ID: 904900914

View in Genome Browser
Species Human (GRCh38)
Location 1:33856366-33856388
Sequence CTGGGGTTCCCCAGAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904900914_904900916 -8 Left 904900914 1:33856366-33856388 CCTCTTTCTCTGGGGAACCCCAG 0: 1
1: 0
2: 3
3: 36
4: 408
Right 904900916 1:33856381-33856403 AACCCCAGCCTGGCCTCCACTGG 0: 1
1: 0
2: 3
3: 42
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904900914 Original CRISPR CTGGGGTTCCCCAGAGAAAG AGG (reversed) Intronic
900156957 1:1206990-1207012 CTGGGGAACCCCACAGAATGGGG + Intergenic
900897800 1:5495970-5495992 CAAGGGTTCCCCAGAGACAAAGG - Intergenic
901852015 1:12021853-12021875 CTTGGGAACCCCAGAGGAAGGGG + Intronic
902106877 1:14044925-14044947 CTGGTTTTCCCCAGAGTATGTGG - Intergenic
903226990 1:21899458-21899480 ATGGGGCTCCACTGAGAAAGGGG + Intronic
903289220 1:22297321-22297343 CTTGGGTTCCCAAGGAAAAGAGG - Intergenic
904206855 1:28861163-28861185 CTGGGGATCCACAGACAGAGTGG - Intronic
904350067 1:29899263-29899285 CTGGGCTTCCCCAGAGTAGAGGG + Intergenic
904379487 1:30101454-30101476 CTTTGCCTCCCCAGAGAAAGGGG + Intergenic
904900914 1:33856366-33856388 CTGGGGTTCCCCAGAGAAAGAGG - Intronic
905233426 1:36529683-36529705 CTGGGGCTCTCCAGAGACAAGGG + Intergenic
905240985 1:36581361-36581383 CTGGGGATCCCCAAAGACAGAGG - Intergenic
905475486 1:38224225-38224247 TTAGGGTTCTCCAGAGAAACAGG + Intergenic
905699983 1:40004985-40005007 GGGGTGTTCTCCAGAGAAAGAGG - Intergenic
905732004 1:40304090-40304112 CTGGGGAGCCCTGGAGAAAGCGG + Exonic
906019507 1:42615013-42615035 CTGGGTTGCAGCAGAGAAAGAGG + Intronic
906032787 1:42734315-42734337 CTGGGGCTGCCCAGAGACTGTGG - Exonic
906254607 1:44338510-44338532 CTGGCTTCCCCCAGAGCAAGTGG + Intronic
906269150 1:44460719-44460741 CCTGGGTTCCCCAGCTAAAGAGG + Intronic
906990370 1:50731028-50731050 CTGGGCTTTCCCAGAGATACTGG + Intronic
908168494 1:61482170-61482192 CTGGGTTGCAGCAGAGAAAGAGG + Intergenic
909459341 1:75892441-75892463 TTAGGGTTCTCCAGAGAAAGAGG - Intronic
910090734 1:83460695-83460717 CTGGTGTTCCCCAGAAACATAGG + Intergenic
910763686 1:90759652-90759674 CTGGGGCTCCACTGAGAAGGAGG + Intergenic
911861783 1:102960615-102960637 CTGGAGTTTCCTGGAGAAAGGGG + Intronic
912980814 1:114369937-114369959 CTGGGGTTCCCTAAAGAAAATGG + Intergenic
913158848 1:116127611-116127633 CTGGCCTTCCCAAGAGAGAGTGG + Exonic
914050735 1:144128078-144128100 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
914128446 1:144837366-144837388 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
914422462 1:147541837-147541859 CTGGGGTTCCCTCGAAAGAGGGG - Intronic
914806841 1:150997962-150997984 CTGAGGTAACCCAGAGAGAGAGG + Intronic
914881010 1:151547218-151547240 CTGGGCTTTGCCAGAGAAGGAGG + Intronic
915443159 1:155959185-155959207 ATAAGGTTCCCCAGAGCAAGAGG + Intronic
916624473 1:166540181-166540203 CTGGGGTTCCTTAAAGAAAATGG - Intergenic
919847278 1:201649907-201649929 CTCGGGATCCACAGAGGAAGTGG - Intronic
920361184 1:205417585-205417607 CGGGGGTGCCTCAGGGAAAGTGG - Intronic
920615457 1:207488076-207488098 CTGAGTTTCCCATGAGAAAGTGG + Intronic
921406140 1:214781475-214781497 CTGGGTTGCAGCAGAGAAAGAGG + Intergenic
922876186 1:228941508-228941530 CTGGGTTGCAGCAGAGAAAGAGG - Intergenic
923034122 1:230272285-230272307 GTGGCCTTCCCCAGAGAAGGTGG + Intronic
1063584083 10:7335122-7335144 CGGTGGTTGCCCAGAGAAGGGGG + Intronic
1065291529 10:24235075-24235097 CTGAGGTCCCCCAAAGAAAAAGG - Intronic
1066201015 10:33142672-33142694 CTTGAGTTCCCCATAGAAAATGG + Intergenic
1066761209 10:38755223-38755245 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
1066960384 10:42217199-42217221 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
1068812213 10:61269020-61269042 CTGGGTTGCAGCAGAGAAAGAGG + Intergenic
1069606906 10:69744459-69744481 CTTGGATTCCCCAGGGAAGGAGG - Intergenic
1069630707 10:69895477-69895499 CTGGGGGTGCCCTGAGAAACAGG + Intronic
1069685512 10:70315865-70315887 CTGGGTTGCAGCAGAGAAAGAGG - Intronic
1070160716 10:73865302-73865324 CAGGGGCTCCTCAGAGAGAGGGG + Intronic
1070320946 10:75354133-75354155 CTGGGCTTCCCAAGGGAGAGTGG - Intergenic
1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG + Intergenic
1073472492 10:103731571-103731593 CTGGGTTCCCCCAGAGAACCAGG + Intronic
1074382951 10:112995141-112995163 CAGGGGTTCCCCTGAGGAGGAGG - Intronic
1074858216 10:117489186-117489208 CTGGCTTTCCCCAGGGGAAGAGG + Intergenic
1075077742 10:119362314-119362336 CTGGGGTTCCCCAAAGGCACAGG - Intronic
1076131305 10:128015900-128015922 CTGCGGTGCCCATGAGAAAGCGG + Intronic
1076290492 10:129342193-129342215 CTGGTGCTCCCTAGAAAAAGAGG + Intergenic
1076921759 10:133458004-133458026 CTGCGGTACCCCAGAGAGGGTGG + Intergenic
1076984616 11:226347-226369 CTGGGGTTCCCTTGACCAAGGGG + Intronic
1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG + Intronic
1077440606 11:2567027-2567049 CAGGGGTGCCCCAGGGAATGGGG + Intronic
1077497685 11:2894322-2894344 CTGGGGTAACCCAGGGAAGGGGG - Intronic
1077534225 11:3112321-3112343 CTGGGGTTCCTTAAAGAAAATGG + Intronic
1078793656 11:14570076-14570098 CTGGTGATACCCAGACAAAGAGG + Intronic
1079099845 11:17534281-17534303 CTTGGGATACCCACAGAAAGAGG - Intronic
1079392409 11:20034025-20034047 CTGGCGTCCTCCTGAGAAAGTGG + Intronic
1079921287 11:26436964-26436986 CTTGGATTCCCCAGAGCCAGAGG + Intronic
1081236993 11:40658449-40658471 CTGGGTTTCAGTAGAGAAAGGGG + Intronic
1081975706 11:47233381-47233403 CTGGACTTCCCAAGAGAAAGTGG + Intronic
1084290886 11:68166182-68166204 CTGGTGTTACCCAGAAAAACAGG + Intronic
1084319876 11:68367323-68367345 CTGGGGTTGCCCACAGCAGGTGG + Intronic
1085350771 11:75796759-75796781 CTGGGGGTCCCCAGAAAAGGGGG - Intronic
1085441760 11:76570638-76570660 TCGGGGTTCTCCAGAGAAACCGG - Intergenic
1085503058 11:77040010-77040032 CCGGGGTGCCCAATAGAAAGAGG - Exonic
1085573283 11:77578532-77578554 CTGGGGTTCCTTTAAGAAAGTGG + Intronic
1086755014 11:90549900-90549922 ATGGGTTTCCCAATAGAAAGAGG - Intergenic
1086850642 11:91803278-91803300 TTGTGTTTCTCCAGAGAAAGTGG + Intergenic
1087328919 11:96755480-96755502 CTGGGGGCTCCCAGAGGAAGGGG - Intergenic
1088034528 11:105296037-105296059 CTGGGGATACCCAGGGAAAGGGG - Intergenic
1089679465 11:120111236-120111258 CTGAGGGTCCCCAGAGGAACAGG - Intergenic
1089860624 11:121587177-121587199 TTGGGGTTCTCCAGAGGAATAGG + Intronic
1090255460 11:125280718-125280740 GTGGAGTTCCCCCAAGAAAGAGG + Intronic
1090352400 11:126115746-126115768 CGGGGGTCCCTGAGAGAAAGTGG - Intergenic
1090595098 11:128312194-128312216 CTTGTATTCACCAGAGAAAGGGG + Intergenic
1091060655 11:132458315-132458337 CTGTGGTTGGCCAGAGGAAGTGG - Intronic
1091750474 12:3018839-3018861 CTGGGGTCCCCCAGGGGAGGAGG + Intronic
1091760113 12:3081552-3081574 CCGGGGTTCCCAGGAAAAAGAGG - Intronic
1091794860 12:3292233-3292255 CAGGGGATCCCCAGACAGAGGGG - Intergenic
1091973066 12:4804370-4804392 CAGAGGTTACACAGAGAAAGAGG + Intronic
1091995916 12:4993993-4994015 CTGGGGTCCCCTAGAGAAGCTGG - Intergenic
1092556901 12:9569307-9569329 ATGGGGTTCCCAAGAGCCAGTGG + Intergenic
1092556951 12:9569464-9569486 ATGGGGTTCCCAAGAGCCAGGGG + Intergenic
1092755669 12:11761044-11761066 CCGAGGTCACCCAGAGAAAGTGG + Intronic
1094514790 12:31120163-31120185 ATGGGGTTCCCAAGAGCCAGTGG - Intergenic
1095963691 12:47852079-47852101 CTGGGGTTCCTTAGTGAAGGGGG + Intronic
1096628151 12:52907649-52907671 CTGGGCTGCCCCAGAAAAAAAGG - Intronic
1097009873 12:55945300-55945322 CTGAGATTACCCAGAGAAAGAGG + Intronic
1097785578 12:63755265-63755287 CTGGGGTTGTCCAGAGCATGGGG + Intergenic
1098813290 12:75123745-75123767 CTGGGGTTCCTAAGAGAATCAGG - Intronic
1101398469 12:104368251-104368273 GCAGGGTTCCCCAGAGAAACAGG - Intergenic
1102509336 12:113403692-113403714 CTGTGGTTTCCCAGGGGAAGAGG - Intronic
1104179018 12:126360186-126360208 CTGGGGTTCACCTGAGAACATGG + Intergenic
1104760513 12:131295248-131295270 CTGGGGGTCCCCAGTCACAGTGG + Intergenic
1104819262 12:131665537-131665559 CTGGGGGTCCCCAGTCACAGTGG - Intergenic
1104970347 12:132528098-132528120 CTGGGGCTCCAGAGGGAAAGCGG - Intronic
1109842120 13:67932439-67932461 TTTGGATTCCCCAGAGAAAAAGG - Intergenic
1110419286 13:75287295-75287317 CTGGTGTTCCCCTGAGTGAGTGG + Intronic
1111318595 13:86593979-86594001 TTGAGGTTTCCCAGAGAAGGGGG + Intergenic
1112572635 13:100607697-100607719 CTGTGGTACCCCTGAGAAATTGG + Intronic
1113031752 13:106000875-106000897 GCAGGGTTCTCCAGAGAAAGAGG + Intergenic
1113294182 13:108939329-108939351 CTGGGGTCCCCGGGGGAAAGGGG + Intronic
1114222227 14:20706865-20706887 CTGGGTTGCAGCAGAGAAAGAGG + Intergenic
1114510200 14:23252514-23252536 CTGGGTTGCAGCAGAGAAAGGGG + Intronic
1114521028 14:23336147-23336169 CAGGGGTTCTCTGGAGAAAGGGG - Intergenic
1114723527 14:24909256-24909278 CTGGAGTGCCCCTGTGAAAGGGG - Intronic
1114850165 14:26373885-26373907 CTGAGCCTCCCCAGAAAAAGAGG + Intergenic
1115410799 14:33072539-33072561 CCTGGGTTCCCTAGGGAAAGAGG - Intronic
1115640442 14:35332392-35332414 CTGGGGTTTTCCAGGGATAGAGG + Intergenic
1117465348 14:55987885-55987907 CTGGGGTTGCCCAGAGGCAGAGG + Intergenic
1119014817 14:71039464-71039486 CTGGTTTCCCCCAGAGCAAGTGG + Intronic
1120902386 14:89587158-89587180 CCGGGGTTCCCCCGAAAAAGAGG - Intronic
1120972099 14:90216040-90216062 CTGGGGTTCCTTTAAGAAAGGGG - Intergenic
1120978751 14:90272958-90272980 CTGGTGTTCCCAAGAGACTGAGG + Exonic
1121523501 14:94602387-94602409 CTGGCCTTCCACAGAGAAGGTGG + Intronic
1122036571 14:98953552-98953574 TTGGTGTGCCCAAGAGAAAGTGG - Intergenic
1122820815 14:104343932-104343954 CTGGGGGTCCCCAGGAGAAGGGG - Intergenic
1123420606 15:20127404-20127426 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
1123445256 15:20326123-20326145 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
1123529830 15:21133933-21133955 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
1123786999 15:23684285-23684307 AGGGGGTTCTGCAGAGAAAGGGG - Intergenic
1126708201 15:51427359-51427381 CTGGGGTTCCTTAAAGAAAATGG - Intergenic
1127793087 15:62415638-62415660 CTGGGGTGACCCAAAGGAAGAGG + Intronic
1127854925 15:62946435-62946457 CTGGGTTGGCCCAGAGAAAGAGG - Intergenic
1128260294 15:66228422-66228444 CTATGGAGCCCCAGAGAAAGAGG + Intronic
1129009059 15:72398367-72398389 CTGAGGTTCCCAAAATAAAGGGG + Exonic
1129515049 15:76152208-76152230 CTGGGGTTACCAAGAGGAGGGGG + Intronic
1130377322 15:83340825-83340847 TTAGGGTTCTCCAGAGAAATGGG - Intergenic
1130667203 15:85879774-85879796 CTGGAGGTCCCCAGACAAATAGG - Intergenic
1131681412 15:94727661-94727683 CAGAGATACCCCAGAGAAAGAGG + Intergenic
1132946693 16:2535669-2535691 CTGGCTTTCCCCAGAGCGAGTGG - Intergenic
1132969007 16:2675945-2675967 CTGGCTTTCCCCAGAGCGAGTGG + Intergenic
1133498088 16:6339367-6339389 CTGGGTTACAGCAGAGAAAGTGG + Intronic
1134644768 16:15857294-15857316 CTCCGGATCCCTAGAGAAAGGGG + Intergenic
1134827063 16:17293370-17293392 CTGAAGTTCCCCAGGGACAGTGG + Intronic
1134855357 16:17514280-17514302 CTGGGTTGCCGCAGAGAAAGAGG + Intergenic
1135984738 16:27175823-27175845 CTGGGCTTCCACAGAAGAAGAGG - Intergenic
1136395676 16:29991362-29991384 CTGGGGCCCCCCACACAAAGTGG + Intronic
1136721506 16:32322490-32322512 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
1136839886 16:33528778-33528800 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
1137607679 16:49797370-49797392 CTGTGAATGCCCAGAGAAAGGGG + Intronic
1139921214 16:70461648-70461670 TGGGGGTTCCCCGGAGAAGGGGG - Intronic
1141441838 16:84034191-84034213 CTGGGGGACCCCAGAGACTGAGG + Intronic
1142401642 16:89861845-89861867 CTGGCGTCCCCCAGAGCACGTGG + Intronic
1203004926 16_KI270728v1_random:195280-195302 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
1203093257 16_KI270728v1_random:1229910-1229932 CTGGGCTTCCCCCGAGCAGGTGG + Intergenic
1203136476 16_KI270728v1_random:1731399-1731421 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
1203150054 16_KI270728v1_random:1829063-1829085 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
1143287256 17:5799539-5799561 CTGGGGTCCCCCTCAGAGAGTGG - Intronic
1143571819 17:7764039-7764061 CTGGGGCGCCCCACAGGAAGGGG + Intronic
1143684779 17:8504957-8504979 CTGGGGCTCGCCTGAGAAACAGG - Intronic
1143757790 17:9079564-9079586 AAGTGGTTCCCCAGAGGAAGTGG + Intronic
1144833234 17:18143381-18143403 CTGAGGTTGGCCAGAGAAAAGGG - Intronic
1146649734 17:34599199-34599221 GGGGGGTTCCCCACAGCAAGAGG + Intronic
1148553093 17:48562414-48562436 CTGTGCTTCCCCATAGAAATAGG + Intronic
1148627572 17:49081392-49081414 CTGGGCTACAGCAGAGAAAGAGG - Intergenic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148839527 17:50485842-50485864 GTGGAGTTGACCAGAGAAAGGGG + Exonic
1148993406 17:51685959-51685981 CTGGGGTGCCCCAGGGATTGGGG + Intronic
1149053688 17:52336973-52336995 CTGGAGTGCCCCAGACACAGAGG + Intergenic
1149380900 17:56092867-56092889 CTGGAGGTCCCCAGGGAGAGTGG - Intergenic
1149700767 17:58653669-58653691 CTGGGTTGCAGCAGAGAAAGAGG - Intronic
1151239760 17:72748717-72748739 CTGTGTTTCCTCAGAGAAAAAGG + Intronic
1151495348 17:74455018-74455040 CTGAGGTTCCCAAGAGAAGCTGG + Intergenic
1151665401 17:75542712-75542734 CTGGGGCTAGCCAGAGAGAGGGG + Intronic
1151784024 17:76266255-76266277 CTGGGGGACCCCAGAGCCAGGGG + Intronic
1152029632 17:77834102-77834124 CTGGGATTCCCCAGACAGCGAGG - Intergenic
1152588077 17:81197937-81197959 CTTGGGTTCCCCAAAGGCAGAGG + Intronic
1152927027 17:83092102-83092124 CTGGCCTCCCCCAGAGAATGCGG - Intronic
1153103279 18:1498511-1498533 CTGAGGTTCCCCAAAGAAAAAGG - Intergenic
1153555725 18:6311233-6311255 TTAGGGTTCTCCAGAGAAACAGG - Intronic
1153610625 18:6880633-6880655 CTGGAGTTCCCCAGACACACTGG + Intronic
1154139392 18:11810043-11810065 CTGAGGTTCCCCAGAGCTAGGGG + Intronic
1155040982 18:22065605-22065627 CCTGGGTCCACCAGAGAAAGAGG + Intergenic
1155495550 18:26438494-26438516 CTGAGATTTCCCGGAGAAAGTGG + Intergenic
1157023250 18:43812389-43812411 CTGGGTTGCAACAGAGAAAGAGG - Intergenic
1157644962 18:49258941-49258963 CTGGGCTGCCCCAAAGAAAGAGG + Intronic
1158048913 18:53191859-53191881 GTGGGGTTGGCTAGAGAAAGGGG + Intronic
1158606243 18:58898802-58898824 CTGGGGTACCAGAGAAAAAGTGG - Intronic
1160558701 18:79742443-79742465 CAGGGTTTTCCCAGACAAAGTGG + Intronic
1161810313 19:6467667-6467689 CTGGGGTCCTCCAGAGAACTGGG + Exonic
1162525108 19:11202295-11202317 TTGGGGTTTCCCAGAGAAAGAGG + Intronic
1163481732 19:17560506-17560528 CTGGGTATCCCCAGGGAAGGCGG + Intronic
1165272793 19:34724892-34724914 CTGGGGTTTTTCAGAGAAGGGGG - Intergenic
1166163624 19:40970779-40970801 CTGGTGATCCCCAGGCAAAGAGG - Intergenic
1166219237 19:41354196-41354218 GTGTGGGTCACCAGAGAAAGAGG + Intronic
1166304477 19:41929683-41929705 CTGCCTTTCCCCAGAGAAGGTGG - Intronic
1167005965 19:46776921-46776943 CAGGGGTACCCCTGGGAAAGAGG - Intronic
1167273058 19:48517268-48517290 CGGGGAGTCCCCAGAGAACGCGG - Intergenic
1167776925 19:51564568-51564590 CTGGGGGTCCCCAAGGAAATTGG + Intergenic
1168294092 19:55370324-55370346 CAGGGGTTCCCCAGGGCAGGGGG + Exonic
1202690143 1_KI270712v1_random:80717-80739 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
925185359 2:1843034-1843056 CTCGGGTCCCCCTGAGGAAGCGG - Intronic
926202789 2:10813350-10813372 CTGGGGTTCTCCAGAGAAGGAGG - Intronic
926794174 2:16605428-16605450 CTTGATTTCCCAAGAGAAAGGGG - Intronic
927308334 2:21599434-21599456 CTGGGAAACCCCAGGGAAAGTGG + Intergenic
927846643 2:26475766-26475788 CAGGGCTTCCCCTGAGAAACCGG + Intronic
927963838 2:27257239-27257261 CTGGTGTTCCCCAGGGGCAGGGG + Exonic
928042225 2:27890313-27890335 CTGGGGAACCCCAGAGGCAGTGG - Exonic
928218455 2:29382137-29382159 CTCTGATTCCCTAGAGAAAGTGG - Intronic
929511278 2:42568205-42568227 GGGGGGTTCCCCAGGGACAGAGG + Intronic
930172804 2:48268528-48268550 CTGGGGTTCAAGAGAGAAAGTGG - Intergenic
933599201 2:84312665-84312687 CTGGGATTCACCCTAGAAAGAGG + Intergenic
933956270 2:87375296-87375318 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
934240420 2:90267320-90267342 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
934272770 2:91549427-91549449 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
934324513 2:91999900-91999922 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
934462890 2:94230599-94230621 CTGGTGATCCCCCGAGAGAGCGG + Intergenic
934732670 2:96669337-96669359 CTGGGCTTTCCCTGAGGAAGGGG + Intergenic
934774514 2:96928641-96928663 CTGGGTTTCACCAGAGAGTGGGG + Intronic
936148837 2:109999349-109999371 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
936195843 2:110372019-110372041 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
936429774 2:112452234-112452256 CTGGCTTCCCCCAGAGCAAGTGG + Intergenic
936477389 2:112851233-112851255 CTGGGGTTCCTTAAAGAAAATGG + Intergenic
940103450 2:150069879-150069901 CTGAGGTTCCCCAGTGAAAATGG - Intergenic
940176168 2:150879771-150879793 CTGGGTTGCACCAGAGAAAGAGG - Intergenic
944051893 2:195479166-195479188 CTGGGTATCACCATAGAAAGTGG - Intergenic
945412569 2:209529004-209529026 TTGGTCTTCCCCAGAGAAAAAGG - Intronic
946537685 2:220648896-220648918 CTGGGGTTTACCAGAGGATGGGG - Intergenic
946762571 2:223009440-223009462 TCAGGGTTCGCCAGAGAAAGAGG + Intergenic
947079583 2:226381188-226381210 CTGGGGTTCTCCAGAGAGGAAGG - Intergenic
947247074 2:228060794-228060816 GAGGCATTCCCCAGAGAAAGGGG + Intronic
948363286 2:237437644-237437666 CTGGGGCTGCCCACAGAAATGGG - Intergenic
948676144 2:239597908-239597930 CCAGGGTTCCCGAGAGAAACGGG + Intergenic
1168790381 20:572191-572213 CTGGGCCTCCCTGGAGAAAGAGG + Intergenic
1169011252 20:2252790-2252812 CTGGGTTGCAGCAGAGAAAGAGG + Intergenic
1169302287 20:4454333-4454355 CTGAGGTTTCCCTGAGAAAAAGG - Intergenic
1169343729 20:4814409-4814431 CTGGGGTTCCCTTGAGGAAGGGG - Intronic
1170098172 20:12669825-12669847 CTGGAGTTCCCCAGAAAGATAGG + Intergenic
1171373534 20:24676573-24676595 CAGGGCTGCCCCAGGGAAAGCGG - Intergenic
1172765829 20:37350206-37350228 CTGAGGCTCCCCAGAGGAAGTGG - Intronic
1172781796 20:37440950-37440972 CTGGTTTTCCCCAGAGGAAATGG - Intergenic
1173822229 20:46026840-46026862 GATGGGTTCCCCAGGGAAAGAGG + Intronic
1174121906 20:48272083-48272105 TTGCGTTTCCCAAGAGAAAGGGG - Intergenic
1174415509 20:50363673-50363695 CCGGGGTACCCCACATAAAGGGG - Intergenic
1174520776 20:51128943-51128965 GTGCAGTTCCCCTGAGAAAGGGG + Intergenic
1174555926 20:51395360-51395382 CTGGGATCCCCAAAAGAAAGAGG - Intronic
1174768578 20:53276433-53276455 CTGGTGATCCCCAGCAAAAGTGG - Intronic
1175417438 20:58811096-58811118 CTGGGTCTTCCCAGAGGAAGTGG - Intergenic
1175904292 20:62372032-62372054 CTGGGGCTCCCCAGAGATCTGGG - Intergenic
1175960137 20:62631709-62631731 CAGGGGTTCCCGAGACACAGTGG + Intergenic
1176087976 20:63306707-63306729 CTGGGCTTCCCCATAGAACTGGG + Intronic
1176104881 20:63381250-63381272 CACGGGTTCCCCAGAGCTAGGGG + Intergenic
1177700286 21:24631148-24631170 CTGGGGCTTCCCCAAGAAAGAGG - Intergenic
1177972282 21:27805418-27805440 CCAGGGTTCTCCAGAGAAACAGG + Intergenic
1178025995 21:28467766-28467788 TTAGGGTTCTCCAGAGAAACAGG - Intergenic
1178188401 21:30251573-30251595 CTGGGGTCCCCTGAAGAAAGAGG - Intergenic
1178669089 21:34575147-34575169 CTGGGGTTTCTCAGAGGATGTGG + Intronic
1179599243 21:42465025-42465047 CTGGGCTGCAGCAGAGAAAGAGG + Intergenic
1179924561 21:44527240-44527262 CGGGGCTTTCCAAGAGAAAGGGG + Intronic
1179927774 21:44547445-44547467 CTGGTTTTCACCAGACAAAGTGG - Intronic
1180551279 22:16543839-16543861 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
1180584018 22:16869686-16869708 CTGGTGATCCCCTGAGAGAGTGG + Intergenic
1180592790 22:16955371-16955393 CTGGGGAACCACGGAGAAAGGGG + Intergenic
1180767466 22:18353774-18353796 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1180778840 22:18508608-18508630 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1180811562 22:18765929-18765951 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181197715 22:21200177-21200199 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181282644 22:21730812-21730834 CTTGGGTTCCCCAGAGAGCAGGG - Intronic
1181352729 22:22270089-22270111 CTGGTGATCCCCCGAGAGAGTGG - Intergenic
1181395860 22:22621109-22621131 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181647518 22:24241459-24241481 CTGAGGTTTCCCAGAGAAGCAGG - Intronic
1181703986 22:24636724-24636746 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181805545 22:25372542-25372564 CTGGGGTTGCCCATAGCAGGTGG - Intronic
1182023710 22:27101255-27101277 TTGGGGGACCTCAGAGAAAGTGG + Intergenic
1182165959 22:28173306-28173328 CTGTGATTCCCCATAGATAGTGG - Intronic
1182964871 22:34511440-34511462 CTGGGGATACCCAGGGAGAGTGG - Intergenic
1183338880 22:37267146-37267168 CTGGGGCTCCCCTGTGAACGAGG - Intergenic
1183438656 22:37810136-37810158 CCTGGGTTCCACAGATAAAGCGG - Exonic
1184454366 22:44600823-44600845 CTGGGGGTCCCTGGAGAGAGTGG - Intergenic
1184692445 22:46123455-46123477 GTGGTGTCCCCCAGAGACAGGGG + Intergenic
1203229088 22_KI270731v1_random:94658-94680 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
949208246 3:1466597-1466619 CTGGGGTTTTCCAGAGTAAGTGG + Intergenic
950918862 3:16672364-16672386 CTGGGGTTCCTTAAAGAAAATGG + Intergenic
952543856 3:34397177-34397199 CTGGGGTGAGACAGAGAAAGAGG + Intergenic
952790592 3:37197459-37197481 CTTGGGTTCCCCAAAGGCAGAGG - Intergenic
953045194 3:39288681-39288703 CTGCATTTCCCCAGAGGAAGTGG + Intergenic
953963168 3:47282386-47282408 CTGGGAACCCCCAGATAAAGCGG + Intronic
954422783 3:50427338-50427360 CTGGGGGTCCCCAGGGATGGGGG - Intronic
954757711 3:52850647-52850669 CTCGGGTTTCGCAGACAAAGAGG + Intronic
954868641 3:53750450-53750472 CTAGGCTTCCTCAGAGGAAGTGG + Intronic
955407845 3:58636533-58636555 CTGGGGGTGTCCAGAGAACGTGG + Intronic
955439842 3:58943410-58943432 CTGGTGATACCCAGGGAAAGAGG + Intronic
957440119 3:80234666-80234688 ATGACTTTCCCCAGAGAAAGTGG - Intergenic
959063367 3:101635155-101635177 CTGGGGCTCTTCAGAGAAGGGGG - Intergenic
959580635 3:107979201-107979223 CTCAGGCTCCCCAGAGATAGAGG + Intergenic
960381341 3:116966326-116966348 ATGGGGGTCAGCAGAGAAAGTGG - Intronic
961432140 3:126890869-126890891 CTGGGGTTCCCCAGGGAGTGGGG + Intronic
961457972 3:127033574-127033596 CTGGGGCTCACCAGGGAAAGGGG + Intronic
963043102 3:141083459-141083481 CTGGCCCTGCCCAGAGAAAGGGG - Intronic
965631057 3:170733256-170733278 CTGGACTACCTCAGAGAAAGTGG - Intronic
966179453 3:177174565-177174587 CTCCTGTTCCCCAGAAAAAGAGG + Intronic
966946256 3:184779111-184779133 CTGGGGTTCCCCGCAGAAGCGGG + Intergenic
967175053 3:186855248-186855270 CAGAGCTTCCTCAGAGAAAGTGG + Exonic
967994336 3:195155226-195155248 CTGTGTTTCCCCTCAGAAAGAGG - Intronic
968043104 3:195604605-195604627 CTGGGGTTCCTTAAAGAAAATGG + Intergenic
968269666 3:197393775-197393797 CTGGGGTTCAGCAGAGAGACAGG + Intergenic
968579406 4:1383002-1383024 GTGGGGTTCCCCACACAAGGCGG - Intronic
968641096 4:1715446-1715468 CTGGGGTTCCCCACAGCACTGGG - Intergenic
968871781 4:3246133-3246155 CTGGACTTCCCCAGAGCAATTGG - Intronic
969686307 4:8676285-8676307 CTGTTGTTCCACAGAGAAGGAGG - Intergenic
969788027 4:9474006-9474028 ATGGGGTTCCCAAGAGTCAGGGG - Intergenic
969906847 4:10405206-10405228 TTAGGGTTCCCGAGAGAAACAGG - Intergenic
971872196 4:32256923-32256945 CTGGAGTTCTTCAGAGAAAGAGG - Intergenic
971938612 4:33187192-33187214 CTCTGATTCCCCAGAGGAAGTGG + Intergenic
972127103 4:35782282-35782304 TTAGGGTTCTCCAGAGGAAGAGG + Intergenic
973112643 4:46414385-46414407 CTGGGTTGCAGCAGAGAAAGAGG + Intronic
974328479 4:60445647-60445669 TTAGGTTTCTCCAGAGAAAGAGG + Intergenic
974913353 4:68149373-68149395 ATGGAGTTCCCCAGGAAAAGGGG - Intergenic
975781785 4:77848031-77848053 CTGGGTTGCAGCAGAGAAAGTGG - Intergenic
978357232 4:107890249-107890271 CTGGGGTTCCTTAAAGAAAATGG - Intronic
980766260 4:137309641-137309663 CTGAGGTTTCCCAGAGAACACGG + Intergenic
981768187 4:148275820-148275842 CTGGAGTTCCCAAGAGTCAGGGG + Intronic
982385646 4:154798819-154798841 TTGGGCTGACCCAGAGAAAGAGG + Exonic
984170775 4:176356934-176356956 CTGGGGTTCCTTAAAGAAAATGG - Intergenic
984232734 4:177118790-177118812 CTTTGGTTGCCCAGAGACAGGGG - Intergenic
986008131 5:3684947-3684969 CCTGGGCTCCCCAGAGACAGAGG - Intergenic
986020097 5:3793806-3793828 CTGGGGTTCCCCAGAGTGGAAGG - Intergenic
987046651 5:14115312-14115334 CTGGGCTACAGCAGAGAAAGAGG + Intergenic
987082997 5:14442362-14442384 CAGGGATCCCCCAAAGAAAGGGG + Intronic
987744060 5:21947845-21947867 CTGAGGTTGCCCAGAGCAACGGG - Intronic
987765636 5:22225765-22225787 CTGGGATTGCCCAGAGAAAAAGG - Intronic
988363527 5:30266483-30266505 CTGAGGTTCCCCAGGGAAAAAGG - Intergenic
990954327 5:61328854-61328876 GTGGGTTTTCCCAGAGGAAGTGG + Intergenic
991654230 5:68887041-68887063 ATGGAATTCCCCATAGAAAGGGG - Intergenic
991764264 5:69957982-69958004 CTGAGGTTGCCCAGAGTAACGGG - Intergenic
991783063 5:70160165-70160187 CTGAGGTTGCCCAGAGCAACGGG + Intergenic
991843496 5:70833054-70833076 CTGAGGTTGCCCAGAGTAACGGG - Intergenic
991875505 5:71160492-71160514 CTGAGGTTGCCCAGAGCAACGGG + Intergenic
994505889 5:100642249-100642271 CTCAGGTTCCACAGAGGAAGAGG - Intergenic
996163132 5:120191874-120191896 CTGAGGTTCCTCAGAGGAAAAGG + Intergenic
996487467 5:124053733-124053755 CTGAGGCTTCCCAGAGAAAAAGG + Intergenic
998142803 5:139709599-139709621 CTGGGGGTCGCCAGAGGTAGCGG + Intergenic
998227544 5:140338665-140338687 CCTGGCTTCCCCAGAGAAGGAGG + Intronic
999277802 5:150343399-150343421 CTGGGGATCCCAAGTGAAAAAGG - Intergenic
1000107559 5:158074769-158074791 ATGGGGTCCCCCAGACAAAGAGG - Intergenic
1000639490 5:163684854-163684876 CCAGGGTTCTCCAGAGAAACAGG + Intergenic
1000813124 5:165887380-165887402 CTAGGGTTTCCCAGAGAAGGAGG + Intergenic
1000924311 5:167175522-167175544 GTGGGGTACGACAGAGAAAGGGG - Intergenic
1001604622 5:172951032-172951054 TTGGGGCTCCCCAGGGAAAGGGG - Exonic
1002025462 5:176393633-176393655 CTGTGGCTCCTCAGAGACAGTGG - Intronic
1002079467 5:176728802-176728824 CCGAGATTCCCCAGAGAACGAGG - Intergenic
1002932300 6:1643086-1643108 CTGAGTCTCCCCAGAGAAACTGG + Intronic
1003586227 6:7391431-7391453 TAGGGGTTAGCCAGAGAAAGAGG + Intronic
1003923751 6:10857486-10857508 CTGAGGTTCCTCAGAGAAGAAGG + Intronic
1003923959 6:10859537-10859559 CTGAGGTTTCCCAGAGAAGGAGG + Intronic
1004606434 6:17199588-17199610 CTGGGGCTCAGCAGAGCAAGAGG - Intergenic
1005117506 6:22355043-22355065 TTGGAGTTCTCCAGAGAAACAGG - Intergenic
1005370815 6:25130574-25130596 CTGGGGTTCCTTAAAGAAAATGG + Intergenic
1006624838 6:35390044-35390066 GTGGGGTGCCCCAGCCAAAGCGG + Intronic
1007702951 6:43775019-43775041 CAGGGTGTCCCCAGAGAAATGGG - Intronic
1007916586 6:45567023-45567045 CTGGGACTCTCCAGAGAAAGAGG + Intronic
1008952315 6:57174032-57174054 CTGGGGTTCCACTCAGAATGAGG + Intronic
1009370093 6:62888799-62888821 ATGAGATCCCCCAGAGAAAGTGG - Intergenic
1010734609 6:79429549-79429571 TTAGGGTTCTCCAGAGAAACAGG + Intergenic
1014287818 6:119521392-119521414 CTGGAATTCCCCAGAGAATATGG + Intergenic
1014895178 6:126892650-126892672 CTGAGGCTGCACAGAGAAAGGGG - Intergenic
1016504923 6:144768350-144768372 CTGGGGCTCTTCAGAGTAAGGGG + Intronic
1018718661 6:166555619-166555641 CTGGGTTGCAGCAGAGAAAGAGG - Intronic
1019421723 7:954053-954075 CTCGGGCTCCGCACAGAAAGAGG - Intronic
1019503852 7:1380684-1380706 CTGGGCTCTCCCAGAGACAGGGG + Intergenic
1020094769 7:5362102-5362124 CAGGGGTGCCCCTGAGGAAGGGG + Intronic
1020292172 7:6730275-6730297 CTGGGGCTCCCCAGAGGCCGGGG - Intergenic
1022261607 7:28710935-28710957 ATGTGGTTGCCCAGAGAAGGTGG + Intronic
1023106266 7:36765860-36765882 CTGGTGTAGCCCAGAGGAAGAGG + Intergenic
1023123485 7:36932922-36932944 CTGGGGTGCTGCAGAGACAGTGG + Intronic
1023213482 7:37833263-37833285 TTGGGGTTCTGCTGAGAAAGGGG + Intronic
1024105067 7:46075205-46075227 CTGGTGTCCTCCAGAGAAAAGGG + Intergenic
1024575308 7:50758739-50758761 CTGTGTTTTCCCAGAGTAAGAGG + Intronic
1026025388 7:66740485-66740507 CTGGGGAGCCCCGGAGAAACCGG - Intronic
1026568516 7:71509805-71509827 CCGGAGATCCCCAGAGAAACGGG + Intronic
1026766648 7:73164332-73164354 CTGCTGCTGCCCAGAGAAAGGGG + Intergenic
1026956410 7:74379063-74379085 CTGTGGTTCCACAGAGCATGGGG + Intronic
1027043126 7:74974031-74974053 CTGCTGCTGCCCAGAGAAAGGGG + Intronic
1027080521 7:75228328-75228350 CTGCTGCTGCCCAGAGAAAGGGG - Intergenic
1027229719 7:76265116-76265138 CTGGGGTTGTCTAGAGAAAAGGG + Intronic
1029114954 7:98232026-98232048 CTGGGGGTGCCCAGAGGAGGAGG + Intronic
1029264315 7:99326168-99326190 CAGGGGATCCACGGAGAAAGGGG - Intronic
1029625389 7:101717634-101717656 CTGGGGTTCCCAAGAGAACAGGG - Intergenic
1031293195 7:119965734-119965756 TTAGGGTTCTCCAGAGAAACAGG - Intergenic
1032775706 7:135110363-135110385 CTCGGGTTTCCCAGCAAAAGTGG - Intronic
1034114605 7:148572844-148572866 CTTTGCTTCCCCAGAGAAAGGGG + Intergenic
1034304305 7:150037783-150037805 ATGGGGGTCCCCAGAGCCAGCGG + Intergenic
1034304784 7:150039532-150039554 ATGGGGGTCCCCAGAGCCAGGGG + Intergenic
1034304850 7:150039759-150039781 ATGGGGGTCCCCAGAGCCAGGGG + Intergenic
1034305481 7:150042283-150042305 ATGGGGGTCCCCAGAGCCAGGGG + Intergenic
1034802667 7:154063008-154063030 ATGGGGTTCCTCAGAGCCAGGGG - Intronic
1035277334 7:157755711-157755733 CTGGGGACCCCCAGAGGGAGGGG + Intronic
1036502273 8:9324952-9324974 GAGGGGATCCCAAGAGAAAGAGG + Intergenic
1036800718 8:11789080-11789102 CAGGGGCTCCCCAGACATAGTGG + Intergenic
1037481799 8:19312901-19312923 CTGGGGTTCACCAAAGCAGGCGG + Intergenic
1037543008 8:19889997-19890019 CAGGGGAGCCCCAGGGAAAGAGG + Intergenic
1038235436 8:25748544-25748566 TTGGACTTTCCCAGAGAAAGAGG + Intergenic
1038328828 8:26591777-26591799 CTGGGATTCTCCAGAGGCAGAGG - Intronic
1042198765 8:66258955-66258977 CTGGGGTTCCCTGGAGGAAATGG - Intergenic
1042327074 8:67540307-67540329 CTGGTGATACCCAGAGAAACAGG - Intronic
1042930028 8:74004109-74004131 CTGGGGATCCCCAGAGAAATTGG + Intronic
1043714643 8:83466906-83466928 CTTGGGTTCTCCAAAGAAAATGG - Intergenic
1045315669 8:101041532-101041554 TCAGGGTTCCCCAGAGAAACAGG - Intergenic
1045432499 8:102126211-102126233 GTGGGATTCCTCAGAGAGAGAGG + Intergenic
1045656922 8:104396866-104396888 TTGGGGTTAGCAAGAGAAAGAGG + Intronic
1046977540 8:120298737-120298759 CTGGGATTCTCCAGAGCATGGGG + Intronic
1048443885 8:134479026-134479048 GTGGGGTTACCTAGAGAATGAGG + Intronic
1048472466 8:134715451-134715473 CTGGATTCCCCCACAGAAAGGGG - Intergenic
1049409737 8:142467205-142467227 CTTGGGTTCCCAAGATAACGTGG - Intronic
1049440073 8:142605369-142605391 CTGGGGTTCCCCATATGAAGAGG - Intergenic
1049935172 9:494587-494609 CTGGTTTCCCCCAGAGCAAGTGG - Intronic
1050070085 9:1801269-1801291 TTAGGGTTCTCCAGAGAAAGAGG - Intergenic
1050629988 9:7549018-7549040 TTAGGGTTCTCCAGAGAAACAGG + Intergenic
1053079513 9:35162575-35162597 CTGGGGTTCTCTAGTGAGAGTGG + Intronic
1053737097 9:41108614-41108636 ATGGGGGTCCCAAGAGACAGGGG - Intergenic
1053940083 9:43239268-43239290 CTGGTGATCCCCCGAGAGAGTGG + Intergenic
1054691251 9:68322703-68322725 ATGGGGGTCCCAAGAGACAGGGG + Intergenic
1056272004 9:84955551-84955573 CAGGGGTCCCGCAGGGAAAGAGG - Intronic
1056552471 9:87663511-87663533 CTGGGGATATCCAGTGAAAGAGG - Intronic
1056843345 9:90016586-90016608 CTGGGGTTCCACATGGAAATGGG + Intergenic
1057248693 9:93481652-93481674 CTGGGGTGTCCCAGACAAGGAGG - Intronic
1058055999 9:100449468-100449490 CTGAGGTTTCACAGAGCAAGCGG + Intronic
1060049618 9:120368914-120368936 ATGGGTATCCCCAGGGAAAGAGG - Intergenic
1060985530 9:127817025-127817047 AAGGGGGACCCCAGAGAAAGCGG - Intronic
1061012066 9:127961636-127961658 CTGGGGTGCAACAGAGAAAAAGG + Intronic
1061040419 9:128138402-128138424 ATGGGGGTCCCAAGAGACAGCGG + Intergenic
1061962865 9:133997346-133997368 CTGGGGCTGCCCAGAGAATGAGG - Intergenic
1062546021 9:137064094-137064116 CTGGGGAGCCCCAGGGATAGCGG - Exonic
1186674308 X:11799833-11799855 CTGGCTTTGCCCAGAGCAAGTGG - Intergenic
1186806041 X:13140797-13140819 CTGGGATTTCACAGAGAAGGTGG - Intergenic
1188508794 X:30911644-30911666 CTGGGTGGCTCCAGAGAAAGTGG + Intronic
1188970125 X:36605236-36605258 CTGGGTTGCCACAGAGAAAGAGG - Intergenic
1189420334 X:40851578-40851600 CTGGGTTGCAGCAGAGAAAGAGG + Intergenic
1194451488 X:94049273-94049295 CTGGGGTTCCTTAAAGAAAATGG - Intergenic
1194558675 X:95394080-95394102 CTGGGCCTCCCCAGAGCCAGGGG + Intergenic
1195877828 X:109560825-109560847 TTAGGGTTCTCCAGAGAAACAGG - Intergenic
1196914085 X:120513814-120513836 CTGGGTTACAGCAGAGAAAGAGG - Intergenic
1198740257 X:139834793-139834815 ATGAGGTTCCTTAGAGAAAGGGG + Intronic
1199087274 X:143641935-143641957 CTGTGGTTCCCGAGATAGAGTGG - Intergenic
1201539767 Y:15093398-15093420 CTGGGGTACAGTAGAGAAAGAGG + Intergenic
1201776099 Y:17667864-17667886 CTGGTGATACCCAGACAAAGAGG - Intergenic
1201825457 Y:18238128-18238150 CTGGTGATACCCAGACAAAGAGG + Intergenic