTT 0: 1
1: 1
2: 8
3: 112
4: 1029
Right 904900061 1:33850021-33850043 ATCTCCTCACTGTTCAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 152
904900051_904900063 23 Left 904900051 1:33849980-33850002 CCTGCCTCCTCCTCTTTACCCTT 0: 1
1: 1
2: 8
3: 112
4: 1029
Right 904900063 1:33850026-33850048 CTCACTGTTCAAAACTGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904900051 Original CRISPR AAGGGTAAAGAGGAGGAGGC AGG (reversed) Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900323392 1:2095829-2095851 AGGGGAAAAGAGGAGAAGGGAGG - Intronic
900538094 1:3188818-3188840 AAGGAGAGAGAGGAGGAAGCAGG + Intronic
900693658 1:3996767-3996789 AAGAGGACAGAGGTGGAGGCAGG - Intergenic
901172342 1:7268250-7268272 AAGAGTACAGAGGAGAAGGGGGG + Intronic
901740366 1:11338131-11338153 AAGGGGGAGGAGGAGGAGGTGGG - Intergenic
901835427 1:11921063-11921085 AAGAGTAGAGGGGAGGAGACGGG + Intronic
902043041 1:13506211-13506233 AAGGGTAAAGAAGTCAAGGCAGG + Intronic
902280277 1:15369346-15369368 TAGGGTAGAGAAGAGGAGGATGG - Intronic
902359105 1:15932331-15932353 AAGGCTGCTGAGGAGGAGGCAGG + Exonic
902771460 1:18647524-18647546 AAGGAGAAAGAGGAGGACCCTGG + Intronic
903011175 1:20331493-20331515 AAGGTGGAAGAGGAGGAAGCAGG + Intronic
903298935 1:22364258-22364280 AAGAGAAGAGAGGTGGAGGCAGG - Intergenic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
904047848 1:27619485-27619507 AAGGCTATATAGGAGGGGGCTGG - Intronic
904087077 1:27916760-27916782 AGGAGGAAAGAGGAGGAGGAAGG - Intergenic
904224890 1:29008492-29008514 AATGGTAGAGAGGATGAGGCAGG + Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905078438 1:35295327-35295349 AAGGGCAAAGATTATGAGGCAGG + Intronic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905392063 1:37642622-37642644 AAGGACAAAAAGGAGCAGGCAGG - Intergenic
905461940 1:38127828-38127850 AATGGCAAGGAGGAGGAGGGTGG - Intergenic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905704358 1:40043077-40043099 AAGAGTAAAGATACGGAGGCAGG + Intronic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
906063313 1:42962316-42962338 AAGGGGAAAGGGGAGCAGGAGGG + Intergenic
906129170 1:43445857-43445879 GAGGGATAAGAGGATGAGGCAGG - Intronic
906436651 1:45802425-45802447 CAGGGAATAGAGGAGCAGGCTGG + Intronic
906472097 1:46139671-46139693 AAGAGGAAAGACGAGGAGGATGG - Intronic
907289999 1:53407505-53407527 AAGGCTAGAGAGGATGAGGATGG + Intergenic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907706815 1:56839612-56839634 ATGGGTACAGAGTGGGAGGCTGG + Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907936388 1:59046011-59046033 AAGGTGACAGAGGAGGAAGCAGG - Intergenic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
911031741 1:93496243-93496265 AAGGAAAAAGAGGAGAAGGAAGG - Intronic
911282192 1:95943671-95943693 AAAGGAAAAGAAGGGGAGGCAGG - Intergenic
911757485 1:101575892-101575914 AAGAGTAAACAGCCGGAGGCAGG + Intergenic
911930490 1:103896684-103896706 TAAGCTGAAGAGGAGGAGGCAGG - Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912255890 1:108057780-108057802 AACAGCAGAGAGGAGGAGGCAGG - Intergenic
912560102 1:110545006-110545028 AAGGGAAAAGAGGAAGAAGGGGG - Intergenic
912782426 1:112564217-112564239 AAGGGAAAAGGAAAGGAGGCTGG + Intronic
912920471 1:113861821-113861843 AAGGGTATAAAAGAGGAAGCAGG + Intronic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913398171 1:118395966-118395988 GAAGGAAGAGAGGAGGAGGCTGG - Intergenic
913540627 1:119816956-119816978 AATGTTATAGAGGAGGGGGCTGG - Intergenic
913939860 1:125091637-125091659 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
913979215 1:143493455-143493477 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914043606 1:144072789-144072811 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914073618 1:144319105-144319127 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914105537 1:144647255-144647277 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
914134481 1:144887702-144887724 AAAAGTAAAAAGGAGGAGGAGGG + Exonic
914242173 1:145859263-145859285 TAGGGCAACGGGGAGGAGGCGGG + Intronic
914514568 1:148362882-148362904 GAGGGAAAAGAGGGAGAGGCAGG - Intergenic
915015180 1:152726340-152726362 ACGGGAGAAGAAGAGGAGGCAGG + Intergenic
915418475 1:155760698-155760720 AAGGGTACAAGGGAGAAGGCAGG + Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915646251 1:157274758-157274780 AGGGATAATGAGGAGGAGGGAGG + Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916260168 1:162833991-162834013 GAGGGTAAGCAGGAGGTGGCAGG + Intronic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
916475184 1:165162335-165162357 TAGGGCAAAGAGGAGTAGGAAGG + Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
917600277 1:176566733-176566755 AAGTGCAAAAAGGAGGAGGCAGG - Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
918085864 1:181244754-181244776 AAGGGGAAAGAGGAGAGGGAGGG + Intergenic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
919058085 1:192595459-192595481 AGGGGTAGGGAGGAGGAGGGAGG + Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919822834 1:201483737-201483759 AAGGGTGGAGTGGAAGAGGCAGG + Exonic
919968447 1:202553607-202553629 GAGTGTACAGAGGAGGAGGATGG + Intronic
920182736 1:204142579-204142601 ATGGGCAGAGGGGAGGAGGCTGG + Intronic
920199416 1:204250342-204250364 AAGGGGGATGAGGAGGAGGTAGG + Intronic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
920313434 1:205061712-205061734 GAGGACAAAGAGGAGGGGGCCGG - Intronic
920966128 1:210702386-210702408 AAGGAAAAAGGGGAGGAGGAAGG - Intronic
921135667 1:212257064-212257086 GATGGTTAAGAGGAGGGGGCTGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921382551 1:214539709-214539731 GAGGGAAGAGAGGAGGAGGGAGG + Intronic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922204664 1:223436046-223436068 AAGGATAAAGAGGAAAAAGCAGG + Intergenic
922334456 1:224607366-224607388 AAGGGAAAAGAGCAGGCAGCAGG + Intronic
922375437 1:224959271-224959293 TGGGGTAATGAGGAGGAGGGTGG - Intronic
922601242 1:226856127-226856149 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922723853 1:227913607-227913629 AAGGCTGAGGAGGAGGAGGGAGG + Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922872175 1:228911680-228911702 AAGGACAAAGAGGGGCAGGCTGG + Intergenic
922900110 1:229130076-229130098 AATGGCACAGAGGAGGAAGCTGG + Intergenic
923367976 1:233282205-233282227 CAGGGCAAAGAGGAGGCGTCGGG - Intronic
923436943 1:233976083-233976105 AAGGCGAAGGAGGAGGAGGGAGG + Intronic
924110319 1:240692373-240692395 CTGGGTAAAGAGGAGGCTGCCGG - Intergenic
924196805 1:241616164-241616186 AAGGGAATAGAGGAAGAGGCAGG - Intronic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
924952193 1:248895372-248895394 AAGGACAAAGAGGAGGAAGAAGG + Intergenic
1063159454 10:3408756-3408778 AGGAGGAAAGAGGAGGAGGAGGG + Intergenic
1063159493 10:3408898-3408920 AGGAGGAAAGAGGAGGAGGGAGG + Intergenic
1063164813 10:3451676-3451698 TAGAGGAAAGAGGAGGAGGGAGG - Intergenic
1063250011 10:4264037-4264059 AAGGGTCAAGAGAGGGAAGCAGG - Intergenic
1063758869 10:9048474-9048496 AAGGGAAATGTGGAGGAGACTGG - Intergenic
1063953948 10:11248421-11248443 AAGGATGGAGAGGAGGAGGGTGG - Intronic
1064216812 10:13407278-13407300 AAGGGAAAGGAGGAAGATGCCGG + Intergenic
1064490563 10:15851381-15851403 AAGGGTGAAGAGGGAGATGCAGG - Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064555987 10:16547634-16547656 AAGGCAAAGGAGGAGCAGGCAGG - Intergenic
1064566968 10:16650239-16650261 AAAGGTTGACAGGAGGAGGCAGG + Intronic
1064706112 10:18074164-18074186 GAGGGAGAAAAGGAGGAGGCAGG + Intergenic
1064737695 10:18399531-18399553 AAGGGTAGAAGGGAGGAGGAGGG + Intronic
1064767441 10:18688983-18689005 AATGGAAAAAAGGAGAAGGCAGG - Intergenic
1066191053 10:33056603-33056625 AAGGGAAATGTGGAGGAAGCAGG + Intergenic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066442202 10:35449531-35449553 AAGGCTGCAGAGGGGGAGGCTGG + Intronic
1066562606 10:36686891-36686913 AAGAGGGAAGAGGAGGAGGAAGG + Intergenic
1066601366 10:37110957-37110979 AAGGGTAGAGAGGAAGAGGCAGG + Intergenic
1066694879 10:38068822-38068844 GAGGATAAAGAGGAGGAGTACGG + Intergenic
1066780275 10:38938148-38938170 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1066956023 10:42173434-42173456 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1067770752 10:49121980-49122002 GAGGGTAAAGATGATGAGTCTGG - Intergenic
1067809753 10:49417739-49417761 AAGGGTAAGGCCGGGGAGGCTGG + Intergenic
1068644554 10:59451223-59451245 ATGGCTATAGAGGAAGAGGCAGG - Intergenic
1068700702 10:60016706-60016728 AAGGATAAAGAAGAGTAGGTTGG - Intergenic
1069060968 10:63894139-63894161 AAGGAAAGAGAGGAGGAGGAAGG - Intergenic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1069821256 10:71230074-71230096 AAGAGCAGAGAGGAGGAGGTAGG - Intronic
1069870030 10:71527443-71527465 CAGGGCCCAGAGGAGGAGGCTGG - Intronic
1070290321 10:75109573-75109595 CAGGGTGCAGAGGAGGTGGCTGG + Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070586345 10:77769735-77769757 AAGTGGAAAGAGCAGGAGCCAGG - Intergenic
1070811676 10:79301231-79301253 AAGGGTAGGGAGGAGGGGCCAGG - Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1072639587 10:97201878-97201900 GAGGGTGAAGAGGAGGGAGCAGG - Intronic
1072710516 10:97713375-97713397 AAGAGGGAAAAGGAGGAGGCAGG + Intronic
1072815773 10:98507657-98507679 AAGGATAGAGAGGGGGAGGACGG - Intronic
1072857119 10:98959879-98959901 AAGGAGAAAGAAGAGGAGGAGGG - Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073053990 10:100687409-100687431 AAGGGAAAAGAGGCCGGGGCCGG - Intergenic
1073433279 10:103500654-103500676 AAGCGTAAGGGGGAGGAGGCTGG - Intronic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073597763 10:104817532-104817554 AGGGGGAAAGAAGAGGAGGAGGG - Intronic
1074120032 10:110487400-110487422 AATGGTAAAAAGGTGGGGGCGGG - Intergenic
1074155018 10:110790376-110790398 GAGAGCAAAGAGGAGGAGACAGG + Intronic
1074238500 10:111610833-111610855 GAGGAGGAAGAGGAGGAGGCTGG + Intergenic
1074364972 10:112850428-112850450 AAGGGTAAAGAAGAGGGTGAGGG + Intergenic
1074442043 10:113486548-113486570 AGAGGTTAAGTGGAGGAGGCTGG - Intergenic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1074672200 10:115804455-115804477 AAGAGCAAAGAGCAGGAGCCAGG - Intronic
1074813929 10:117130893-117130915 AAGGAGAAAGAGCAGGAAGCTGG + Intronic
1075091684 10:119447361-119447383 ATGGGTCAAGGGGAGGGGGCTGG - Intronic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075528340 10:123204484-123204506 GAGGGTAAATTGGATGAGGCGGG - Intergenic
1075724602 10:124604904-124604926 CAGGGTAGAGAGGAGGCGGGTGG + Intronic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076318883 10:129564224-129564246 AAGGGGGAAGAGGAGGGGGAAGG - Intronic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076442344 10:130488606-130488628 AAGGGGATTGAGGAAGAGGCAGG + Intergenic
1076524189 10:131100956-131100978 AGTGGGAAAGAGGAGGAAGCAGG - Intronic
1076558474 10:131345644-131345666 AAAAGGAAAAAGGAGGAGGCAGG + Intergenic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077871431 11:6265535-6265557 AAGATTAAAGAGGTGGAGGCTGG + Intronic
1078548177 11:12261388-12261410 AAGGGTAAAAATGAGCATGCAGG + Intronic
1078839857 11:15068536-15068558 AAGGGTACAGAGAAGCAGGCTGG + Intronic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079400757 11:20104587-20104609 AGGGGGAAAGAGGAGGACGATGG - Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079465006 11:20721783-20721805 AAGGGTAAAGAGAAGGACTTTGG + Intronic
1079549769 11:21680431-21680453 AAGGGTAAAGAAGAGGAGAAAGG + Intergenic
1080021290 11:27562866-27562888 AAAGGTAAAGAAGAGTAGGTGGG + Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1081567250 11:44267583-44267605 AAGGGCCAAGTGGAGGAAGCGGG - Exonic
1081574470 11:44310518-44310540 AAGAGTGGAGAGGAGGGGGCAGG - Intergenic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081686664 11:45047799-45047821 AAGGGTAAAGTTCTGGAGGCAGG - Intergenic
1081736972 11:45410998-45411020 AAGGGCAGGGAGGTGGAGGCGGG - Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1081964343 11:47160638-47160660 CAGGGGCAAGAGGAGAAGGCTGG - Intronic
1083285610 11:61656704-61656726 ATGGGCAAAGGAGAGGAGGCTGG + Intergenic
1083419606 11:62545718-62545740 AGGGGCAAAGGGGAGGAGGAAGG - Intronic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1083936399 11:65872187-65872209 AAGGGTAGGGAGGAAGAGACCGG - Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1085049218 11:73371372-73371394 ATGGGGAAAGAGGAAAAGGCAGG + Intergenic
1085445405 11:76597823-76597845 GTGGGTACAGAGGAGGAGGTGGG - Intergenic
1085824886 11:79834934-79834956 AAGGGAAAGGAGGAGTAGGGAGG - Intergenic
1086314705 11:85579232-85579254 AAGGGTGAAGGGTAGGAGGAGGG + Intronic
1086610125 11:88745500-88745522 AAGAGTAAAGAGTATCAGGCTGG - Intronic
1087665264 11:101038168-101038190 AAGGGAGAGGAGGAGGAGGGAGG - Exonic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1088056885 11:105593631-105593653 AAGGGTAAAAAAGGGGAGGTTGG - Intergenic
1088736498 11:112732066-112732088 AGGTGTAAAGAGAAGGAAGCTGG + Intergenic
1089257862 11:117203481-117203503 GAAGGTAGAGAGGAAGAGGCTGG + Exonic
1089667449 11:120029472-120029494 AGGGAAAAAGAGGAGGAGCCAGG + Intergenic
1089668359 11:120034510-120034532 ATGGGGAGAGAGAAGGAGGCAGG - Intergenic
1089672972 11:120069260-120069282 AAGGGTGAAGGGGAAGAGGAGGG - Intergenic
1090541333 11:127709705-127709727 AAGGGTGTAGAGGTGAAGGCAGG + Intergenic
1090668740 11:128931324-128931346 TAGTGGAAAGAGGAAGAGGCGGG + Intergenic
1090854600 11:130600657-130600679 AAGGCGAAAGAGAAGCAGGCAGG + Intergenic
1090952262 11:131484050-131484072 AAAGGTAATGAGCAGGAGGAGGG + Intronic
1090976852 11:131686567-131686589 GAGGCAGAAGAGGAGGAGGCAGG + Intronic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091896473 12:4109241-4109263 AAGGGCACAGAGGAGGAGAGAGG + Intergenic
1092524141 12:9299285-9299307 GAAGCCAAAGAGGAGGAGGCAGG + Intergenic
1092543127 12:9432527-9432549 GAAGCCAAAGAGGAGGAGGCAGG - Intergenic
1092769493 12:11883948-11883970 ATGGATAAAGATGAGAAGGCTGG - Intronic
1092873921 12:12831999-12832021 AGGAGTAAAGAGTAGGAGGCAGG + Intergenic
1092973889 12:13725336-13725358 AAGAGGGAAGAGGAGGAGTCAGG + Intronic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093087737 12:14885634-14885656 AAGGGGGAAGAAGAGGAGGAGGG + Intronic
1093298818 12:17427581-17427603 AAGGCTAAAGAGGGCGAGGATGG + Intergenic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1094509892 12:31089911-31089933 GAAGCCAAAGAGGAGGAGGCAGG + Exonic
1094676698 12:32627516-32627538 AAGGGGAAGGAGGAGGAGATGGG + Intronic
1095483983 12:42665309-42665331 AAGGACAGAGAGGAGAAGGCTGG - Intergenic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096785155 12:54013107-54013129 AAGGCTGAGGAGGAGGAGGGTGG - Intronic
1096862766 12:54541929-54541951 GAGGGTGAAGAGGGGGAGGTGGG - Intronic
1097673307 12:62568130-62568152 TAGGTTAAAAAGGGGGAGGCAGG + Intronic
1097841523 12:64326207-64326229 CAGGGTAGAGAGGAGGGGGGTGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099304535 12:80937513-80937535 AAGGGGAACGAGGACGAGCCAGG - Intronic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100591671 12:96035606-96035628 AGAGGTAAAGAAGAGGAGGAGGG + Exonic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1101877325 12:108604403-108604425 AATGGAAAAGACGAGGAGACAGG + Intergenic
1102090660 12:110184592-110184614 AAGGGTAAAGGGAAGGGAGCAGG + Intronic
1102244814 12:111348535-111348557 CAGGGTGAAGAGGAGCAGGGGGG - Exonic
1102471917 12:113164080-113164102 AAGGAGGAGGAGGAGGAGGCGGG - Exonic
1102764793 12:115423208-115423230 GAGGAAAAAGAGGAGGAGGGAGG + Intergenic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1102800108 12:115724728-115724750 AAAGATGAAGAGGAGGAAGCAGG + Intergenic
1103080912 12:118023395-118023417 AAGGGGGAGGAGGAGGAGGGGGG + Intronic
1103088712 12:118082081-118082103 AAGGGTTAAGGGGAAGAAGCGGG + Intronic
1103262203 12:119597112-119597134 AAGGACAAAGAGGAAGAGGAAGG + Intronic
1103617313 12:122162514-122162536 GAGGGAAAAGAGGAGGGAGCAGG - Intergenic
1105277551 13:18944535-18944557 AGGGGTAAGGATGAGGAGGCTGG - Intergenic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1106242227 13:27921123-27921145 AGGAGTAAAGAGGAAGGGGCTGG + Intronic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106644089 13:31614382-31614404 AAGGGCAAAGAGGTGGAAGTGGG - Intergenic
1107011654 13:35676479-35676501 AAGGGTGGAGAGCAGGGGGCAGG - Intergenic
1107269218 13:38594621-38594643 GAGGGTAAAGGAGAGCAGGCTGG - Intergenic
1107584565 13:41830891-41830913 AAAAGAAAAGAGGAGGAGGAAGG + Intronic
1107777604 13:43862965-43862987 AAGGATGAAGAGGAAGAGGGAGG - Intronic
1107788631 13:43978613-43978635 AAGGGTCAGGAAGGGGAGGCTGG + Intergenic
1107810114 13:44192349-44192371 AAGGATATAGAGGAGGAGTGGGG + Intergenic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108470832 13:50765431-50765453 AAGGAGAAAGAAGAGGAGGAAGG + Intronic
1108793470 13:54001696-54001718 ATGAGTTTAGAGGAGGAGGCTGG - Intergenic
1108814548 13:54273898-54273920 AAGGGGAAAGAGGAGAAGAAAGG - Intergenic
1108867552 13:54940622-54940644 AGGGGTAATGAGGGGGAGGGAGG + Intergenic
1109062711 13:57638375-57638397 TAGGAAAGAGAGGAGGAGGCTGG + Intronic
1109226932 13:59708291-59708313 AAGGAAAGAGAGGATGAGGCTGG - Intronic
1109249876 13:60006712-60006734 AAAAGAAAAGAGGAGGAGACTGG + Intronic
1109878968 13:68446036-68446058 AAGGGTTAAGAGTAGAAGTCAGG + Intergenic
1110582494 13:77147552-77147574 AAGGGTAGAGAGAAGGAAGGGGG - Intronic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1110947437 13:81440439-81440461 AAGGGTAGTGGGGAGGAGGGGGG + Intergenic
1111251606 13:85608633-85608655 AAGGGTAAGGAGAAGAGGGCGGG - Intergenic
1111330871 13:86761131-86761153 TGGGGGAATGAGGAGGAGGCGGG + Intergenic
1111683419 13:91471804-91471826 AAGGGTCAAGAGGAACAGGGAGG - Intronic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1112342536 13:98564529-98564551 AAGAGCAGAGAGGAGGAAGCTGG + Intronic
1112840546 13:103572255-103572277 AAGGGAAGAGAGGTGGAGGAAGG - Intergenic
1113285643 13:108845487-108845509 AATGGGAAGGAGGAAGAGGCAGG + Intronic
1113394457 13:109933719-109933741 CAGGGTGAAGAGGAGGAGTGTGG - Intergenic
1113522965 13:110953652-110953674 AAAGGTAAAGGGGAAGAGGCTGG + Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114527546 14:23376157-23376179 ATGGGAAAAGAGGAAGAGACAGG - Exonic
1114619607 14:24087411-24087433 ATGGGGAAAGAGGGGCAGGCAGG + Intronic
1114675312 14:24436384-24436406 AAAGGTAAAGGGCAGCAGGCTGG - Exonic
1114796086 14:25716672-25716694 GAGGGTTGAGAGGAGGAGGCAGG + Intergenic
1114882734 14:26806873-26806895 AAGAATAAAGAGGAGAAAGCAGG - Intergenic
1115117545 14:29900309-29900331 AATGGTTAGGAGGAGGAGCCTGG - Intronic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116037538 14:39645508-39645530 AAGGATAAGGAGGAGGAGTGGGG + Intergenic
1116575370 14:46567798-46567820 AAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117984798 14:61376630-61376652 AAGTGTGCAGTGGAGGAGGCAGG - Intronic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118179152 14:63473884-63473906 AAAGGTAAAGAGAAGGAACCTGG + Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118357530 14:65027071-65027093 AAAGGCAAGGAGGAGGAGGCTGG + Intronic
1118361587 14:65061844-65061866 AAGGGAAAAGAGCTGGAGGTGGG + Exonic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118548572 14:66922773-66922795 GAGGGGAAAGAGGGGGAGGTGGG - Exonic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118676310 14:68188351-68188373 AAGGGGAGAAAGGAGGAGGGGGG - Intronic
1118749185 14:68794214-68794236 GAAGGTAAAGAGGTGGAGGGAGG + Intronic
1118819782 14:69337769-69337791 AAGGGCAGAGTGGAGGAAGCAGG - Intronic
1119133433 14:72195234-72195256 AAGTGGGAAGAGGAGCAGGCTGG + Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119219214 14:72893021-72893043 AAGGATGAAAAGGAGGAGGAAGG + Intronic
1119922230 14:78457045-78457067 GAGGAGAAAGAGGAGGTGGCGGG - Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1119999852 14:79290411-79290433 AAGGGAAAGGAGGAGGAGACAGG + Intronic
1120016053 14:79474823-79474845 AGAGGGAAAGAGGAGGAGGAAGG + Intronic
1120336101 14:83157065-83157087 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1120895422 14:89527072-89527094 AAGGGAGGAGAGGAGGAGGAAGG + Intronic
1120899906 14:89566864-89566886 GAGGGTAAGGAAGAGGAGGGGGG - Intronic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1121007969 14:90502307-90502329 GAGGGTGGAGAGGAGGGGGCTGG - Intergenic
1121241891 14:92436873-92436895 GTGGGTAAAGGGGAGAAGGCAGG - Intronic
1121406379 14:93721572-93721594 AAGGCAAAGGAGGGGGAGGCAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121777053 14:96598075-96598097 AAGGGGGAAGAGGAGGGGGAAGG - Intergenic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1122074722 14:99228750-99228772 AAGGGGAAGGAGGAGCAGGGAGG - Intronic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122322264 14:100862170-100862192 AGGGAGAAAGAGGAGGAGGAGGG - Intergenic
1122337343 14:101002534-101002556 AAGGGTAGAGAGGTGAAGGGTGG - Intergenic
1122415062 14:101545453-101545475 ATGGCTGTAGAGGAGGAGGCGGG - Intergenic
1122507081 14:102238570-102238592 AGGGGTAATGAGGAGGAGGGAGG - Intronic
1122602021 14:102926316-102926338 AAGGGCAAGGCGGAGGATGCTGG - Intronic
1122628017 14:103094129-103094151 AGGGGCAAAGATGTGGAGGCGGG - Intergenic
1122672044 14:103379842-103379864 GAGGGGAAAGAGGAGGGGCCGGG - Intergenic
1123011309 14:105350817-105350839 AAGGGTCAAGGGGAGGAGCAGGG + Intronic
1123392900 15:19895243-19895265 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1123905797 15:24920148-24920170 GAAGGTAAGGAGGAAGAGGCTGG - Intronic
1124642441 15:31404271-31404293 AAGGGTAGAAGGGAGGAGGTTGG + Intronic
1124818935 15:33023234-33023256 AAGGGTAAAGGGGAAGGGGAGGG + Intronic
1124890146 15:33725277-33725299 AAGGGTAGAGAAGAGGTGGTTGG - Intronic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1125581590 15:40789467-40789489 AAGGTTAAAAGGGAGGAGGTGGG - Intronic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125639790 15:41221002-41221024 AAGAAGAAAGAAGAGGAGGCTGG - Intronic
1125741564 15:41968583-41968605 AAGAGTAAAGATGAGGGGCCAGG - Intronic
1126081928 15:44971825-44971847 AAGGGAAAAAAGGAGGGGGGGGG - Intronic
1127002792 15:54529773-54529795 AATGGTAATGAGGAGAAGGAGGG - Intronic
1127397207 15:58552446-58552468 GAGGGCAGAGAGGAGGAGGCGGG - Intronic
1127646280 15:60962574-60962596 TAGGGTAAAGTGGAGGAGAGCGG - Intronic
1127959259 15:63878915-63878937 CTGGGTCAAGCGGAGGAGGCAGG + Intergenic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128237882 15:66079926-66079948 AACGGGAAAGGGGAGGAAGCAGG - Intronic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1129131756 15:73504682-73504704 TGGGGTAGAGAGGAGCAGGCAGG + Intronic
1129953763 15:79614730-79614752 AAACGTAAAGAGGAGGACACAGG + Intergenic
1130090035 15:80813305-80813327 AATGATAACGAGGAGGAGGATGG - Intronic
1130408507 15:83624421-83624443 AAGCGCAAAGAGCAGGAAGCGGG + Intergenic
1130424965 15:83787820-83787842 AAGGAGAAAGAGGAGGGGGAGGG - Intronic
1131780048 15:95846208-95846230 AAGGGAACAGAGGAGAAGGGAGG + Intergenic
1131901108 15:97088671-97088693 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1131901118 15:97088709-97088731 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1132016216 15:98319766-98319788 TATGGAAAAGAGGAGGAGGGAGG + Intergenic
1132580046 16:680529-680551 AAGGGCAAGGAGGAGAAGGAGGG + Exonic
1133385924 16:5370449-5370471 AAAAAAAAAGAGGAGGAGGCTGG - Intergenic
1133430812 16:5735503-5735525 AAGGGTCAAGATGCGGAAGCGGG - Intergenic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133690458 16:8209662-8209684 GAGGAAAAAGAGGAGGAGCCAGG + Intergenic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1133972741 16:10579227-10579249 AAGCTTAAAGAGGACGAGGAAGG - Intronic
1134038644 16:11051124-11051146 AAGGACAGAGAGGAGGAAGCAGG + Intronic
1134340859 16:13344439-13344461 AAGGGCATAGAGGAGGAAGAAGG - Intergenic
1134384214 16:13756906-13756928 AAGGGTAAACTTGAGGAGGGAGG - Intergenic
1134449429 16:14354289-14354311 AAGGGGAAAGGGGAGGGGGAAGG + Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1135526620 16:23217950-23217972 AAGGGTGAAGTGGAGAAGGAGGG - Intergenic
1135532099 16:23263614-23263636 AAGGCTGAAGAGGAAGAGGAGGG - Intergenic
1135973473 16:27089324-27089346 AAGGGTAGAGAGAAGAAGGTAGG + Intergenic
1136081319 16:27854251-27854273 AAGGCAAAAGGGGAGGAGGAGGG + Intronic
1136343815 16:29662926-29662948 AAGGGTGCAGAGGAGGAGGTGGG - Intergenic
1136394150 16:29983793-29983815 GAGGGTTAAGGGGAGCAGGCAGG - Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136799203 16:33055254-33055276 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1136956881 16:34798203-34798225 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1137273814 16:46920251-46920273 AAGGGGAAAGAGCAGGAGTTTGG + Intronic
1137683534 16:50370613-50370635 CAGGGTAATGAGGAGCAGACAGG - Intergenic
1138103499 16:54273794-54273816 AATGGGAAAGAGGAAGAGGAAGG - Intergenic
1138248952 16:55487862-55487884 AAGAATGAAGAGGAGGAGGGAGG - Intronic
1138256947 16:55573709-55573731 AAAGATAAAGAGGTGGAGGGAGG - Intronic
1138513122 16:57520142-57520164 CAGGATGAAGACGAGGAGGCTGG - Intronic
1139297748 16:65917968-65917990 CCAAGTAAAGAGGAGGAGGCAGG + Intergenic
1139421456 16:66851759-66851781 ATGGGGAGAGAGGAAGAGGCTGG + Intronic
1139477339 16:67209258-67209280 AAGGGCAGAGTAGAGGAGGCTGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139946339 16:70644944-70644966 AAGGAGGAAGAGGAGGAGGAAGG + Intronic
1140465355 16:75176791-75176813 AAGGGAAAAGAGGAATAGGAAGG + Intergenic
1140486832 16:75300122-75300144 AAGGGTACAGAGGTAGAAGCAGG + Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141469696 16:84229964-84229986 AAAGGGACAGATGAGGAGGCAGG + Intronic
1141675672 16:85515978-85516000 AAGGGCAGAGAGGAGATGGCAGG + Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141862710 16:86728888-86728910 AAGTGAAAAGAGGTGGATGCTGG + Intergenic
1141974694 16:87507772-87507794 AAGTGTGACCAGGAGGAGGCTGG + Intergenic
1142581988 17:948880-948902 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142581996 17:948899-948921 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582004 17:948918-948940 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582012 17:948937-948959 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142852155 17:2709510-2709532 GAGGGGGAGGAGGAGGAGGCTGG - Intronic
1143060323 17:4195243-4195265 AAGGGTAAAGAGAAAGAACCAGG - Intronic
1143305941 17:5946797-5946819 AAGGGTGGAGAGGAGAAGGATGG + Intronic
1143478906 17:7217612-7217634 AAGGGGAGAGAGGAGGAGAGAGG + Intronic
1143902003 17:10181430-10181452 AAGGGTAAAGAAGAGGATGGGGG + Intronic
1144176887 17:12716231-12716253 ATGGGTAGAGAGGAAGAGGAGGG + Intronic
1144422846 17:15113855-15113877 CAGGGAAGAGATGAGGAGGCTGG + Intergenic
1144646149 17:16974929-16974951 AAGGAGAAAGAGGAGAAGGAAGG + Intergenic
1144667624 17:17112647-17112669 AGGGGCAGAGGGGAGGAGGCTGG - Intronic
1144864622 17:18327231-18327253 AGTGGAAAGGAGGAGGAGGCAGG + Intergenic
1145095677 17:20023585-20023607 AAGGGGGAAGAGGGCGAGGCAGG + Intronic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145218316 17:21068784-21068806 AGGGGACCAGAGGAGGAGGCAGG - Intergenic
1145709581 17:26958835-26958857 AAAAGTAAAGAGGAGGGGGAGGG - Intergenic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1145897643 17:28469744-28469766 TAGGGTAAGGAGGAGGAGTCAGG + Intronic
1146268333 17:31467927-31467949 AAGGGCAAACAGGAGCTGGCAGG - Intronic
1146274028 17:31503475-31503497 AAGGGGGAAGAGGAAGAGGAGGG + Intronic
1146660665 17:34663315-34663337 ATGGGGCAGGAGGAGGAGGCTGG + Intergenic
1146890855 17:36505668-36505690 GAGGGGAAAGAGGAGGAGATTGG - Intronic
1147055406 17:37830545-37830567 AGGGGGAAAGAGTAGCAGGCAGG + Intergenic
1147192002 17:38743493-38743515 AAGGGTCCAGAGGAACAGGCTGG - Intronic
1147374640 17:40016360-40016382 AAGGCTAATGAGGAGGGGGAAGG + Intronic
1147400687 17:40178424-40178446 AAGGGCAAGGAAGAGGAGCCGGG - Intronic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147611313 17:41803286-41803308 AAGGGTGACGAGGCCGAGGCTGG - Exonic
1147632392 17:41940439-41940461 AAGAGGAAAGGGCAGGAGGCAGG - Intronic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148240724 17:45997986-45998008 AAGGGTGAAGAGGAGGCTGGGGG + Intronic
1148677550 17:49453962-49453984 ATGGGTAGAGAGGAGAAGGAAGG - Intronic
1148792819 17:50183289-50183311 AAGCTTAAAAAGGAGTAGGCGGG + Exonic
1149273165 17:55004726-55004748 AGGGGGAAGGAGGAGGAGGCGGG + Intronic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149794455 17:59506400-59506422 AAGGATAAAAGAGAGGAGGCCGG + Intergenic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1149923398 17:60679279-60679301 AAGGGAAAAAAGGAGGAAGTAGG - Intronic
1150231016 17:63550573-63550595 AAGGGAGGAGAGGAGGGGGCGGG - Exonic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150702276 17:67458193-67458215 AAGGAAAAAGAGGAGGAAGCAGG - Intronic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1151170448 17:72241403-72241425 AAGGGTAAAAAGTAGGAGTTAGG + Intergenic
1151185616 17:72361893-72361915 GAGGGAAAAGAGGAGGGAGCTGG - Intergenic
1151362952 17:73599573-73599595 GAGGGAAAAGAGGAGGAGAGAGG + Intronic
1151454554 17:74218195-74218217 GAGGGAAAAGAGGAGCAGGTAGG - Intronic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151498326 17:74473117-74473139 AAGGGTAAGGGAAAGGAGGCAGG + Intronic
1151524283 17:74653264-74653286 AAGGGAAGAGAGGAAGAGGAGGG + Intergenic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1152784362 17:82240309-82240331 AGGGAGAAAGACGAGGAGGCAGG + Intronic
1153395962 18:4621081-4621103 AAGGTAAGAGATGAGGAGGCTGG + Intergenic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153503333 18:5770602-5770624 TAGGGTAAAGAGGATGAGGGGGG + Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1154425082 18:14265849-14265871 TAGGGTGAGGAGGAGTAGGCTGG + Intergenic
1154518680 18:15201921-15201943 AAAAGTAAAGAGGAGGGGGAGGG + Intergenic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155846791 18:30718284-30718306 AAAGGAAAAGAAGAAGAGGCTGG - Intergenic
1155870273 18:31018963-31018985 AAGGATAAAGCTGAAGAGGCAGG + Intronic
1156080577 18:33329822-33329844 AAAGGAAAAGAGGAAGAGGAAGG - Intronic
1156197987 18:34797408-34797430 AAGGGACAAGAGGAAGAGACTGG - Intronic
1156461090 18:37321694-37321716 GAGGGGCAAGAGGAGGAGGCGGG + Intronic
1156461571 18:37324157-37324179 GACTGTCAAGAGGAGGAGGCTGG - Intronic
1157030493 18:43900972-43900994 AAGGCTAAGGAAGAGGAGGAAGG - Intergenic
1157327346 18:46678668-46678690 AAGGAGAAAGGGGAGGAGGCAGG + Intronic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157888337 18:51390127-51390149 AAGGGTGGAGAGAAGAAGGCAGG - Intergenic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158620090 18:59025458-59025480 AAGGGTAGAGACGAGAAGGAAGG - Intergenic
1160021799 18:75187035-75187057 AGGAGTCAGGAGGAGGAGGCAGG - Intergenic
1160217299 18:76943341-76943363 AGGGGTGAGGAGGAGCAGGCCGG + Intronic
1160319252 18:77875074-77875096 GAGGGTGGAGAGGTGGAGGCTGG - Intergenic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160575876 18:79853578-79853600 AGAGGGCAAGAGGAGGAGGCGGG + Intergenic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160951903 19:1671871-1671893 AATGGTGAAGAAGAGCAGGCCGG - Intergenic
1160952371 19:1673944-1673966 AACGGTAAAGAGGAGGGAGGCGG - Intergenic
1160965307 19:1744719-1744741 AGGGGGGAAGAGGAGGAGGGAGG - Intergenic
1161093406 19:2375056-2375078 AAGGGGATAGAGTTGGAGGCAGG - Intergenic
1161221409 19:3119836-3119858 TAGGGCACAGAGGAGGATGCAGG - Intronic
1161404023 19:4081862-4081884 AGAGGCAAAGAGGAGGAGGGAGG - Intergenic
1161541016 19:4851640-4851662 AAGGGGGAAGAGGAGGAGGGCGG + Intronic
1161595615 19:5149711-5149733 AAGCTTAACGAGGAGGAAGCGGG + Intronic
1162151873 19:8651869-8651891 AAGGGTAGTGAGGAGGAAGAGGG - Intergenic
1162391023 19:10390300-10390322 GTGGGGAATGAGGAGGAGGCTGG + Intergenic
1162433809 19:10644660-10644682 AAAGGGAACGAGGAGGGGGCAGG + Intergenic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1162783528 19:13020168-13020190 AGGGGAGAAGAGAAGGAGGCTGG + Intronic
1162911623 19:13850767-13850789 AAGAGTCAAGAGTAAGAGGCAGG - Intergenic
1163003786 19:14384719-14384741 AAGGGGAAACAGGAGGAGATGGG - Intronic
1163425001 19:17236226-17236248 AGGGGTAGAGAGGAGAGGGCCGG + Intronic
1163558896 19:18007699-18007721 AAGGGAGAAGTGGAGGAGGTGGG - Intronic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164249795 19:23466689-23466711 AAGGAGAAAGAGGAGGAGAGGGG - Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164444310 19:28303997-28304019 AAGGGTGAAGAGGCAGAGGGAGG - Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164601652 19:29566964-29566986 ATGGGTACAGGGGAGGGGGCAGG + Intergenic
1164601769 19:29567385-29567407 ATGGGTACAGGGGAGGGGGCAGG + Intergenic
1164868632 19:31625610-31625632 GAGGAGGAAGAGGAGGAGGCTGG - Intergenic
1164937041 19:32223150-32223172 AAGAGAAAAGAGGAGGAGAAAGG + Intergenic
1165361939 19:35342091-35342113 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1165386281 19:35512403-35512425 AAGGGGTAAGAGGAAGGGGCTGG - Exonic
1165450248 19:35878227-35878249 TAGGGTCCAGAGGAGGGGGCTGG - Intronic
1166754340 19:45181104-45181126 AAGCTCAAAGGGGAGGAGGCAGG - Exonic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1166996324 19:46721291-46721313 TAGGGTCAAGAGGATCAGGCAGG + Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167608191 19:50492867-50492889 AGGGGTGAGGAGGAGGAGGGAGG + Intergenic
1167608486 19:50494359-50494381 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1167638817 19:50669051-50669073 AAGGATGCAGGGGAGGAGGCGGG + Exonic
1167758895 19:51430983-51431005 AAAGAGAAAGAGTAGGAGGCTGG - Intergenic
1167896842 19:52588575-52588597 AAGGGCAAAGAAAAGGAGCCAGG + Intergenic
1168205441 19:54847241-54847263 AAGGAGAAAGAAGAGGAGGATGG - Intronic
1168304469 19:55427995-55428017 AAAGGTAAAAAGGAGGTGGCAGG - Intergenic
1168454118 19:56492193-56492215 ATAGGTAAAGAGGGTGAGGCAGG - Intergenic
1168509259 19:56961521-56961543 AGGGGGAAAGAGGAGGGGGGAGG - Intergenic
1202682847 1_KI270712v1_random:25123-25145 AAAAGTAAAGAGGAGGGGGAAGG - Intergenic
924988165 2:289036-289058 CAGGGGGAAGAGGAGGAGACGGG - Intergenic
925169091 2:1740149-1740171 GAGGGTGCAGAGGAGGAGGAGGG + Intronic
925277458 2:2660563-2660585 AAGGTGAAAGGGGAGCAGGCAGG + Intergenic
925474481 2:4197634-4197656 AAGGGCACAGATGAGGAGGCAGG + Intergenic
925902177 2:8516515-8516537 GAGGGTGAAGGTGAGGAGGCAGG - Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926266839 2:11330876-11330898 AAGAGGAATGAGGAGGAGGGAGG + Intronic
926429065 2:12767463-12767485 GGGGGCAAAGAGGAGAAGGCAGG - Intergenic
927391469 2:22600228-22600250 AGGAGTAAAAAGGAGCAGGCTGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927486194 2:23489859-23489881 AAGGGAGAGGAGGAGGTGGCTGG + Intronic
928407274 2:31024239-31024261 AAGGGGAAAGGGGAAGAGCCAGG - Intronic
928731751 2:34239930-34239952 AAGGCAAAAGAGGAAGAAGCAGG + Intergenic
928746422 2:34421160-34421182 AAAGATAAAGAGGAGTAGCCAGG - Intergenic
929056844 2:37885688-37885710 GAGGGTAGGGAGGAGGAGGTTGG - Intergenic
929242237 2:39665554-39665576 AAGGGGAGAGAGGAGGATGAGGG + Intronic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929706842 2:44222498-44222520 AAGGGTAAAGTTGAGCAGGGGGG + Intronic
929777829 2:44939470-44939492 AAGGGGCAGGAGGAGGAAGCGGG - Intergenic
930154597 2:48093206-48093228 TTGGGGGAAGAGGAGGAGGCTGG + Intergenic
930175042 2:48292966-48292988 AGGGGCAAAAAGAAGGAGGCTGG + Intergenic
930307624 2:49695104-49695126 ACTAGTAAAGAGAAGGAGGCAGG - Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930897395 2:56462207-56462229 AGGTGTAAAGAGGCGGAGGCTGG - Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931455310 2:62405432-62405454 AATGGCAGAGAGCAGGAGGCAGG - Intergenic
931891941 2:66682812-66682834 AAGGACAAAGAGAAGAAGGCAGG - Intergenic
932468743 2:71940204-71940226 GGGGCTAGAGAGGAGGAGGCAGG - Intergenic
932743879 2:74314998-74315020 AAGGTGAAGGAGGAGAAGGCTGG - Exonic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933520660 2:83368144-83368166 ATGGGTAAAGAAGGGTAGGCCGG + Intergenic
933982951 2:87568480-87568502 AAAGGAAAAGAGGAGGGGGCAGG - Intergenic
934163788 2:89275927-89275949 GAGTGCAGAGAGGAGGAGGCAGG - Intergenic
934189312 2:89771658-89771680 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934203484 2:89906597-89906619 GAGTGCAGAGAGGAGGAGGCAGG + Intergenic
934248953 2:90330051-90330073 AAAAGTAAAGAGGAGGGGGAAGG + Intergenic
934260626 2:91473425-91473447 AAAAGTAAAGAGGAGGGGGAAGG - Intergenic
934303943 2:91805369-91805391 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
934329311 2:92047381-92047403 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934467530 2:94277302-94277324 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934652386 2:96099921-96099943 AAGGACAAAGAGGAGGGGGAGGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934738457 2:96702398-96702420 AAGGGTAGGGAAGAGGAGTCAGG + Intergenic
934855353 2:97725855-97725877 AAGTGCAAAGATCAGGAGGCAGG + Intronic
934883491 2:98004688-98004710 AAGGGAGAGGAGGAGGAGGAGGG - Intergenic
935604013 2:104951626-104951648 CAGGGCTAAGGGGAGGAGGCGGG - Intergenic
936310890 2:111382315-111382337 AAAGGAAAAGAGGAGGGGGCAGG + Intergenic
936393216 2:112095256-112095278 AAGGAGAGAGAGGGGGAGGCTGG - Intronic
937229313 2:120388319-120388341 AAGGATAATGAGGAGGAAGGAGG + Intergenic
937253875 2:120541222-120541244 AAGGACAAAGGGGAGGAGGTGGG - Intergenic
937953746 2:127407999-127408021 CAGGGGGAAGAGGAGGGGGCGGG - Intergenic
938518670 2:132042410-132042432 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
939162281 2:138604760-138604782 AAAGGCAAGGAGGAGGAGGCAGG + Intergenic
939539180 2:143472703-143472725 AATGATGAAGAGGAGGAGGAAGG + Intronic
939669606 2:144993956-144993978 AAAGATCAAGAGGAGGAAGCTGG + Intergenic
939914423 2:148021380-148021402 ACGGCCAAAGAGGAGGAGGGTGG - Intronic
939960589 2:148561795-148561817 AAGGGGCAATACGAGGAGGCTGG - Intergenic
940312571 2:152294034-152294056 TAGGGTAGAGAGGAGGAGTCAGG - Intergenic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
940775122 2:157876466-157876488 GAGGGGAGAGAGGAGGCGGCGGG + Intergenic
941152679 2:161934304-161934326 AAGGGTAATGAGGGGTGGGCAGG - Intronic
941647047 2:168051747-168051769 AAGAGTAAAGTAGAGGGGGCTGG - Intronic
941736318 2:168980923-168980945 CAGGGTAGAGAGGAGGAGACTGG - Intronic
941787595 2:169515327-169515349 AAAGGAAAAGAGGAAGAGACCGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
943333268 2:186585838-186585860 AATGGGAAAGAAGAGAAGGCAGG - Intergenic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943708323 2:191060065-191060087 TAGGGTGCAGAGGAGGAGGATGG + Intronic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
943829920 2:192447541-192447563 AATGGTAAAGGGGAGGAGCTAGG + Intergenic
944149153 2:196538857-196538879 ATTGGTAGAGAGGAGGCGGCTGG - Intronic
944215238 2:197247989-197248011 AAGGGGAATGATGAGGAGGGAGG - Intronic
944545499 2:200795322-200795344 GAGCACAAAGAGGAGGAGGCAGG + Intergenic
944727939 2:202490745-202490767 AAGGGTAAAGAGTAGGATTAGGG + Intronic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945488741 2:210429385-210429407 AAGGCTGAAGAGGAGGAGAAAGG + Intergenic
945768300 2:214007964-214007986 AGGGGTGAAGAGAAGGAGGGAGG - Intronic
945969510 2:216222037-216222059 GAGGCAAAAGAGGAGGAGTCTGG - Intergenic
946030204 2:216697622-216697644 AAGGGTAGAGAGAAGGGGGGAGG + Intergenic
946050178 2:216855798-216855820 AAGGGTCATCCGGAGGAGGCTGG + Intergenic
946080029 2:217109893-217109915 AAGGAGAATGAAGAGGAGGCTGG + Intergenic
946504100 2:220280685-220280707 AAGGGTTATGAGGAGCAGGAAGG - Intergenic
946978390 2:225178421-225178443 AAGGGAAAAGGGGATGAGGGTGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947134586 2:226964464-226964486 AAAGGTAAAGTGGAGGTGGGTGG - Intronic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
947982953 2:234425720-234425742 CAGGTGAAAGAGGAAGAGGCAGG - Intergenic
948295475 2:236857221-236857243 GAGAGGAAAGAGGAGGGGGCGGG - Intergenic
948295483 2:236857243-236857265 GAGAGTTAAGAGGAGGGGGCGGG - Intergenic
948676059 2:239597379-239597401 GAGGGTGCAGAGGTGGAGGCTGG + Intergenic
948687672 2:239679220-239679242 AATGGGAGTGAGGAGGAGGCCGG - Intergenic
1168856515 20:1012972-1012994 AGGGGTAAAGGAGAGGAAGCAGG + Intergenic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1169074119 20:2751028-2751050 AAGGGGAAGGAGGAGGAGAAGGG + Intronic
1169345237 20:4823652-4823674 AGGGGAGAAGAGGAGGGGGCAGG - Intergenic
1169532274 20:6498428-6498450 AAGGGCAAAAAGGAAGATGCTGG + Intergenic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1169801819 20:9518434-9518456 AAGGTAAACGGGGAGGAGGCTGG - Intronic
1169845613 20:9988127-9988149 AGGGGTAAGGAAGAGGAGGGTGG + Intronic
1170040838 20:12037477-12037499 AAAGGAAAGGTGGAGGAGGCAGG - Intergenic
1170348507 20:15414637-15414659 AAGGATAACCAGGAAGAGGCTGG - Intronic
1170440984 20:16378421-16378443 AAGGGGAAAGAGAGGGAGACAGG + Intronic
1170550683 20:17473519-17473541 AAGGTTAAATAGGAGGAGGTTGG - Intronic
1170606144 20:17876294-17876316 AGGGGGAAAGAAGCGGAGGCAGG + Intergenic
1170606150 20:17876314-17876336 AGGGGGAAAGAAGCGGAGGCAGG + Intergenic
1171080454 20:22177300-22177322 ATGGGAAAGGAGGAGGAGCCAGG - Intergenic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171351996 20:24510031-24510053 GAAGGAAAAGAGGAGCAGGCAGG - Intronic
1171946871 20:31386669-31386691 AAGGGAGAATAGGAAGAGGCTGG + Intronic
1172144169 20:32744478-32744500 AAGGGTAGAGGAGAGGAGGAGGG - Intergenic
1172591296 20:36119901-36119923 GAGGGTACAGAGGAGGAGGGCGG - Intronic
1172778492 20:37422037-37422059 AAGGGTGGAGAAGAGGAGGAAGG - Intergenic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173249939 20:41358970-41358992 AAGGGGAAGGAGGAGGCTGCAGG + Exonic
1173564217 20:44027739-44027761 ACAGGCAAAGATGAGGAGGCAGG + Intronic
1174109134 20:48185801-48185823 AAGGGTGCAAAGGAAGAGGCTGG - Intergenic
1174292566 20:49519490-49519512 AAGGGTGAGGAGGAGGGGCCAGG - Intronic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174667098 20:52269239-52269261 AGGGGTTAAGAGGTGGGGGCAGG + Intergenic
1174832220 20:53823394-53823416 AAGGGCCATGGGGAGGAGGCTGG + Intergenic
1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG + Intronic
1175335966 20:58196543-58196565 TAGGGAAATGGGGAGGAGGCAGG - Intergenic
1175531148 20:59674844-59674866 AAGGGGCAACAGGAGAAGGCAGG - Intronic
1175723385 20:61300855-61300877 AAGGGTGAGGAGGAGGAGGTGGG - Intronic
1175843373 20:62045328-62045350 AAGGGTAGAGAGGAGCGGGCAGG - Intronic
1175962953 20:62646270-62646292 GAGGGTGAAGGTGAGGAGGCAGG - Intronic
1176743045 21:10623740-10623762 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1177013454 21:15755862-15755884 AAGGGAGAAGTGGAGGATGCAGG + Intronic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177382458 21:20362481-20362503 AAGAGTAAATAGGAGGATACCGG + Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178291157 21:31369741-31369763 AAGGGTTAGGAGGCTGAGGCGGG + Intronic
1179292328 21:40029564-40029586 GAGGGTGGAGAGTAGGAGGCGGG + Intronic
1179556100 21:42177465-42177487 AAGGGTAAAGGAAAGGACGCAGG - Intergenic
1179564766 21:42240321-42240343 AAGAGCAAACAGGAGGAGCCAGG - Intronic
1179655017 21:42839493-42839515 AGGTGTAGAGAGGAGGGGGCAGG + Intergenic
1179681158 21:43022212-43022234 AAGGCCGAGGAGGAGGAGGCTGG - Intronic
1179799255 21:43803249-43803271 AAAGGCACAGAGGAGTAGGCAGG - Intronic
1180534277 22:16383083-16383105 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1181883399 22:25999576-25999598 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1182366249 22:29781347-29781369 AAGGGAAGAGAGTAGGAAGCTGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183077279 22:35435160-35435182 AAAAGGAATGAGGAGGAGGCTGG + Intergenic
1183162343 22:36123338-36123360 GAGGGGAATGAGGAGGAGCCGGG + Intergenic
1183328157 22:37205465-37205487 AAGGGAGAAGAGGAAGAGGAAGG - Exonic
1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG + Intergenic
1183587338 22:38760577-38760599 AAAGGGCAAGAGGAGGAGCCGGG + Intronic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
1184196807 22:42935294-42935316 AAGGGAAACAGGGAGGAGGCAGG - Intronic
1184227536 22:43137781-43137803 AAAGGTAAAGAGGAACAGGGTGG + Intronic
1184244991 22:43231335-43231357 AAGGATAATGAGGAGGGGTCTGG - Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184327465 22:43800032-43800054 AGAGGTAAAGAGGGGGAGGTGGG + Intronic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184449734 22:44575843-44575865 AGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184467324 22:44676611-44676633 CGGGGTGAAGAGGAGGAGGGGGG + Intronic
1184525263 22:45019049-45019071 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1184686503 22:46098763-46098785 AGGGGCAAGGAGCAGGAGGCCGG - Intronic
1184786331 22:46673718-46673740 CTGGGTAAAGAGGAGGACGCCGG + Exonic
1185015279 22:48339236-48339258 AAGGGGAAGGAGGAGGAGAGAGG + Intergenic
1185171544 22:49297422-49297444 AAGGGTGACGAGGGCGAGGCGGG + Intergenic
1203289589 22_KI270735v1_random:21714-21736 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203315366 22_KI270737v1_random:2713-2735 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
949113442 3:291166-291188 CAAGGTAAAGAGGAAGAGGTTGG + Intronic
949163559 3:910516-910538 AAGGGCAAAGAGGAGGTAGAAGG + Intergenic
949379749 3:3431493-3431515 AAGGTTAAAGGGGAGGAAGCAGG + Intergenic
949700130 3:6746956-6746978 AAGGCTACAGAGGAGGTGGCTGG - Intergenic
949920033 3:8993279-8993301 AAGAGAAAAAAGGAGGAGGTAGG - Intronic
949930756 3:9076709-9076731 ATGGGTTGAGAGGAGGAGGGAGG - Intronic
950107767 3:10399070-10399092 GAGGGAAAAGGGGAGGATGCTGG - Intronic
950172821 3:10851273-10851295 AAGTGGCAATAGGAGGAGGCGGG - Intronic
950442204 3:13016576-13016598 AGGAGCACAGAGGAGGAGGCTGG - Intronic
950896329 3:16454978-16455000 CATGGTGGAGAGGAGGAGGCTGG - Intronic
950958124 3:17077008-17077030 AAGAGTGGAGAGGAAGAGGCTGG - Intronic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951571669 3:24070488-24070510 AAGGGTAGAGGGTAGGAGGAGGG - Intergenic
951654529 3:24990716-24990738 AAGAGTAATAATGAGGAGGCAGG - Intergenic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952762212 3:36924679-36924701 TAGGGCAACGAGGAGGGGGCTGG - Intronic
952827354 3:37535538-37535560 TGGGGTAAAGTGGAAGAGGCTGG + Intronic
953155027 3:40361923-40361945 AAGTATAAAGAGGAGGAGTAAGG - Intergenic
953367190 3:42354850-42354872 AAGGATGAAAAGGAGGAGGTGGG - Intergenic
953578950 3:44136135-44136157 AAGGGTAAAGGGGAGGAAGCAGG - Intergenic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
953891154 3:46752527-46752549 AAGGGCAAAGGGCAAGAGGCTGG + Intronic
953989230 3:47471187-47471209 ATGAGTACAGAAGAGGAGGCAGG + Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954653347 3:52178612-52178634 AAGGACAATAAGGAGGAGGCTGG + Intergenic
955525511 3:59815732-59815754 AAGGGAAAAGAGTGGGAGGGGGG + Intronic
955536142 3:59925558-59925580 GAGGGTAAAGAATAGTAGGCAGG - Intronic
955611117 3:60758229-60758251 AAGGGTAAAGGGGAGGAAAGAGG - Intronic
955879790 3:63531094-63531116 TGTGGTGAAGAGGAGGAGGCAGG + Intronic
955892365 3:63663644-63663666 AGGGGGCAAGAGGAGGAGGGAGG - Intronic
956665412 3:71637534-71637556 AAGGAGAAAGAGGGGGAGGAGGG + Intergenic
956668220 3:71661878-71661900 AGTGGTTAAGAGGAGGAGCCTGG + Intergenic
956774030 3:72550167-72550189 AAAGGACAAGAGGAGGAGGAGGG - Intergenic
956989360 3:74745384-74745406 AAGTAGTAAGAGGAGGAGGCTGG - Intergenic
958953629 3:100442938-100442960 AAGAGAAAATAGGAGGAGGAAGG + Intronic
958963036 3:100528504-100528526 CAAGGGACAGAGGAGGAGGCAGG + Intronic
959111327 3:102126378-102126400 ATAAGTAAAGAGGAGGAGACAGG - Intronic
959114615 3:102161963-102161985 AAGAAATAAGAGGAGGAGGCAGG + Intronic
959539628 3:107524043-107524065 GAGGGGGAAGAGGAGGAGGGAGG + Intronic
959963832 3:112332291-112332313 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960405786 3:117257755-117257777 AAGGGGGAAGAGGAGGAGAACGG + Intergenic
960874529 3:122283906-122283928 CAGGGAGAAGAGGAGGAGGTAGG - Exonic
961029507 3:123589575-123589597 ATGGGAAAGTAGGAGGAGGCAGG + Intergenic
961540976 3:127599162-127599184 AAGGGCAAAGATCTGGAGGCTGG + Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
961895747 3:130166595-130166617 AAGGAGAAAGAGGAGGCTGCTGG - Intergenic
961985216 3:131124574-131124596 AAGGGAGAAGAGGAGGAGAATGG + Intronic
962201951 3:133407577-133407599 AAGAGTGGAGGGGAGGAGGCTGG + Intronic
962256578 3:133874020-133874042 TAGGCTGAAGAGGAGGAGGAAGG + Intronic
962401838 3:135067300-135067322 AAGGGCAATGAGGTGGAGGCAGG + Intronic
962600858 3:136989989-136990011 CAGGGTGAAGAGGTAGAGGCAGG + Intronic
962694750 3:137937016-137937038 AGGGGAAAAGAGGATGAGGCAGG + Intergenic
963112540 3:141699259-141699281 AGGGGTAATGAGGAGGAGGGAGG + Intergenic
963207624 3:142652566-142652588 GAGGGCACAGAGTAGGAGGCGGG + Intronic
963931179 3:151005754-151005776 AAGGGTACAGATGAAGGGGCTGG - Intergenic
964444597 3:156745446-156745468 GAAGGGAAAGAGGAGGAAGCAGG - Intergenic
964527353 3:157629749-157629771 CAGGGTGTGGAGGAGGAGGCAGG + Intronic
965524525 3:169702004-169702026 AAAGGAAAAGAGGAGGAAGAAGG - Intergenic
966001417 3:174953338-174953360 AAGGGGAAAGAGGAGGGGAGGGG - Intronic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966142177 3:176769015-176769037 AAGGAAGAAGAGGAGGAGGGAGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
967687800 3:192437856-192437878 GTGGGCAAAGAGTAGGAGGCAGG - Intronic
968181910 3:196601681-196601703 AAGGGAAAGGAGGAGGAAGCTGG - Intergenic
968744438 4:2352393-2352415 AAGGGGAGATAGGAGGAGGGAGG + Intronic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
968934382 4:3602329-3602351 AAGGATGAAGAGGAGGTGGGTGG - Intergenic
969131366 4:4993327-4993349 AGGGCTGAAGAGGAGGTGGCAGG - Intergenic
969334615 4:6500465-6500487 AAGGGTGAAGATGAGAAGACAGG + Intronic
969480840 4:7446076-7446098 AAGGGAAAAGAAGAGAAGACAGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969727780 4:8934091-8934113 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
970017189 4:11525314-11525336 CAGGGCAAAGAGGACAAGGCTGG - Intergenic
970022683 4:11586909-11586931 AAGGATACAGAGAAGGAAGCAGG + Intergenic
971366137 4:25978538-25978560 AAGTGGAAAGATGAGGAGGTAGG - Intergenic
971757216 4:30720259-30720281 AAGGGGAAAGGAGAGGAGGGAGG + Intergenic
972422728 4:38904817-38904839 AAGAGTAAAGAGGATGAGACAGG + Intronic
972452504 4:39216739-39216761 AAAGGTGATGGGGAGGAGGCAGG - Intronic
973245318 4:48004633-48004655 AAGAGAAAATAGGAGGAGGAAGG + Intronic
973529813 4:51825057-51825079 AAGGGTAGAGGGTAGGAGGTTGG - Intergenic
973882408 4:55287083-55287105 AGAGGTGAAGAGGAGGAGGAAGG + Intergenic
973994134 4:56439531-56439553 AAGGGTAAAGAACAGTGGGCCGG - Intronic
974137067 4:57832223-57832245 AATAGTAAAAAGGAGGAGGCAGG - Intergenic
974570176 4:63635629-63635651 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
974743929 4:66045108-66045130 ACAGCAAAAGAGGAGGAGGCAGG + Intergenic
975504449 4:75122849-75122871 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
975540027 4:75499764-75499786 AAGGGTAGGGAGGATGGGGCAGG + Intronic
975992729 4:80276637-80276659 AGGGGGAAAGGGGAGGGGGCTGG - Intronic
976132299 4:81897551-81897573 AAGGGGGGAGAGGAGGAGGAAGG - Intronic
976408412 4:84685252-84685274 AAAGGTAAGGTGGAGGAGGCTGG + Intronic
976836581 4:89381220-89381242 GAAGGTAAAGAGGTGGAGGGAGG - Intergenic
976851901 4:89557335-89557357 AAAGATAAGGAGGAGCAGGCAGG + Intergenic
977361907 4:96016105-96016127 AAGGGAAAAGAGGAATAAGCTGG + Intergenic
977367736 4:96093093-96093115 AAGGATAATGATGATGAGGCTGG - Intergenic
977711911 4:100135997-100136019 CATGGTAAAGGGCAGGAGGCAGG - Intergenic
978268543 4:106859006-106859028 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
979069771 4:116187133-116187155 AAGGGGAAAGAGAAGAAGGTAGG + Intergenic
979228886 4:118323507-118323529 AAAGGAAGAGAGGAGGAGGGAGG + Intronic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
979305529 4:119138689-119138711 AAGGGGAAAGGAGAGAAGGCAGG - Intronic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980998825 4:139808567-139808589 AAAGGCAAAAAGGAGGAAGCAGG + Intronic
981148512 4:141353860-141353882 ATTGGTAAAGAGGAGGATGCTGG - Intergenic
981241712 4:142484753-142484775 AAGGGTGGAGAGTAGGAGGAGGG - Intronic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
982345814 4:154357033-154357055 AAGGGAGAAGAGGAGGAGAGAGG + Intronic
982869176 4:160553952-160553974 ATGGGTACAGAGTAGGGGGCAGG + Intergenic
983001024 4:162413877-162413899 GAGAGAAAAGTGGAGGAGGCGGG + Intergenic
983580279 4:169302987-169303009 GAAGGTAAAAAAGAGGAGGCAGG + Intergenic
983759211 4:171384744-171384766 AAGGTGAAGGAGGAGGAGGGGGG - Intergenic
983795156 4:171853347-171853369 AAGGGGAAAGAAGGGGAGGAAGG - Intronic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984419111 4:179496850-179496872 AAGGAGAAAGAGGAGGAGGTGGG + Intergenic
984984234 4:185312065-185312087 AAAGCTAATGAGGAGGAGGAAGG - Intronic
985778951 5:1859716-1859738 AACGGCACAGAGGATGAGGCAGG - Intergenic
986236847 5:5918717-5918739 AAGGAAGAAGAGGAGGAGGAAGG + Intergenic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
988650521 5:33144312-33144334 AACAGTATAGAGGAGGAGGTAGG + Intergenic
988850396 5:35174737-35174759 AAGGGTAAAGTCAAGGTGGCTGG - Intronic
988922205 5:35953945-35953967 AAAGGGAGAAAGGAGGAGGCAGG + Exonic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991100702 5:62789347-62789369 AAGGGTACAAAGCAGGAGGCAGG + Intergenic
992090625 5:73312877-73312899 GAGGGGGAGGAGGAGGAGGCAGG - Intergenic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992716224 5:79513949-79513971 AAGTGTGAAGAGGCGGCGGCGGG - Exonic
992829978 5:80584651-80584673 AAGTGGGAAGAGGGGGAGGCTGG + Intergenic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
993261854 5:85667678-85667700 AAGGCTGAAGAGGAGGAGAAAGG - Intergenic
993967426 5:94374815-94374837 AAGGATTAAGAGGAGGAAGTAGG - Intronic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
996131483 5:119786933-119786955 AAGGGTAAGGAAGAGGGAGCAGG - Intergenic
996620418 5:125495114-125495136 AATGGTATAGAGGAGAAGTCTGG - Intergenic
996714854 5:126579017-126579039 AGGGCTGGAGAGGAGGAGGCAGG - Intronic
996791937 5:127302791-127302813 AAAGGAAAGGAGGAGGAAGCAGG + Intronic
996857987 5:128031351-128031373 AGGGGTGAAGATGAGGGGGCAGG - Intergenic
997769079 5:136536373-136536395 AATAGTAGAAAGGAGGAGGCAGG - Intergenic
997779825 5:136645239-136645261 AGCAGAAAAGAGGAGGAGGCTGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998294424 5:140953406-140953428 AAGGACAAAGGGGAGGAGCCAGG - Intronic
998407861 5:141883944-141883966 AAGGAAAGAGAGGAGGAGGGAGG - Intergenic
998718775 5:144917932-144917954 AAGGGTAAAGAAGAAGAAGACGG + Intergenic
998781382 5:145660419-145660441 GAGGGTTAGGAGGAGGAGCCAGG - Intronic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999316699 5:150588671-150588693 CAGGGGAGAGAAGAGGAGGCTGG + Intergenic
999768632 5:154757865-154757887 AAGGGGGAAGGGGAGGAGGGGGG - Intronic
1000569541 5:162895281-162895303 AGGCTTAAAGAGGAGGAAGCTGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001081832 5:168672920-168672942 AAGGGTGAGAAGGGGGAGGCAGG - Intronic
1001134370 5:169090226-169090248 GAGGGTGAAGGGGAGGAGGGAGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001315493 5:170638646-170638668 CCGGGTAGAGAGGAGGAGGGAGG - Intronic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1001468482 5:171990142-171990164 AAGGGGAAAGAGGAAGAGAAGGG + Intronic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1002169336 5:177366681-177366703 GAGGGGAAGGAGGGGGAGGCAGG - Intronic
1002240743 5:177837636-177837658 AGGGGTAAAGAGAATGAGACAGG - Intergenic
1002511761 5:179724747-179724769 AAGGGAGATGAGGAGGAGGAAGG + Exonic
1002512430 5:179731694-179731716 AAGGTTAAGCAGGAGGTGGCAGG - Intergenic
1002516381 5:179761979-179762001 AGAGGTAAAAAAGAGGAGGCAGG + Intronic
1002795097 6:465638-465660 AAGGAGAAAGAGGATGGGGCAGG - Intergenic
1002898302 6:1391618-1391640 AAGTGTTAAGAGGAGGGGGTGGG + Intronic
1003316937 6:5021534-5021556 AAGGGTAGTGAGAAGGAGGGAGG - Intergenic
1003465433 6:6376096-6376118 AAGGGGAAAGGGTAGGAGGTGGG + Intergenic
1003558121 6:7158551-7158573 AAGGGTATGGAGGTGGAGGCTGG - Intronic
1003773633 6:9335722-9335744 AGGGGTTGAGAGGAGGAGGGAGG - Intergenic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004365833 6:15011917-15011939 AATGGTTAAGATGAGTAGGCAGG + Intergenic
1004420784 6:15467895-15467917 AAGGGTAAAGGTGAGGAGATCGG + Intronic
1004504939 6:16239641-16239663 AGGAGTAAACACGAGGAGGCTGG + Intronic
1005847225 6:29791771-29791793 ACAGGTAAGGAGTAGGAGGCAGG + Intergenic
1005847670 6:29793746-29793768 AGGTGAGAAGAGGAGGAGGCAGG + Intergenic
1006016416 6:31084749-31084771 AAAAAAAAAGAGGAGGAGGCAGG - Intergenic
1006170466 6:32089054-32089076 CAGGTTAAAGAGGAGGACTCAGG + Intronic
1006303605 6:33206870-33206892 AAGGGAAAGGAGGGGGAGGTGGG - Intergenic
1006331200 6:33392134-33392156 AAGTGGAAAGGGGCGGAGGCAGG + Intronic
1006334833 6:33415046-33415068 AAGGGGAAAGTGGAGGAGCTGGG + Exonic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1006376931 6:33676888-33676910 AAGGGTGAGGAGGTGGAGGCAGG + Exonic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1006783476 6:36648746-36648768 AAGTGTAAAGGGGCCGAGGCGGG + Intergenic
1006935053 6:37711521-37711543 AATGGTGATGAGGGGGAGGCTGG - Intergenic
1007302461 6:40877608-40877630 AAGGTGAAGGTGGAGGAGGCAGG - Intergenic
1007309814 6:40936423-40936445 AAGGGACAGGAGGAGGTGGCTGG - Intergenic
1007694521 6:43723920-43723942 AAGGCTAATGAGGAAGAGGCTGG + Intergenic
1007756389 6:44102393-44102415 GAGGGGAGAGAGGAGAAGGCAGG - Intergenic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008535853 6:52505688-52505710 AAGGGTGAGGATGAAGAGGCGGG + Exonic
1009318375 6:62253484-62253506 AAGGCCAAAGAGGAGGAGGCAGG - Intronic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1010518270 6:76801383-76801405 TAAGGTAAAGAGGTGGAGGCCGG - Intergenic
1010772541 6:79848032-79848054 AAGGGGAAAGAAGAGCAGGAGGG + Intergenic
1012101821 6:95099067-95099089 TATGGTAATGATGAGGAGGCAGG + Intergenic
1012121192 6:95368648-95368670 AAGGGGAAAGAAGAGGAAGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013132110 6:107242901-107242923 AAGGGCTATGAGGAGGTGGCAGG + Intronic
1013569994 6:111413007-111413029 AAGGGTGAAGAGTAAGAGGGAGG - Intronic
1013851927 6:114526692-114526714 TAGTGTATAGAGGAGGAGACGGG - Intergenic
1013862449 6:114652156-114652178 AAGGAAAAAGAAGAGGAAGCAGG - Intergenic
1014802320 6:125790896-125790918 GAGGAGCAAGAGGAGGAGGCGGG - Exonic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015464290 6:133531130-133531152 AAGGGCAAAGAGAAGCCGGCTGG + Exonic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1016196965 6:141355857-141355879 TAGGGGAAAGAGTGGGAGGCAGG - Intergenic
1016362188 6:143279418-143279440 AAGTGGAAAGATTAGGAGGCTGG - Intronic
1016531715 6:145065689-145065711 CAGGGAAAAGAGGAGGAGTTTGG + Intergenic
1017030232 6:150214536-150214558 AGGGGTAAAGAGGAGAAGAAGGG - Intronic
1017200469 6:151748416-151748438 AAGAGTAAAAAGAATGAGGCAGG - Intronic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017537745 6:155366554-155366576 AAGGGCAAAGGGGACGAGGAGGG - Intergenic
1017703229 6:157096093-157096115 AAGGGTAAGGAGGAGTTTGCTGG - Intronic
1017772341 6:157652910-157652932 AAGGGGAGAGAGGAGGAAGGGGG + Intronic
1017787951 6:157772057-157772079 AAGGGCAAAGAGGAAGAGTAGGG + Intronic
1018002218 6:159589387-159589409 GTGTGTAAAGAGCAGGAGGCTGG - Intergenic
1018042165 6:159934466-159934488 AAGGGGGCAGAGGAGGAGGGAGG - Intergenic
1018205841 6:161436311-161436333 GAGGGCAGAGAGGAGGAGGCGGG + Intronic
1018676773 6:166229299-166229321 AAATGTAAAGAGGGGGAGGGAGG - Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019013335 6:168860897-168860919 GGGGGCAGAGAGGAGGAGGCAGG + Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019797591 7:3063305-3063327 GAGGAGAAAGGGGAGGAGGCTGG - Intergenic
1019880607 7:3857279-3857301 AAGGGGAAGGAGGAGGAGAAAGG + Intronic
1019943427 7:4308674-4308696 AAGGTTAAAATGGAGGAGGGTGG - Intergenic
1020080058 7:5282312-5282334 ATGGGGAAAGCGGAGGAGGGAGG + Intronic
1020164955 7:5800495-5800517 AAAGGTAAGGAGGCAGAGGCAGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021280237 7:18708135-18708157 AAGAGTGTAGAGGAGGGGGCAGG + Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021778025 7:24073093-24073115 AAGGGTGAAGAGGAGGATTCAGG - Intergenic
1022025571 7:26444716-26444738 AAGGGTAAGTAGGTGTAGGCTGG - Intergenic
1022329758 7:29366410-29366432 AAGGGTGAAGACCAGGAGGGTGG + Intronic
1022340109 7:29459885-29459907 AAGAGGAAAGAGGAGCAGGACGG + Intronic
1022545146 7:31180328-31180350 AAAGGTAAGGTGGAGGGGGCAGG - Intergenic
1022657263 7:32330950-32330972 AAGGAGACAGAGGAGGAGGGAGG - Intergenic
1022972553 7:35530911-35530933 AGGAGTAAGGAGGAGGAAGCAGG - Intergenic
1023375476 7:39551205-39551227 TAGGCTGAAGAGGAGGAAGCGGG - Intergenic
1023461316 7:40400389-40400411 AAGGCAAAGGAGGAGCAGGCAGG + Intronic
1023736744 7:43242249-43242271 AAAGGTGCAGACGAGGAGGCCGG + Intronic
1024178135 7:46861761-46861783 ATGCTTAAAGGGGAGGAGGCCGG + Intergenic
1024178141 7:46861785-46861807 GAGAGTTAAGAGGAGGAGGGTGG + Intergenic
1024255189 7:47535628-47535650 AAGGGTAGAGAGCAGGCTGCTGG + Intronic
1024646747 7:51377619-51377641 ATGGGAAGAGGGGAGGAGGCTGG - Intergenic
1024880233 7:54077003-54077025 AAGGGTGAAGAGGTGGATTCTGG + Intergenic
1024953424 7:54889449-54889471 AGGGGCAATGAGGAGGAGCCGGG - Intergenic
1025187394 7:56871591-56871613 AGGGGTAAGGAAGAAGAGGCCGG - Intergenic
1025188808 7:56881395-56881417 AGGGGTAAGGAAGAAGAGGCCGG - Intergenic
1025198743 7:56949553-56949575 AAGGGGAGGGAGGAGGAGGGGGG - Intergenic
1025307290 7:57873029-57873051 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1025683128 7:63695525-63695547 AGGGGTAAGGAAGAAGAGGCTGG + Intergenic
1025684531 7:63705329-63705351 AGGGGTAAGGAAGAAGAGGCCGG + Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1026509327 7:71015500-71015522 AGGGGAAAATGGGAGGAGGCTGG + Intergenic
1026582362 7:71629079-71629101 AAGGGTCAAGAGGAGTTGGCTGG + Intronic
1026848739 7:73712010-73712032 GAGGGTCCAGAGGAGGATGCGGG - Intronic
1027478153 7:78659623-78659645 AAGGGTAAAGGAGAGGATGCAGG + Intronic
1028477581 7:91267384-91267406 AGGGGGCAAAAGGAGGAGGCGGG - Exonic
1028655967 7:93207444-93207466 AAGGAGAAAGAGGAGTAGGGAGG + Intronic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1029127285 7:98303370-98303392 GTGGGTGAAGGGGAGGAGGCTGG - Intronic
1029187284 7:98748279-98748301 AAGGAGAAAGAGGGAGAGGCAGG + Intergenic
1029309633 7:99650706-99650728 GAAGGTAGAGAGGAGGAGGAGGG - Intronic
1029363568 7:100103344-100103366 AGGGGTAAAGAGGGGGAGTGGGG - Intronic
1029644550 7:101845546-101845568 GAGGGAATAGAGGAGGAGGCTGG + Intronic
1029980689 7:104875929-104875951 AAGGATAAAGAGGATGTGCCAGG - Intronic
1030149117 7:106385166-106385188 AAGGGTGAGGAGGAGAAGCCAGG + Intergenic
1030803658 7:113887036-113887058 AAAGGTAGAGAGGAGAAGGGAGG - Intronic
1031151677 7:118061290-118061312 AAGAGCAAAGATGAGGGGGCAGG - Intergenic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031380256 7:121077006-121077028 AAGGGCAAAGAGGAGGATACAGG - Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1031897564 7:127369000-127369022 AAGAGTAAAGGGGAGGGGGAGGG + Intronic
1032675005 7:134121806-134121828 AGAGATAAAGGGGAGGAGGCTGG - Intergenic
1033035682 7:137873894-137873916 AAGGCCACAGAGGAGGTGGCTGG + Intergenic
1033415627 7:141158957-141158979 AAGGGAAATGAGGAAGAGGTTGG + Intronic
1033454645 7:141491862-141491884 CAGGGGAGAGATGAGGAGGCAGG - Intergenic
1034291759 7:149938020-149938042 ACGGGTCGGGAGGAGGAGGCTGG - Intergenic
1034393345 7:150802033-150802055 AAGGAGAAAGAAGAAGAGGCAGG - Intronic
1034814326 7:154158878-154158900 ACGGGTCGGGAGGAGGAGGCTGG + Intronic
1035111056 7:156482189-156482211 AAGATTAAAGAAGAGTAGGCTGG + Intergenic
1035287724 7:157816860-157816882 AAGAGAAAAGAGGAGGAGAAAGG - Intronic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036084786 8:5601498-5601520 ATGGCAAAAGATGAGGAGGCTGG + Intergenic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1036387171 8:8292552-8292574 AAGGGGAAAGAGGAGCAGGCCGG - Intergenic
1036603304 8:10283585-10283607 AGGGGGAAAGAGGAGGAAGGGGG - Intronic
1037165138 8:15817973-15817995 AATGGAAAAAAGGAGGAAGCTGG + Intergenic
1037260645 8:17003036-17003058 AATTGTAAAGAGGGGGAGGGAGG - Intergenic
1037373028 8:18200534-18200556 AAGGGTAAAGGGTGGGAGGATGG + Intronic
1037833966 8:22205372-22205394 CAGGGTGCAGAGGAGCAGGCTGG + Intronic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1038395828 8:27244736-27244758 AAGTGGAAAGAGGAGGGGGCGGG + Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038972028 8:32647016-32647038 AAGGACAAAGAGGAGTAGTCGGG + Intronic
1039394956 8:37217672-37217694 AGGGGTACAGAGCAGCAGGCTGG - Intergenic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1039790338 8:40870860-40870882 CAGGCTAAAGAAGAGGATGCTGG + Intronic
1040024645 8:42770565-42770587 AAGGGTGCAGAGCAGGAGGATGG + Intronic
1040499280 8:47992827-47992849 AGGGGTAATGAGGAGGAGGGAGG + Intergenic
1040912802 8:52538102-52538124 AAGGCTAAAGAGGAGTGGGGAGG + Intronic
1041440980 8:57896754-57896776 AAAGGTAAAGAGAAGTAGCCAGG - Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1042108958 8:65358699-65358721 AAGGCCAAAGAGGAGAAGACTGG - Intergenic
1042194961 8:66223911-66223933 AAGGATAAAGGGGAGGGAGCAGG + Intergenic
1042422343 8:68606655-68606677 AATAGTAAAGATTAGGAGGCAGG - Intronic
1042536115 8:69860426-69860448 AAGGGTATAAAGGTGGAGGTGGG + Intergenic
1042579152 8:70257513-70257535 AAGGAGAAAGAGCAGCAGGCAGG + Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1043586449 8:81775487-81775509 AAGGATAGAGGGGAGGAGGAGGG - Intergenic
1044256662 8:90071405-90071427 AAGGGGGAAGAGGAGAAGGGAGG + Intronic
1045076211 8:98571379-98571401 AAGGGGAAAGAGGGGAAGGCGGG + Intronic
1045116479 8:98988351-98988373 AAGGGTTAAGTGGAGAAGGATGG + Intergenic
1045196342 8:99934841-99934863 ACGGATAAAGAAAAGGAGGCCGG + Intergenic
1045725799 8:105171692-105171714 AGGGGGAAAGAGTGGGAGGCGGG - Intronic
1045777711 8:105825247-105825269 AAAGGCAAAGAGGAGGCAGCAGG + Intergenic
1045993265 8:108334683-108334705 TAGGCTGAAGAGGAGGAGGAGGG - Intronic
1046366573 8:113239650-113239672 ATGGGTAATGAGTAGGAGGGTGG + Intronic
1046502537 8:115096988-115097010 AAAGTTCAAGAGGAGAAGGCAGG - Intergenic
1047371122 8:124256937-124256959 AAGGGGAAGGAGGATGAGTCTGG - Intergenic
1047428305 8:124766859-124766881 GAGAGCAAAGAGGAGGATGCTGG + Intergenic
1047439974 8:124869080-124869102 AAGGGCTAAGAGGAAGAGGATGG + Intergenic
1048154284 8:131929254-131929276 GAAGGTAAAGAGGAAGAGACAGG - Intronic
1048163947 8:132045553-132045575 AAGGGAAACCAGGAGAAGGCAGG - Intronic
1048201441 8:132377496-132377518 AAGGGGCAGGAGGATGAGGCTGG + Intronic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049181599 8:141225858-141225880 GAGGGCAAAGGGGAGGAGGCTGG - Intronic
1049186158 8:141255037-141255059 AAGGGAAAAGTGGGGGAGGTAGG + Intronic
1049672578 8:143876522-143876544 AAGGGAAGGGAGGAGGAAGCAGG - Intronic
1049675089 8:143885747-143885769 ATGGCTGCAGAGGAGGAGGCGGG - Intergenic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050230995 9:3525997-3526019 GAGGGAAGAGGGGAGGAGGCGGG + Intronic
1050259780 9:3829032-3829054 AATGGTAAAGATGAGGAATCAGG + Intronic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1053096983 9:35337195-35337217 AAGGGTAAAGAGGAGTGAGTGGG + Intronic
1053215769 9:36269251-36269273 AAGGGGCAAGAGGAGGAGTAGGG - Intronic
1053943951 9:43285582-43285604 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055392068 9:75833653-75833675 AAGAATAAAGTGGATGAGGCTGG - Intergenic
1055674681 9:78645035-78645057 AGGGTTAAAGAGGAGGATGGGGG - Intergenic
1056146103 9:83730895-83730917 AAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1056329438 9:85509655-85509677 AAGGATGCAGAGGTGGAGGCTGG - Intergenic
1056578473 9:87873156-87873178 AAGGGGAAGGAGGAGGAGAGAGG + Intergenic
1056773969 9:89498156-89498178 GAAGGGAAAGGGGAGGAGGCGGG - Intergenic
1057008798 9:91583708-91583730 AGGGGTATAGGTGAGGAGGCTGG - Intronic
1057078440 9:92153996-92154018 AGTGGGAAAGAGGAGGAAGCAGG - Intergenic
1057914016 9:99041696-99041718 AAGGGGATAGTGGAGGAGGCGGG + Intronic
1058535603 9:105956848-105956870 AAGAGTAAAGAGGATGTGGGAGG + Intergenic
1059025380 9:110622305-110622327 AAGGGTAAAGAAAAGAAGTCAGG - Intergenic
1059038337 9:110784865-110784887 AAGGAAGAAGAGGAGGAGGAAGG - Exonic
1059220693 9:112615123-112615145 AAAAATGAAGAGGAGGAGGCCGG + Intronic
1059325921 9:113503981-113504003 AAGGGGAAGGGGGAGGAGGCAGG - Intronic
1059327870 9:113515281-113515303 AAGGGGGAAGAAGAAGAGGCTGG - Intronic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059656170 9:116359713-116359735 AAGGGCAAAGATGTGGAGGTGGG + Intronic
1059812026 9:117865957-117865979 AAGGGTAAAGGGGAGGAAGCAGG + Intergenic
1059940366 9:119353305-119353327 AAGGATAAAGAGGAAAAGGAGGG - Intronic
1060299619 9:122367623-122367645 GTAGGTAAAGAGGAGGAGGAAGG + Intergenic
1060392976 9:123293839-123293861 AAGGGTACAGAGGATAAGGTGGG + Intergenic
1060967658 9:127720845-127720867 AAGGGGGAAGGGGAGGAGGGAGG - Intronic
1061013945 9:127971343-127971365 AATGGAAAGGAGGAGGGGGCTGG - Intronic
1061053020 9:128207140-128207162 AAGAGTAAGGAGGAGCAGACTGG + Intronic
1061232509 9:129322877-129322899 AAGGATAAAAAGGAGGGAGCGGG + Intergenic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1061729414 9:132601975-132601997 AAGAGAAAAGGGGAGGAGACAGG + Intronic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1203587086 Un_KI270747v1:14159-14181 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1185459862 X:328929-328951 AGGGGGAGAGAGGAGGAGGAGGG - Intergenic
1185499089 X:584120-584142 AGGGAGGAAGAGGAGGAGGCTGG + Intergenic
1185499114 X:584220-584242 AGGGAGGAAGAGGAGGAGGCTGG + Intergenic
1185499142 X:584320-584342 AGGGAGGAAGAGGAGGAGGCTGG + Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185603550 X:1354837-1354859 AATGGAGAGGAGGAGGAGGCGGG + Intronic
1185603604 X:1354987-1355009 GAGGGGAGAGAGGAGGAGGGAGG + Intronic
1185662081 X:1735760-1735782 AGGGAGAAAGAGGAGGAGGGAGG - Intergenic
1185750892 X:2609169-2609191 GAGGGGACAGAGGAGGGGGCGGG - Intergenic
1185754624 X:2643431-2643453 AAAGGGAAAGAGGAGGAGAAGGG + Intergenic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1186366851 X:8904537-8904559 GAAGGAAAAGAGGAGGAGGTTGG - Intergenic
1186634890 X:11392310-11392332 AATGGTACATAGGAGGAGGCTGG - Intronic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1186826579 X:13346434-13346456 CAGGATAAAGGGGAGGAAGCAGG + Intergenic
1187362979 X:18645199-18645221 AAAGGAAAAAAGGAGGTGGCGGG - Intronic
1189052927 X:37665336-37665358 AAGGGCAAAGACATGGAGGCAGG - Intronic
1189237373 X:39497657-39497679 AAGGGTCAGGAGGAGAGGGCTGG + Intergenic
1189684344 X:43548420-43548442 GGGGGTAAAGAGGAGGAGTCAGG + Intergenic
1189842398 X:45094373-45094395 ATGGGTGAAAATGAGGAGGCAGG + Intronic
1189875835 X:45434790-45434812 AAAGGTAAAGAGGGGGAGGTGGG - Intergenic
1190236072 X:48616758-48616780 AAAGGGAAGGAGGAGGAAGCAGG + Intergenic
1192510209 X:71716887-71716909 GAGGGTAAAGAGGGAGAGGAGGG + Intronic
1192516488 X:71764666-71764688 GAGGGTAAAGAGGGAGAGGAGGG - Intronic
1192767896 X:74161310-74161332 ATGCGTAAAGAGGAGGAGAGAGG - Intergenic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1193699238 X:84742551-84742573 AGGGGTAATGAGGAGGAGGGAGG - Intergenic
1193701643 X:84769904-84769926 GAGGGTAAAAAGGAGGTGGTAGG - Intergenic
1193751673 X:85353378-85353400 AAGAGTACAGATGAGGAGACTGG + Intronic
1193959773 X:87910933-87910955 AAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1194724057 X:97373933-97373955 AAGTGTAAAGATGAGGAGCGAGG + Intronic
1194770274 X:97894682-97894704 AAGGGTAGTGAGGAGCTGGCAGG - Intergenic
1194974511 X:100380108-100380130 AAGTGGAAAGAGGCTGAGGCAGG - Intronic
1195211137 X:102652861-102652883 AAAGGCAAGGAGGAGGAGACTGG + Exonic
1195217292 X:102713812-102713834 AAAGGCAAGGAGGAGGAGACTGG + Exonic
1195745024 X:108108319-108108341 ACAGGTAAATAGAAGGAGGCAGG - Intronic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196185856 X:112744185-112744207 AGGGTAGAAGAGGAGGAGGCTGG + Intergenic
1196605258 X:117650319-117650341 AAGGGTAGTGAGGAGTGGGCAGG + Intergenic
1196871857 X:120120235-120120257 AGGTGGAAGGAGGAGGAGGCAGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198313378 X:135442086-135442108 AAGGGTAATGGGGAGCAGGGAGG + Intergenic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1198843415 X:140882922-140882944 AAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1199770382 X:150971490-150971512 AAGGGTGGAGAGCAGGAGGAGGG + Intergenic
1201195071 Y:11485296-11485318 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1201864728 Y:18637687-18637709 AAGGTTAAAGAGAAGAAGGCAGG - Intergenic
1201868594 Y:18682691-18682713 AAGGTTAAAGAGAAGAAGGCAGG + Intergenic