ID: 904907043

View in Genome Browser
Species Human (GRCh38)
Location 1:33905361-33905383
Sequence CTCCTATGAAACCATGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904907043_904907047 9 Left 904907043 1:33905361-33905383 CCAGCTACATGGTTTCATAGGAG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 904907047 1:33905393-33905415 GGAAATAGTTCAAGAAGGACTGG 0: 1
1: 0
2: 0
3: 43
4: 654
904907043_904907046 4 Left 904907043 1:33905361-33905383 CCAGCTACATGGTTTCATAGGAG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 904907046 1:33905388-33905410 GAGAAGGAAATAGTTCAAGAAGG 0: 1
1: 2
2: 1
3: 51
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904907043 Original CRISPR CTCCTATGAAACCATGTAGC TGG (reversed) Intronic
902613190 1:17609088-17609110 CTCCTTTTAAAAGATGTAGCGGG + Intronic
902757084 1:18556051-18556073 ATCCTATTACTCCATGTAGCTGG + Intergenic
904907043 1:33905361-33905383 CTCCTATGAAACCATGTAGCTGG - Intronic
904911633 1:33938586-33938608 TTCCCATGATACCATGTTGCTGG + Intronic
906127303 1:43434891-43434913 CTGCTACGAAAGCATGTAACAGG + Intronic
906933993 1:50195813-50195835 CAGCTATGAACCCCTGTAGCAGG - Intronic
907823710 1:57995145-57995167 CTCATCTGAAATCATGTACCTGG - Intronic
911505712 1:98748097-98748119 CTCCTAAGTAACCAAGTAGCTGG + Intronic
912653320 1:111461597-111461619 CTCTTAAGAATCCATGCAGCAGG + Exonic
916989370 1:170225979-170226001 CTCCTATGAAACCATGTGAAGGG + Intergenic
922604689 1:226882206-226882228 GTCCTATGAAACCCTGCAGATGG - Intronic
1063908003 10:10799934-10799956 CTCCTATGAAGCCATGTTTTGGG - Intergenic
1067248939 10:44571161-44571183 CTCTTCAGAAACCATGGAGCCGG + Intergenic
1068107476 10:52637209-52637231 GTCCTATGAAACCATTTGGATGG - Intergenic
1069405565 10:68094685-68094707 CTCCTCTGAAACAATGTCACTGG + Intergenic
1074289639 10:112128687-112128709 CTCTTTGGAAACCATGTTGCAGG + Intergenic
1074312736 10:112336360-112336382 CTCCTTTGGAACCAGGGAGCTGG + Intergenic
1074433327 10:113412245-113412267 CTCCTATGAGACTTTGTAACTGG - Intergenic
1082769361 11:57194575-57194597 TTGCTATGAAACCATGAACCTGG - Intergenic
1087285110 11:96256538-96256560 TTCCTATGAACCCATGTATAGGG - Intronic
1091562373 12:1624860-1624882 CCCTTATGAATCCATGTATCTGG - Intronic
1106201488 13:27541262-27541284 TTCCTATGAAAACATGTCTCTGG + Intergenic
1108371262 13:49771563-49771585 CTCCTCTGCACCCAAGTAGCTGG + Intronic
1108510593 13:51152281-51152303 CTCCTGTGGAAACATTTAGCAGG + Intergenic
1111675766 13:91386698-91386720 CTCCTAGGAAGCCAAGTTGCTGG + Intergenic
1111798244 13:92950843-92950865 GTCCAGTGAAACCATGTATCTGG - Intergenic
1128053909 15:64685625-64685647 CACCTGTGAAACTATGCAGCTGG + Exonic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128749092 15:70135771-70135793 CTCTTATCACAACATGTAGCAGG - Intergenic
1131687214 15:94781080-94781102 ATGCTAAGAAACCAGGTAGCTGG + Intergenic
1133329941 16:4966689-4966711 CTCCAAAGCAAACATGTAGCAGG + Intronic
1134166158 16:11931389-11931411 TTCCTATAAAACCAAGTATCAGG - Intronic
1134494560 16:14722336-14722358 TTCCTATAAAACCAAGTATCAGG + Intronic
1134499943 16:14761456-14761478 TTCCTATAAAACCAAGTATCAGG + Intronic
1134526488 16:14948075-14948097 TTCCTATAAAACCAAGTATCAGG + Intronic
1134545916 16:15108271-15108293 TTCCTATAAAACCAAGTATCAGG - Intronic
1134580636 16:15367594-15367616 TTCCTATAAAACCAAGTATCAGG - Intronic
1134714065 16:16346548-16346570 TTCCTATAAAACCAAGTATCAGG + Intergenic
1134721937 16:16389911-16389933 TTCCTATAAAACCAAGTATCAGG + Intronic
1134945488 16:18321958-18321980 TTCCTATAAAACCAAGTATCAGG - Intronic
1134952752 16:18362110-18362132 TTCCTATAAAACCAAGTATCAGG - Intergenic
1136150709 16:28346723-28346745 TTCCTATAAAACCAAGTATCAGG - Intronic
1136166946 16:28460561-28460583 TTCCTATAAAACCAAGTATCAGG - Intronic
1136196030 16:28654471-28654493 TTCCTATAAAACCAAGTATCAGG + Intronic
1136212368 16:28768594-28768616 TTCCTATAAAACCAAGTATCAGG + Intronic
1136257091 16:29048506-29048528 TTCCTATAAAACCAAGTATCAGG + Intronic
1136308253 16:29387810-29387832 TTCCTATAAAACCAAGTATCAGG - Intronic
1136321670 16:29489348-29489370 TTCCTATAAAACCAAGTATCAGG - Intronic
1136436350 16:30229318-30229340 TTCCTATAAAACCAAGTATCAGG - Intronic
1137267556 16:46881572-46881594 CTCCTATCAACCCACATAGCTGG - Intergenic
1138141308 16:54570994-54571016 CTGCTGTGAAACCATTGAGCAGG + Intergenic
1139855949 16:69980238-69980260 TTCCTATAAAACCAAGTATCAGG - Intergenic
1140196085 16:72856776-72856798 CTTCTACTAAACCATGTTGCAGG + Intronic
1140366782 16:74387841-74387863 TTCCTATAAAACCAAGTATCAGG + Intronic
1140878095 16:79172087-79172109 GTCCTCTGTCACCATGTAGCAGG + Intronic
1154117420 18:11623446-11623468 TTCCTATAAAACCAAGTATCAGG - Intergenic
1156586578 18:38437719-38437741 CCCCTATGACACTTTGTAGCAGG + Intergenic
1157440588 18:47708626-47708648 CTCCTATTAATCCATGTGGCAGG - Intergenic
1158311809 18:56167146-56167168 CTCCTATGATGCCAAATAGCTGG - Intergenic
1158595963 18:58816311-58816333 CTTCCATGAAACCATGAAACCGG - Intergenic
1158843941 18:61420756-61420778 CTCCTATTAAACAATCTGGCTGG + Intronic
926626727 2:15096665-15096687 CACCTATGACACCAAGGAGCAGG + Intergenic
929470099 2:42183028-42183050 CTCCTGTGATACCAGGTATCAGG + Intronic
930104461 2:47629037-47629059 CTCAGATGAAACCATGAAGGAGG - Intergenic
931483137 2:62663139-62663161 GTCCTATGAAACTTTGGAGCTGG + Intergenic
938384816 2:130857754-130857776 CTCCTATAAAAAGATATAGCTGG - Intronic
938385197 2:130861231-130861253 CTCCTATAAAAAGATATAGCTGG - Intronic
941284443 2:163592288-163592310 CTTATATGAAACCAAATAGCAGG + Intergenic
943537018 2:189165447-189165469 CTCCTATCAAACCTAGTAACTGG + Intronic
1174422279 20:50407191-50407213 CTTGTCTGAAACCATGCAGCCGG - Intergenic
1175756531 20:61533667-61533689 CACCTGTGCAACCATGAAGCAGG - Intronic
1175897492 20:62345842-62345864 CTCCAATGACACCAGGGAGCAGG - Exonic
1177735889 21:25089320-25089342 ATCATATGAACCCATGTATCTGG - Intergenic
1178116461 21:29422593-29422615 CTACTTTTAAACCATGTAACTGG - Intronic
1181349933 22:22247653-22247675 TTCCTCTGGAACCATCTAGCTGG - Intergenic
1182539413 22:31029473-31029495 CTCATCTGAAACCATGGAGACGG - Intergenic
950686773 3:14624112-14624134 GTGCTATGAAACCTTGTAACAGG + Intergenic
952784441 3:37139023-37139045 CTCCTGTGAGACTATCTAGCAGG + Intronic
954972356 3:54661949-54661971 GTACTATGAAAGCCTGTAGCAGG - Intronic
960848786 3:122030313-122030335 CTCCTTTGACAACATGAAGCAGG + Intergenic
961098967 3:124182288-124182310 CTCCTAAGAGACCATGAAGCAGG - Intronic
962860083 3:139391171-139391193 ATCTTTAGAAACCATGTAGCTGG - Intergenic
970966183 4:21930784-21930806 CTTCCATGAAACTTTGTAGCTGG + Intronic
972356252 4:38281694-38281716 CTTCTAGGAGACCATGTAACAGG - Intergenic
973765277 4:54156538-54156560 CTTCTGTTAATCCATGTAGCAGG - Intronic
977887396 4:102268532-102268554 CTCCTATGCCACCATGTGACAGG + Intronic
980423529 4:132594670-132594692 CACCTATGAAAACATGTGGCAGG + Intergenic
985393765 4:189519127-189519149 CTCATATGTCACCATCTAGCAGG + Intergenic
988014957 5:25544049-25544071 CTCTTGTGAAACCATGGTGCTGG - Intergenic
995905610 5:117119024-117119046 CTCAAATGAAACTATTTAGCTGG - Intergenic
996569696 5:124919127-124919149 CTCTTATGAGAGCATGTGGCTGG + Intergenic
999673569 5:153977742-153977764 CTCCTCTGAAACAAGGTATCAGG - Intergenic
1000347544 5:160327512-160327534 CTCCAATGCAGCGATGTAGCTGG + Intronic
1004470287 6:15922891-15922913 CTTCTCTGAAAACATGTACCAGG + Intergenic
1005445415 6:25917485-25917507 CTTCCATGAAATCATGTGGCAGG + Intronic
1011162533 6:84407683-84407705 CTTCTATGAGACAATGTAGTTGG + Intergenic
1012026199 6:93995104-93995126 CTCCACTGAAACCAAGGAGCGGG + Intergenic
1012066982 6:94560193-94560215 CTCCTCTGACACCTTCTAGCAGG - Intergenic
1012860295 6:104551501-104551523 CTCCTATGAAACCATGGGGGAGG - Intergenic
1015465614 6:133544938-133544960 CTGATATGAAACCAAGTATCAGG - Intergenic
1016555388 6:145330566-145330588 CACCTCTGAACCCATGTACCAGG + Intergenic
1017118129 6:150997812-150997834 CTCCCATGAAACAATATTGCTGG - Intronic
1020464740 7:8464810-8464832 CTCCTAAGAATTCATATAGCAGG + Intronic
1025248546 7:57336275-57336297 CTTGTCTGAAACCATGCAGCCGG + Intergenic
1027744110 7:82051838-82051860 CTCCTATCAAAGCATATAACTGG + Intronic
1028168578 7:87567978-87568000 CTCCCAAGTAACCAAGTAGCTGG - Intronic
1030312734 7:108084350-108084372 CTCCTAGGTAACCATGAAGCTGG - Intronic
1039534850 8:38300466-38300488 CTCCTTTAAAATCATGTACCAGG - Intronic
1040881083 8:52205496-52205518 CTCCTAGGAAACAATTTAGAAGG + Intronic
1046112327 8:109740072-109740094 CTCGTATGAAAACATGATGCTGG - Intergenic
1054893871 9:70285178-70285200 CTCCTAGGAAATCATGTCTCCGG - Intronic
1058648039 9:107148870-107148892 TTCCTTTGGAACCATTTAGCTGG + Intergenic
1186689592 X:11961154-11961176 ATACTATGAAACCCTGAAGCTGG + Intergenic
1192227552 X:69239503-69239525 CTCCCAAGTAACCAAGTAGCTGG + Intergenic
1195981177 X:110580078-110580100 CTCCTATAAAATAATGTACCTGG - Intergenic