ID: 904905688

View in Genome Browser
Species Human (GRCh38)
Location 1:33895744-33895766
Sequence CAGCCTGCATCCCATGCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904905688_904905692 2 Left 904905688 1:33895744-33895766 CCCTAGGCATGGGATGCAGGCTG 0: 1
1: 0
2: 2
3: 11
4: 193
Right 904905692 1:33895769-33895791 CCCAGCCCCCATGAGTTTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 153
904905688_904905690 1 Left 904905688 1:33895744-33895766 CCCTAGGCATGGGATGCAGGCTG 0: 1
1: 0
2: 2
3: 11
4: 193
Right 904905690 1:33895768-33895790 TCCCAGCCCCCATGAGTTTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
904905688_904905694 3 Left 904905688 1:33895744-33895766 CCCTAGGCATGGGATGCAGGCTG 0: 1
1: 0
2: 2
3: 11
4: 193
Right 904905694 1:33895770-33895792 CCAGCCCCCATGAGTTTGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904905688 Original CRISPR CAGCCTGCATCCCATGCCTA GGG (reversed) Intronic
901323251 1:8351911-8351933 GAGGATGCATCCCAGGCCTAAGG - Intergenic
902566517 1:17315026-17315048 CAGCCTGGTTCCCATGCTGACGG - Intronic
902809356 1:18879506-18879528 CAGGCTGCATTCCAAGACTACGG + Intronic
903919430 1:26788599-26788621 CAGCCCGCATCCCTCGCCAAAGG - Exonic
904029167 1:27523301-27523323 CAGACTGGAGCCCAGGCCTAGGG + Intergenic
904443740 1:30550937-30550959 CAGCCTTCTTCCCATGCTTGTGG - Intergenic
904905688 1:33895744-33895766 CAGCCTGCATCCCATGCCTAGGG - Intronic
905632570 1:39526859-39526881 CAGCCTGCTCCCCTTGCCCATGG + Intergenic
906903564 1:49864588-49864610 CTCCCTGCATCCCTTGGCTAGGG - Intronic
908383317 1:63617107-63617129 GAGCCTACATCCCTTGCCCACGG + Intronic
909928022 1:81461614-81461636 GAGCTTGCATGACATGCCTAAGG - Intronic
913072040 1:115308161-115308183 CAGCCTGCATCCCAGATTTATGG - Intronic
914945613 1:152062902-152062924 CATCCTGCAACTCTTGCCTATGG + Intergenic
915129311 1:153686102-153686124 CAGTCTCCATTCCATGCCCAGGG + Exonic
915367493 1:155324079-155324101 CAGCCTCCATGCCAAGTCTAGGG + Intronic
920401388 1:205678966-205678988 CAGCCTGTTTCCCAGGCCTCGGG + Intronic
921889105 1:220335957-220335979 CAGCCTGAAATCTATGCCTAGGG - Intergenic
1063007203 10:1984479-1984501 CAGCCTGGATCCCAGGGCTGGGG - Intergenic
1064242844 10:13646609-13646631 CAGCCGGCATCCAATTCCTGCGG - Exonic
1066391361 10:34979652-34979674 CAACCTGTATCCTATGCCCAAGG - Intergenic
1067016396 10:42758793-42758815 CAGCCTCCATCCCATGCAGAAGG - Intergenic
1068121256 10:52784246-52784268 GAAGCGGCATCCCATGCCTATGG - Intergenic
1069826040 10:71255816-71255838 CAGCTTGCATCCGAAGCCAAAGG + Intronic
1069842587 10:71349027-71349049 CAGCCTTCAACCAATGACTAGGG - Intronic
1070540233 10:77410370-77410392 CAGCCAGCTTCTCATGCCTGAGG - Intronic
1070653256 10:78253219-78253241 CAGCTTGGGTCCCATGCCCAAGG + Intergenic
1071499405 10:86192885-86192907 GAGCCTGAGTCCCAGGCCTAAGG + Intronic
1072786355 10:98285742-98285764 GAGGCTGCATCCCATGTCTCTGG - Intergenic
1073768161 10:106706469-106706491 CAGCCTCCATCCCTTTCCCAAGG - Intronic
1076236468 10:128867309-128867331 CAGCCTGCAGCTGAGGCCTACGG - Intergenic
1076442958 10:130492817-130492839 AGACCTGCATCCCATGCCCAGGG - Intergenic
1077216560 11:1397567-1397589 CAGCCTGCAGCCCAGGCCCCTGG - Intronic
1077534150 11:3111394-3111416 CAGCCTGAGACCCATCCCTAGGG + Intronic
1081504383 11:43700084-43700106 CAGCCTTCATCCAGTGACTAAGG - Intronic
1081861333 11:46334751-46334773 CATCATCCATCCCATGCCTCTGG + Intronic
1083624321 11:64064367-64064389 CATCCTCCATCCAATGCCTGTGG - Intronic
1084765745 11:71307188-71307210 CAGCCTGCAGCCCTTGGTTAGGG - Intergenic
1085468800 11:76743610-76743632 CAGCCTCCATCCCCTGCCTCTGG + Intergenic
1086268290 11:85028527-85028549 CAGCCTCCCTCCCATGCTCACGG + Intronic
1087921442 11:103871232-103871254 CAACATGCATCCCAGGCCTCAGG - Intergenic
1088695244 11:112360915-112360937 CACTCTGCATCCCAGGCCTGGGG - Intergenic
1088891202 11:114045939-114045961 CTGACTGCACCCCATGCATAGGG - Intergenic
1089576425 11:119447625-119447647 CTGCCTGCATCGCAGGCCTCGGG + Intergenic
1089756476 11:120691246-120691268 AAGCCTCCATCCCAGGCCTGAGG - Intronic
1092160548 12:6313137-6313159 CAGCCTGCATCCCATCCAGCTGG - Intronic
1092260903 12:6952832-6952854 CAGCCCCCAGCCCATGCCTTTGG - Intronic
1092931310 12:13318397-13318419 GAGGCTGCATGCCATGCCTGAGG + Intergenic
1095517691 12:43024717-43024739 CAAGCTGTATCCCATCCCTAGGG - Intergenic
1101422255 12:104559355-104559377 CAGCCTTCATTCCAGGACTAAGG + Intronic
1102068147 12:109996074-109996096 CAGGCTGCATCCCGCGGCTAGGG - Intronic
1102698854 12:114821806-114821828 ATGCCTGCATGCCATGCATACGG - Intergenic
1103175874 12:118862621-118862643 CAGCCTCCATCCCACGCCCTTGG - Intergenic
1103922328 12:124405432-124405454 CACCCTGCAGCCAAGGCCTAGGG + Intronic
1107353593 13:39542158-39542180 CAGCCTCCCTCACATGCCTTTGG - Intronic
1108510082 13:51148227-51148249 CAGCCTGCCTCCCAGTCCTTGGG + Intergenic
1108714858 13:53069001-53069023 AAGGCTGCATCTCATGCCTGAGG + Intergenic
1110680741 13:78309145-78309167 CAGCATTCACCCCATGCCTTTGG - Intergenic
1111193492 13:84840399-84840421 CAGCCTGCATCCCCTCCCAGAGG + Intergenic
1113830977 13:113295880-113295902 CACCCTGCATCTGCTGCCTAAGG - Intergenic
1114405105 14:22449200-22449222 CACCCTGGGTCCCATGCCTCAGG + Intergenic
1114571141 14:23669708-23669730 CAGCCTGTAGCACATGCATAAGG + Intergenic
1115694428 14:35881354-35881376 CAGCCTGCTTACCCAGCCTATGG + Intronic
1120385987 14:83846533-83846555 CAGCCTGCATGCCATACCATTGG + Intergenic
1121727859 14:96166135-96166157 CAGCCTGGATCGCCTGCCTGGGG + Intergenic
1122656125 14:103260552-103260574 CAGCCTTCATCCCAAGTATATGG - Intergenic
1124098130 15:26668419-26668441 ATGCCTGCAGCCCCTGCCTAGGG + Intronic
1124711333 15:32014846-32014868 AAGCCTGCTTCCCTTGGCTAAGG + Intergenic
1129182516 15:73886210-73886232 CAGCCCCCTTCCCATGCCTGGGG - Intronic
1131141735 15:89981994-89982016 AGTCCTGCATCCCATGCCCATGG + Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132658147 16:1049813-1049835 CACCCTGCAGCCCATGCGTGTGG + Intergenic
1134566324 16:15255011-15255033 GAGCCTTCATCTCATGCCTATGG + Intergenic
1134736172 16:16501687-16501709 GAGCCTTCATCTCATGCCTATGG - Intergenic
1134931347 16:18210478-18210500 GAGCCTTCATCTCATACCTATGG + Intergenic
1135259344 16:20967434-20967456 CAGGCTGCATCCCAGACCAATGG + Intronic
1135617614 16:23925480-23925502 GAGCTTGCATCCCATTTCTAGGG + Intronic
1135854860 16:25999182-25999204 CAACCTGCCTCACCTGCCTAAGG - Intronic
1136408134 16:30061118-30061140 CTGACTCCAGCCCATGCCTAAGG + Intronic
1136485579 16:30569999-30570021 CAGCCCGGATCCCAGGCCTCCGG + Exonic
1136712978 16:32254625-32254647 CAGGCTGCTTCCCAGGCCTCAGG + Intronic
1136754938 16:32674813-32674835 CAGGCTGCTTCCCAGGCCTCAGG - Intronic
1136813175 16:33195556-33195578 CAGGCTGCTTCCCAGGCCTCAGG + Intronic
1136819651 16:33305636-33305658 CAGGCTGCTTCCCAGGCCTCAGG + Exonic
1136826214 16:33362171-33362193 CAGGCTGCTTCCCAGGCCTCAGG + Intronic
1136831280 16:33460942-33460964 CAGGCTGCTTCCCAGGCCTCAGG + Exonic
1136998305 16:35207075-35207097 CAGGCTGCTTCCCAGGCCTCGGG - Intergenic
1138142669 16:54582352-54582374 CAGCCTGCATTCCTTCCCTTTGG + Intergenic
1140032157 16:71347452-71347474 CAGCCCACATCCCATGCATCAGG + Intergenic
1141530304 16:84641672-84641694 CACTCTCCATCCCATGCCCATGG - Intergenic
1141669796 16:85485777-85485799 CTGCCTGCCTGCCATCCCTAGGG - Intergenic
1141881955 16:86866118-86866140 CAGCCTGGGCCCCATGCCCACGG + Intergenic
1202991751 16_KI270728v1_random:18526-18548 CAGGCTGCTTCCCAGGCCTCAGG + Intergenic
1203057079 16_KI270728v1_random:935143-935165 CAGGCTGCTTCCCAGGCCTCAGG - Intergenic
1143532301 17:7512548-7512570 CAGGGTGCAACCCCTGCCTATGG + Exonic
1146137651 17:30337389-30337411 CAATCTGCTTCCCATTCCTAAGG + Intergenic
1146160010 17:30554736-30554758 CAGCCTGGAGCCCATCCCTCAGG + Intergenic
1146231225 17:31112104-31112126 CTACCTCCATCCCATCCCTAGGG + Intronic
1148159798 17:45443468-45443490 CAGCCTGCTTCCCATGCCTGTGG - Intronic
1150391086 17:64790340-64790362 CAGCCTGCTTCCCATGCCTGTGG - Intergenic
1150409866 17:64934392-64934414 CAGCCTGCTTCCTGTGCCTGTGG - Intergenic
1152028639 17:77827608-77827630 CACCCTGCAGCCCAGGCCTCAGG - Intergenic
1155150403 18:23118348-23118370 CAGCCTCCTGCCCATGCCAATGG + Intergenic
1155984756 18:32218357-32218379 ATGCCTGCATCCCCTTCCTATGG - Intronic
1158427358 18:57352301-57352323 CAGGCTGCAGCCCGAGCCTACGG - Exonic
1160306044 18:77737977-77737999 CAGCCTGCCTTCCAGGCCAAGGG - Intergenic
1161430847 19:4231425-4231447 CATCCTGAACCCCAGGCCTATGG + Intronic
1161729038 19:5947674-5947696 CAGCCTGCAGCCCAAGCCGCGGG - Intronic
1163034144 19:14561900-14561922 CAGCCCGCAGCTCAGGCCTAGGG - Intronic
1163738615 19:18997016-18997038 CACCCTGCTTCCCATGCCCAGGG - Intronic
926045255 2:9705121-9705143 CTCTCTGCATCCCATGGCTATGG - Intergenic
926341877 2:11910463-11910485 CAGAATCCATCCCATGCCTCTGG - Intergenic
927255986 2:21041324-21041346 CATCCTCCTTCCCATGCCTAGGG - Intronic
934052078 2:88219538-88219560 CAGGCTGCTGCCCATGCCTCTGG - Intergenic
934774550 2:96928808-96928830 CAGGCTGTATCCCATGTGTAGGG - Intronic
936836566 2:116717695-116717717 CAGCCTTTATCCCATGTATATGG - Intergenic
937280211 2:120712579-120712601 CAGCCTGCTTCCCATGACTGGGG + Intergenic
937882378 2:126878074-126878096 GAGCCAGCATCCGGTGCCTAGGG - Intergenic
940422826 2:153499444-153499466 CAGCCTGCTCCCCATGCTTCAGG + Intergenic
940931573 2:159438056-159438078 TCCCCTGCAACCCATGCCTAAGG - Intronic
941918265 2:170826247-170826269 AAACCTGCATCCCATTCCTTGGG - Intronic
945108228 2:206337285-206337307 CAGCCTGCATGCAATGACTGGGG - Intergenic
946187965 2:217991894-217991916 CAGCCTGCCTCTCATGCATGAGG - Intronic
946359607 2:219211149-219211171 CACCCTGCCTCCCAGGCCTTGGG - Intronic
1169191073 20:3659720-3659742 CAGCCTACATCCCTTGCCCCAGG + Intronic
1170823533 20:19774086-19774108 AGGCCTCCATCCCCTGCCTATGG - Intergenic
1173724634 20:45288870-45288892 CATGCTGCATCCCATGACAAGGG - Intergenic
1174680622 20:52403327-52403349 CGGTCTGCATCCCATTCCCACGG + Intergenic
1175039592 20:56035674-56035696 CCACCTGCATCCCGTGACTATGG + Intergenic
1175245894 20:57581724-57581746 CAGCCTTCATCTCAAGCCTGTGG + Intergenic
1175818584 20:61896385-61896407 CGTCCTGCATCCCAGGCCTGGGG + Intronic
1184067050 22:42126991-42127013 CACCCTGCATCTCCTGCCCAGGG - Exonic
1184069775 22:42140695-42140717 CACCCTGCATCTCCTGCCCAGGG - Intergenic
1184071519 22:42150303-42150325 CACCCTGCATCTCCTGCCCAGGG - Intergenic
1185095760 22:48805130-48805152 CAGCCTGTGTCCCAGGCCTGTGG + Intronic
952945216 3:38474393-38474415 CAGCCTGCAGCCCAAGCCCTAGG - Intronic
956657263 3:71564634-71564656 CAGCCTGCATCACTGGCCAAGGG - Intronic
956717176 3:72088637-72088659 CAGTCTTCATCCCGTGCCAAAGG + Intergenic
959063963 3:101638957-101638979 CAGCAGGCAGCCCATGCCGACGG - Intergenic
959580949 3:107981897-107981919 CAACCTGCTTCCCAGGCCTTTGG + Intergenic
960971106 3:123140878-123140900 CAGCTGGCTTCCCATGCCTGTGG + Intronic
961165780 3:124762850-124762872 CAGCCTGTGTCCCATCCCTGAGG + Exonic
961412874 3:126735600-126735622 CAGCTTGCACCTCATGCCTGAGG + Intronic
963601351 3:147381329-147381351 CAACCTGCATCCCAGGACTTGGG + Intergenic
964443084 3:156732070-156732092 CAGCCAGCACCACATGCTTATGG + Intergenic
965241464 3:166204810-166204832 CAGCCTGTAACACATACCTAAGG + Intergenic
965367773 3:167820809-167820831 CAGCCTGGACCCCAGGCCTCAGG - Intronic
966090048 3:176122920-176122942 CAGTCTGCAGCCCATGGCTTGGG - Intergenic
967483579 3:190003972-190003994 TTGCCAGCATCCCATGACTATGG + Intronic
970846990 4:20552170-20552192 CAGCCTGCATTCTCTGCCTGAGG - Intronic
972052937 4:34763877-34763899 AATGCTGCATCCCCTGCCTATGG + Intergenic
972575087 4:40344084-40344106 CCACCTGCATCCCATGACTCAGG - Intronic
975176404 4:71294330-71294352 CAACCTGAATCACATGCCAAGGG - Intronic
976590726 4:86847281-86847303 AAGCATCTATCCCATGCCTATGG + Intronic
977816240 4:101416864-101416886 CAGCCTGGACCCCAGGCCTCAGG + Intronic
980613304 4:135185402-135185424 CAGGCTCCTTCCCCTGCCTATGG + Intergenic
980615669 4:135220789-135220811 CAGCTTGCATGCCGTGCCTTAGG + Intergenic
981687974 4:147476089-147476111 CAGCCTTGATCCCAGGCCCATGG + Intergenic
983572807 4:169228450-169228472 CTGCCTGCATCACTTGCCTTGGG + Intronic
984165967 4:176303664-176303686 CAGCCTCCATCCTATTTCTAAGG - Intergenic
992773851 5:80072942-80072964 CTGCCTTCTCCCCATGCCTATGG + Intronic
994153393 5:96475073-96475095 CAGCAGGCATGCCATACCTATGG + Intergenic
995299819 5:110566396-110566418 CAGCCTGCATCCCATTTTTTGGG - Intronic
997514260 5:134475430-134475452 CAACCTGCATTCCATCTCTACGG - Intergenic
999238691 5:150115088-150115110 CAGCCTGCAGCCCTTGCCCAGGG - Exonic
1001933324 5:175688029-175688051 CAGCCTGCATGCCTTGGCTCAGG + Intergenic
1002135025 5:177102137-177102159 CAGCCTCCATCCCTTGGCTAGGG - Intergenic
1007430094 6:41771455-41771477 CTGCCTGCAGCCCCTGCCTGAGG - Exonic
1008397810 6:51029044-51029066 CTGCCTGAATCACTTGCCTAGGG + Intergenic
1012167395 6:95974830-95974852 CAGTCTGGATCCCAAGCTTATGG + Intergenic
1013012367 6:106132294-106132316 CAGCCTTCATTCCATGTCTGTGG + Intergenic
1019313765 7:375339-375361 CAGCCTGCACCGCATGCATCTGG + Intergenic
1019365474 7:630443-630465 CAGCCTGCATCTGAGGCCTGTGG + Intronic
1021343141 7:19489118-19489140 CAGCCTGGACCCCATGCTTCAGG + Intergenic
1022464982 7:30647680-30647702 CAGCCTGCGTCCAATGCCAGTGG + Intergenic
1022756086 7:33292168-33292190 CAGCCTGAATACCTTGCCTGTGG + Intronic
1023672639 7:42594102-42594124 CAGCCTGCATTCCTTGGCTCTGG - Intergenic
1023908348 7:44537406-44537428 CAGCCTCCTTCTCCTGCCTAGGG + Intronic
1026673319 7:72408146-72408168 GAGCCTCCATGCCAGGCCTACGG - Intronic
1026846072 7:73699844-73699866 CAGGCTCCCTCCCCTGCCTAGGG - Exonic
1026856339 7:73757655-73757677 CAGACTTCATGCCATGCCTTAGG - Intergenic
1034240041 7:149603417-149603439 CAGCCTGCTGCCCATAACTAAGG + Intergenic
1035246674 7:157566834-157566856 CAGGCTCCATCCCATCCCTGTGG + Intronic
1035310213 7:157962938-157962960 CTGCCAGCATCCCATGGCTAAGG - Intronic
1035922691 8:3694618-3694640 CAGCCTCCCTCTCATGCCCAGGG - Intronic
1037258413 8:16980550-16980572 CAGCCTCCCTCCCATGCCATAGG + Intergenic
1037821960 8:22139368-22139390 CAGCCCCCATCCCACCCCTAAGG - Intronic
1048316774 8:133368838-133368860 CTGCCATCTTCCCATGCCTAGGG - Intergenic
1049764392 8:144347135-144347157 CGGCCTGTCTTCCATGCCTATGG + Intergenic
1050194222 9:3063573-3063595 CAGCCTTCTTCCCTTGCATAAGG - Intergenic
1050528548 9:6566971-6566993 CAGCCTGCCTCCCAGAGCTACGG + Intronic
1052295417 9:26892328-26892350 CAGCCTGCGCCCCATCCCTCTGG + Intronic
1052337102 9:27331252-27331274 CAGGTTGAGTCCCATGCCTATGG + Intronic
1053121166 9:35548306-35548328 TAGCCTGCCACCCATGCCTTTGG + Exonic
1054853239 9:69870897-69870919 CATCCTTCATCCTCTGCCTAGGG - Intronic
1056705651 9:88950480-88950502 CTGCCTGCAGCCCCTGCTTAGGG + Intergenic
1058382287 9:104390459-104390481 CAGCCTGCATTCCAGCCCCAGGG + Intergenic
1060003921 9:119982830-119982852 CAGTCTGCATCCAATGACTGGGG + Intergenic
1061141275 9:128768667-128768689 CAGCCTGTGTCCCAGGCCTGAGG + Intronic
1061838217 9:133342870-133342892 CAGCCTGCCTGCCTTGCCTTGGG - Intronic
1062523804 9:136970291-136970313 CAGCCTGGAACCCCTGCCTGGGG + Intronic
1062581058 9:137229447-137229469 CAGCCTGCAGCCCAGGCCCCCGG - Exonic
1185935976 X:4257460-4257482 CAGCCTGGACCCCATGCTTCAGG - Intergenic
1188089979 X:25952718-25952740 CACCCTGCATCCCAGGCAAATGG - Intergenic
1190620692 X:52284579-52284601 CAGCCTGGATCCCAGGCTTCAGG + Intergenic
1195310056 X:103624144-103624166 CAGCCTCCTTCCCAGGCCTCAGG + Intronic
1200772907 Y:7143729-7143751 CCTCCTGCATCCCATGGCTGAGG - Intergenic
1201720370 Y:17089947-17089969 CAGCCTGAATCCCATGCTTTAGG - Intergenic