ID: 904909875

View in Genome Browser
Species Human (GRCh38)
Location 1:33926797-33926819
Sequence ATGATCGACTTTAAGTTCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 542}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904909873_904909875 2 Left 904909873 1:33926772-33926794 CCTTTCCAAGTTTATGACTTTAT 0: 1
1: 0
2: 2
3: 42
4: 381
Right 904909875 1:33926797-33926819 ATGATCGACTTTAAGTTCTACGG 0: 1
1: 0
2: 1
3: 19
4: 542
904909874_904909875 -3 Left 904909874 1:33926777-33926799 CCAAGTTTATGACTTTATTTATG 0: 1
1: 0
2: 1
3: 36
4: 505
Right 904909875 1:33926797-33926819 ATGATCGACTTTAAGTTCTACGG 0: 1
1: 0
2: 1
3: 19
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904909875 Original CRISPR ATGATCGACTTTAAGTTCTA CGG Intronic
904010224 1:27385288-27385310 TTATTAGACTTTAAGTTCTAGGG - Intergenic
904909875 1:33926797-33926819 ATGATCGACTTTAAGTTCTACGG + Intronic
905728845 1:40280148-40280170 ATGGTCGACATTGAGTTCTTCGG + Intronic
906094110 1:43208773-43208795 TTGTTATACTTTAAGTTCTAGGG - Intronic
906565043 1:46793604-46793626 AAAATATACTTTAAGTTCTAGGG + Intronic
906722785 1:48021414-48021436 TTTATATACTTTAAGTTCTAGGG - Intergenic
907005073 1:50904898-50904920 TTAATATACTTTAAGTTCTAGGG + Intronic
907232261 1:53010757-53010779 TTGTTATACTTTAAGTTCTAGGG - Intronic
908201494 1:61800592-61800614 TTGTTATACTTTAAGTTCTAGGG + Intronic
909040128 1:70639514-70639536 TTTATGTACTTTAAGTTCTAGGG - Intergenic
910620034 1:89243506-89243528 TTTATATACTTTAAGTTCTAGGG + Intergenic
910662444 1:89688352-89688374 TTTATGGACTTTAAATTCTATGG + Intronic
910957412 1:92721656-92721678 TTGTTATACTTTAAGTTCTAGGG - Intronic
911366713 1:96947408-96947430 AAAATATACTTTAAGTTCTAGGG + Intergenic
911468440 1:98284790-98284812 TTGTTATACTTTAAGTTCTAGGG + Intergenic
911469583 1:98301044-98301066 ATTATTAACTTTAAGTTTTAGGG + Intergenic
911700269 1:100944517-100944539 TTGTTATACTTTAAGTTCTAGGG + Intronic
912605293 1:110983316-110983338 TTGTTATACTTTAAGTTCTAGGG + Intergenic
912846268 1:113077747-113077769 TTATTCTACTTTAAGTTCTAGGG + Intronic
913372445 1:118115974-118115996 ATGATCAACATTAAGTTGCAAGG - Intronic
913686801 1:121239877-121239899 ATGATCTAATTTAAGTTTTGAGG + Intronic
914038662 1:144027505-144027527 ATGATCTAATTTAAGTTTTGAGG + Intergenic
914150792 1:145040425-145040447 ATGATCTAATTTAAGTTTTGAGG - Intronic
914226794 1:145726710-145726732 TTAATATACTTTAAGTTCTAGGG - Intronic
914413078 1:147450397-147450419 AAAATATACTTTAAGTTCTAGGG - Intergenic
915781623 1:158558356-158558378 ATGGTCGACATTAAGTTCTTTGG + Intergenic
915990406 1:160509633-160509655 TTAATATACTTTAAGTTCTAGGG - Intronic
916277326 1:163008845-163008867 ATTATATACTTTAAGTTCTGGGG + Intergenic
916452341 1:164933089-164933111 CTAATGGACTTTAAGTTCTAAGG - Intergenic
916810686 1:168303053-168303075 TTGTTATACTTTAAGTTCTAGGG + Intronic
916992668 1:170261129-170261151 TTGTTATACTTTAAGTTCTAGGG - Intergenic
917162460 1:172072987-172073009 ATGCTAGGCTCTAAGTTCTAAGG + Intronic
917337948 1:173944548-173944570 TTTATATACTTTAAGTTCTAGGG - Intronic
917602582 1:176592556-176592578 ATAATAGACTAGAAGTTCTAGGG + Intronic
917607626 1:176650420-176650442 ATTATATACTTTAAGTTCTAGGG + Intronic
918102046 1:181384869-181384891 ATTATATACTTTAAGTTTTAGGG - Intergenic
918913909 1:190609881-190609903 TTATTCTACTTTAAGTTCTAGGG - Intergenic
919328382 1:196137770-196137792 TTGTTATACTTTAAGTTCTAGGG + Intergenic
919443010 1:197662575-197662597 AATATATACTTTAAGTTCTAGGG + Intronic
919682634 1:200451629-200451651 TTAATATACTTTAAGTTCTAGGG + Intergenic
920474133 1:206258385-206258407 ATGATCTAATTTAAGTTTTGAGG + Intronic
921004723 1:211081946-211081968 TTGTTATACTTTAAGTTCTAGGG - Intronic
921057073 1:211550634-211550656 ATGATCGAAGTTGAGTTCTTGGG - Intergenic
922047214 1:221957778-221957800 ATATTATACTTTAAGTTCTAGGG - Intergenic
1062777104 10:160806-160828 ATGCTCGACTTCTAATTCTAGGG + Intronic
1062983126 10:1742492-1742514 AAGATCGTCTTTAAGATCAAGGG + Intergenic
1063324402 10:5083087-5083109 ATTATACACTTTAAGTTTTAGGG + Intronic
1063338571 10:5241293-5241315 ATGATCGATGTTGAGTTCTTTGG - Intergenic
1064828960 10:19440356-19440378 ATATTACACTTTAAGTTCTAGGG + Intronic
1064892548 10:20194647-20194669 ATATTATACTTTAAGTTCTAGGG + Intronic
1065502631 10:26397289-26397311 TTAATATACTTTAAGTTCTAGGG - Intergenic
1068210593 10:53914743-53914765 TTTATATACTTTAAGTTCTAGGG - Intronic
1068215182 10:53973420-53973442 TTAATATACTTTAAGTTCTAGGG - Intronic
1068251664 10:54450155-54450177 ATATTATACTTTAAGTTCTAGGG + Intronic
1068420032 10:56779550-56779572 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1069056686 10:63851702-63851724 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1069354218 10:67564622-67564644 TTGTTATACTTTAAGTTCTAGGG - Intronic
1069355346 10:67579065-67579087 TTGTTATACTTTAAGTTCTAGGG + Intronic
1070847338 10:79534095-79534117 ATGGTGGAGTTTAACTTCTAGGG - Intergenic
1070926458 10:80226197-80226219 ATGGTGGAGTTTAACTTCTAGGG + Intergenic
1071765003 10:88654105-88654127 TTTATATACTTTAAGTTCTAGGG + Intergenic
1072031112 10:91523412-91523434 TTCATCAACTTTAAGTTCCAGGG - Intergenic
1072171132 10:92863074-92863096 ATGATGGACTTTAACAGCTATGG + Intronic
1072406589 10:95159902-95159924 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1072566152 10:96618281-96618303 TTGTTATACTTTAAGTTCTAGGG - Intronic
1073966682 10:108998338-108998360 ATATTATACTTTAAGTTCTAGGG - Intergenic
1074196218 10:111187743-111187765 ACGATGGACTCTAAGTGCTAGGG + Intergenic
1075067578 10:119299824-119299846 TTAATACACTTTAAGTTCTAGGG + Intronic
1077655056 11:4010731-4010753 ATTATATATTTTAAGTTCTAGGG + Intronic
1078295820 11:10069175-10069197 ATATTCTACTTTAAGTTCTAGGG + Intronic
1078875280 11:15388746-15388768 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1078946647 11:16075784-16075806 ATTATATACTTTAAGTTCTAGGG - Intronic
1079757138 11:24279084-24279106 ATATTATACTTTAAGTTCTAGGG + Intergenic
1079965660 11:26977051-26977073 TTATTCTACTTTAAGTTCTAGGG + Intergenic
1079974356 11:27074042-27074064 ATATTATACTTTAAGTTCTAGGG - Intronic
1080435679 11:32240011-32240033 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1081282876 11:41231744-41231766 ATATTATACTTTAAGTTCTAGGG - Intronic
1081505578 11:43713141-43713163 TTGTTATACTTTAAGTTCTAGGG + Intronic
1082049154 11:47756556-47756578 TTGTTATACTTTAAGTTCTAAGG + Intronic
1082256270 11:50036705-50036727 AAGTTATACTTTAAGTTCTACGG - Intergenic
1082265017 11:50108923-50108945 ATGATCTAATTTAAGTTTTGAGG - Intergenic
1082721623 11:56684588-56684610 ATATTATACTTTAAGTTCTAGGG - Intergenic
1082754439 11:57059912-57059934 TTTATATACTTTAAGTTCTAGGG + Intergenic
1086293720 11:85340618-85340640 ATTATATACTTTAAGTTGTAGGG - Intronic
1086295129 11:85357760-85357782 ATTTTATACTTTAAGTTCTAGGG + Intronic
1088096530 11:106107098-106107120 ATGGTCGACGTTGAGTTCTTCGG + Intergenic
1088838831 11:113604951-113604973 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1090369950 11:126243156-126243178 ATAATCTACTTTCTGTTCTATGG - Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1092030634 12:5280812-5280834 ATTTTATACTTTAAGTTCTAGGG + Intergenic
1092439611 12:8487131-8487153 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1094036383 12:26076277-26076299 ATACTTTACTTTAAGTTCTAGGG + Intronic
1094522757 12:31210141-31210163 ATATTATACTTTAAGTTCTAGGG - Intergenic
1094646601 12:32330553-32330575 TTAATTTACTTTAAGTTCTAGGG - Intronic
1095680725 12:44972287-44972309 TTAATATACTTTAAGTTCTAGGG + Intergenic
1095803144 12:46289621-46289643 TTTATATACTTTAAGTTCTAGGG - Intergenic
1096910759 12:54981550-54981572 ATATTATACTTTAAGTTCTAGGG - Intronic
1096924283 12:55125063-55125085 TTATTAGACTTTAAGTTCTAGGG + Intergenic
1096936465 12:55285337-55285359 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1097250007 12:57627372-57627394 TTGTTATACTTTAAGTTCTAGGG - Intronic
1097743134 12:63269069-63269091 TTAATATACTTTAAGTTCTAGGG + Intergenic
1098121901 12:67249550-67249572 ATATTATACTTTAAGTTCTAGGG - Intergenic
1099383416 12:81984270-81984292 ATATTATACTTTAAGTTCTAGGG + Intergenic
1099504027 12:83449897-83449919 ATGATGGACTTTAAGTCCAGCGG - Intergenic
1099510483 12:83529551-83529573 TTAATATACTTTAAGTTCTAGGG - Intergenic
1101070238 12:101066977-101066999 TTGTTATACTTTAAGTTCTAGGG - Intronic
1101298592 12:103453005-103453027 TTGATATACTATAAGTTCTAGGG - Intronic
1101375668 12:104169352-104169374 ATTTTATACTTTAAGTTCTAGGG + Intergenic
1101850489 12:108398060-108398082 ATATTATACTTTAAGTTCTAGGG - Intergenic
1104555546 12:129796858-129796880 ATCTTAGACTTTAAGTTCTGGGG - Intronic
1105244651 13:18638057-18638079 TTATTAGACTTTAAGTTCTAGGG - Intergenic
1106042870 13:26110490-26110512 TTAATATACTTTAAGTTCTAGGG - Intergenic
1106119876 13:26851364-26851386 ATATTATACTTTAAGTTCTAGGG + Intergenic
1106540733 13:30688068-30688090 ATATTATACTTTAAGTTCTAGGG + Intergenic
1106824470 13:33504735-33504757 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1106936972 13:34733684-34733706 ATCATGGAATTTAAGTTCGAAGG + Intergenic
1106959596 13:34983033-34983055 ATTTTATACTTTAAGTTCTAGGG + Intronic
1106969620 13:35122699-35122721 TTTATATACTTTAAGTTCTAGGG - Intronic
1107103200 13:36616277-36616299 ATGATCGACGTTGAGTTCTTTGG + Intergenic
1108052469 13:46460097-46460119 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1108426962 13:50312262-50312284 ATGTTTGACTTCAAGTTCTTAGG + Intronic
1108989336 13:56634898-56634920 ATTATATACTTTAAGTTCTAGGG - Intergenic
1109089886 13:58029125-58029147 ATTATATACTTTAAGTTTTAGGG + Intergenic
1109405030 13:61886667-61886689 ATGATCGGGTTTAAATTCTGGGG - Intergenic
1109538803 13:63746011-63746033 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1109545032 13:63833755-63833777 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1109670510 13:65600609-65600631 ATAAAATACTTTAAGTTCTAGGG - Intergenic
1109977476 13:69857826-69857848 ATATTATACTTTAAGTTCTAGGG - Intronic
1110051805 13:70911250-70911272 TTTATATACTTTAAGTTCTAGGG - Intergenic
1110391795 13:74983049-74983071 ATATTATACTTTAAGTTCTAGGG + Intergenic
1110545770 13:76753648-76753670 ATGGTCGACGTTTAGTTCTTTGG - Intergenic
1110606387 13:77437833-77437855 ATATTATACTTTAAGTTCTAGGG + Intergenic
1110744604 13:79037894-79037916 ATATTATACTTTAAGTTCTAGGG - Intergenic
1111019020 13:82421517-82421539 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1111610584 13:90601615-90601637 ATATTATACTTTAAGTTCTAGGG - Intergenic
1111712635 13:91835863-91835885 TTATTCTACTTTAAGTTCTAGGG - Intronic
1113005744 13:105700088-105700110 ATATTATACTTTAAGTTCTAGGG + Intergenic
1113307999 13:109098987-109099009 ATGTTCGACCTTGAGTTCTTTGG + Intronic
1113974479 13:114216302-114216324 CTGTTATACTTTAAGTTCTAGGG + Intergenic
1114578925 14:23738630-23738652 ATTTTATACTTTAAGTTCTAGGG + Intergenic
1115001943 14:28432664-28432686 TTTATTTACTTTAAGTTCTAGGG - Intergenic
1115009657 14:28529772-28529794 TTAATATACTTTAAGTTCTAGGG + Intergenic
1115259878 14:31440983-31441005 TTGCTATACTTTAAGTTCTAGGG - Intronic
1115362859 14:32523307-32523329 AAATTCTACTTTAAGTTCTAGGG - Intronic
1115417044 14:33147705-33147727 TTATTCTACTTTAAGTTCTAGGG - Intronic
1115663085 14:35516724-35516746 ATGATCCAGATTAACTTCTAGGG + Intergenic
1115819012 14:37193935-37193957 TTCATACACTTTAAGTTCTAGGG - Intergenic
1115850927 14:37589337-37589359 ATTATCAACTTTAAGTTCTTAGG + Intergenic
1115968472 14:38918277-38918299 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1116061778 14:39933015-39933037 CTGCTGGACCTTAAGTTCTAAGG + Intergenic
1116201037 14:41795905-41795927 TTTATATACTTTAAGTTCTAGGG - Intronic
1116373815 14:44171734-44171756 ATGTTATGCTTTAAGTTCTAGGG + Intergenic
1116377111 14:44216876-44216898 AAATTCTACTTTAAGTTCTAGGG - Intergenic
1116604335 14:46969913-46969935 ATGGAATACTTTAAGTTCTAAGG - Intronic
1118343145 14:64913302-64913324 TTAATATACTTTAAGTTCTAGGG + Intergenic
1118492900 14:66278941-66278963 TTATTCTACTTTAAGTTCTAGGG - Intergenic
1119884310 14:78127658-78127680 ATATTATACTTTAAGTTCTAGGG + Intergenic
1202916322 14_GL000194v1_random:176350-176372 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1123692161 15:22847342-22847364 ACTATATACTTTAAGTTCTATGG - Intronic
1124512430 15:30338719-30338741 ATCATAGACTTTAAATCCTAAGG + Intergenic
1124730484 15:32192032-32192054 ATCATAGACTTTAAATCCTAAGG - Intergenic
1125249149 15:37679368-37679390 TTTTTCTACTTTAAGTTCTAGGG - Intergenic
1125331482 15:38586841-38586863 TTAATATACTTTAAGTTCTAGGG - Intergenic
1127551976 15:60048868-60048890 ATTTTATACTTTAAGTTCTAGGG + Intronic
1128493230 15:68171938-68171960 ATAAAATACTTTAAGTTCTATGG + Intronic
1129438636 15:75562523-75562545 ATGATTGTCTTTAAGATATAGGG - Intronic
1129963955 15:79716466-79716488 ATATTATACTTTAAGTTCTAGGG - Intergenic
1130205321 15:81870104-81870126 TTATTCTACTTTAAGTTCTAGGG + Intergenic
1130283213 15:82534986-82535008 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1130736928 15:86560152-86560174 TTTATATACTTTAAGTTCTAGGG + Intronic
1131556132 15:93401020-93401042 TTAATATACTTTAAGTTCTAGGG + Intergenic
1131774232 15:95776285-95776307 TTGTTGTACTTTAAGTTCTAGGG - Intergenic
1131814307 15:96206553-96206575 ATAAAATACTTTAAGTTCTAGGG - Intergenic
1131947699 15:97644784-97644806 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1132439230 15:101842075-101842097 ATATTATACTTTAAGTTCTAGGG + Intergenic
1136122999 16:28152832-28152854 TGGATTGAATTTAAGTTCTAAGG - Intronic
1137303647 16:47179452-47179474 TTTATATACTTTAAGTTCTAGGG - Intronic
1137462768 16:48680402-48680424 TTAATATACTTTAAGTTCTAGGG - Intergenic
1137938367 16:52657360-52657382 AAGATCTACTTTAGATTCTAAGG + Intergenic
1138704158 16:58896902-58896924 TTTTTCTACTTTAAGTTCTAGGG - Intergenic
1138929251 16:61632617-61632639 ATATTATACTTTAAGTTCTAGGG + Intergenic
1141170638 16:81688670-81688692 TTAATATACTTTAAGTTCTAGGG + Intronic
1141495912 16:84409429-84409451 TTGTTATACTTTAAGTTCTAGGG - Intronic
1145726235 17:27128493-27128515 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1146076786 17:29737943-29737965 ATATTATACTTTAAGTTCTAGGG + Intronic
1146103557 17:30009823-30009845 TTGTTATACTTTAAGTTCTAGGG + Intronic
1148518336 17:48243563-48243585 ATCAGGGACTTTAAGTTCTTTGG - Intronic
1149167940 17:53775872-53775894 TTTATATACTTTAAGTTCTAGGG - Intergenic
1150047559 17:61928181-61928203 ATGATGAAATTTAAGTTCTGAGG - Intergenic
1151502645 17:74501412-74501434 TTTATATACTTTAAGTTCTAGGG + Intergenic
1153005689 18:497327-497349 ATGAACTTCTTTAACTTCTATGG + Intronic
1153094563 18:1385501-1385523 ATTTTATACTTTAAGTTCTAGGG - Intergenic
1153441811 18:5128113-5128135 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1153965138 18:10173578-10173600 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1154184107 18:12166736-12166758 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1154288019 18:13078646-13078668 TTGTTATACTTTAAGTTCTAGGG + Intronic
1154374067 18:13794338-13794360 ATATTGTACTTTAAGTTCTAGGG + Intergenic
1154444287 18:14421843-14421865 TTATTAGACTTTAAGTTCTAGGG + Intergenic
1155409226 18:25524026-25524048 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1155640559 18:28008722-28008744 ATATTATACTTTAAGTTCTAGGG - Intronic
1155803023 18:30132556-30132578 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1156989810 18:43395424-43395446 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1157648471 18:49302562-49302584 ATGATGGACTTTAAACTTTATGG - Intronic
1157787518 18:50498531-50498553 TTTATATACTTTAAGTTCTAGGG + Intergenic
1157937287 18:51887268-51887290 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1158043398 18:53125346-53125368 ATAATGCTCTTTAAGTTCTAAGG + Intronic
1158486800 18:57874490-57874512 TTTATATACTTTAAGTTCTAGGG - Intergenic
1158857503 18:61557945-61557967 AAGTTATACTTTAAGTTCTAGGG + Intergenic
1158875258 18:61728012-61728034 ATATTATACTTTAAGTTCTAGGG + Intergenic
1159321774 18:66860500-66860522 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1159476563 18:68928366-68928388 ATTATCAACTGTAATTTCTAGGG - Intronic
1159610136 18:70515631-70515653 ATATTATACTTTAAGTTCTAGGG + Intergenic
1159714742 18:71807359-71807381 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1159877016 18:73823499-73823521 TTAATATACTTTAAGTTCTAGGG - Intergenic
1161639044 19:5408477-5408499 ATGATAGACTTTTAGATCCACGG - Intergenic
1163063698 19:14777506-14777528 TTTTTAGACTTTAAGTTCTAGGG + Intronic
1164118979 19:22248465-22248487 ATAAAATACTTTAAGTTCTAGGG - Intergenic
1165261258 19:34620645-34620667 AATATATACTTTAAGTTCTAGGG - Intronic
1165722898 19:38092347-38092369 ATATTATACTTTAAGTTCTAGGG - Intronic
1165918978 19:39280641-39280663 ATGGTCGACGTTGAGTTCTTCGG - Intergenic
1167178091 19:47879907-47879929 TTGTTATACTTTAAGTTCTAGGG - Intronic
1167819243 19:51910883-51910905 AAAATATACTTTAAGTTCTAGGG - Intronic
925215780 2:2094901-2094923 TTTATATACTTTAAGTTCTAGGG - Intronic
925580036 2:5401008-5401030 ATATTATACTTTAAGTTCTAGGG - Intergenic
925630706 2:5890136-5890158 TTGTTATACTTTAAGTTCTAGGG + Intergenic
927248076 2:20974027-20974049 ATTAGGGACTTTAACTTCTATGG + Intergenic
928934737 2:36663837-36663859 ATGATCGAATTGAGGTTTTAAGG - Intergenic
929317274 2:40494622-40494644 ATATTATACTTTAAGTTCTAGGG - Intronic
929927266 2:46224369-46224391 AAATTAGACTTTAAGTTCTAGGG - Intergenic
931112146 2:59122896-59122918 TTGTTATACTTTAAGTTCTAGGG + Intergenic
931563220 2:63586886-63586908 TTGTTATACTTTAAGTTCTAGGG + Intronic
932264878 2:70359196-70359218 ATTATATACTTTAAGTTTTAGGG + Intergenic
933268716 2:80210225-80210247 TTATTAGACTTTAAGTTCTAGGG + Intronic
933485847 2:82922787-82922809 ATGTTATACTTTGAGTTCTAGGG + Intergenic
933642329 2:84777224-84777246 TTGTTATACTTTAAGTTCTAGGG - Intronic
936623245 2:114121826-114121848 ATGATCCTTTTTCAGTTCTAGGG + Intergenic
936911741 2:117600878-117600900 ATATTATACTTTAAGTTCTAGGG - Intergenic
936931816 2:117797703-117797725 TTGTTATACTTTAAGTTCTAGGG - Intergenic
937719666 2:125079364-125079386 ATATTATACTTTAAGTTCTAGGG + Intergenic
939047600 2:137268165-137268187 TTTATATACTTTAAGTTCTAGGG + Intronic
939345870 2:140965567-140965589 TTATTAGACTTTAAGTTCTAGGG + Intronic
939526732 2:143304583-143304605 ATTATATACTTTAAGTTGTAGGG - Intronic
939796284 2:146647971-146647993 TTGTTATACTTTAAGTTCTAGGG - Intergenic
940716060 2:157224980-157225002 ATATTATACTTTAAGTTCTAGGG - Intergenic
941248025 2:163125089-163125111 TTGTTACACTTTAAGTTCTAGGG - Intergenic
941970881 2:171349974-171349996 TTGTTATACTTTAAGTTCTAAGG + Intronic
942414018 2:175739379-175739401 ATATTATACTTTAAGTTCTAGGG - Intergenic
944269986 2:197771476-197771498 TTTATATACTTTAAGTTCTAGGG - Intronic
944623774 2:201548062-201548084 TTAATGTACTTTAAGTTCTAGGG + Intronic
945339740 2:208638857-208638879 AGGAAAGACTTTCAGTTCTAGGG - Intronic
946530112 2:220561556-220561578 ATATTACACTTTAAGTTCTAGGG - Intergenic
946794609 2:223336632-223336654 ATATTATACTTTAAGTTCTAGGG - Intergenic
946795389 2:223345713-223345735 ATATTATACTTTAAGTTCTAGGG - Intergenic
1169634078 20:7667282-7667304 ATGCTCCATTCTAAGTTCTAGGG - Intergenic
1169927462 20:10797730-10797752 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1170222817 20:13959062-13959084 ATGGTCGACGTTAAGTTCTTTGG - Intronic
1170478300 20:16739149-16739171 ATGACAGACTTTAAACTCTAAGG + Intronic
1170494063 20:16907447-16907469 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1171246626 20:23615341-23615363 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1171264373 20:23758953-23758975 TTTTTAGACTTTAAGTTCTAGGG - Intergenic
1171371897 20:24667824-24667846 ATGATCCACTTTAAGTTCAAAGG + Intergenic
1171570476 20:26245383-26245405 AAAATATACTTTAAGTTCTAGGG - Intergenic
1174861403 20:54095073-54095095 AAATTCTACTTTAAGTTCTAGGG + Intergenic
1176451698 21:6868028-6868050 TTATTAGACTTTAAGTTCTACGG - Intergenic
1176635675 21:9190996-9191018 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1176637719 21:9264133-9264155 TTATTCTACTTTAAGTTCTAGGG + Intergenic
1176829868 21:13733079-13733101 TTATTAGACTTTAAGTTCTAGGG - Intergenic
1177478716 21:21658004-21658026 ATATTATACTTTAAGTTCTAGGG - Intergenic
1177678027 21:24327968-24327990 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1178107657 21:29338041-29338063 ATATTATACTTTAAGTTCTAGGG - Intronic
1179055714 21:37931477-37931499 AAGATGGACTTTAATTTCAAAGG + Intergenic
1179058904 21:37961531-37961553 ATGATAGAATTTATCTTCTATGG + Intronic
1180421761 22:12871630-12871652 TTATTCTACTTTAAGTTCTAGGG + Intergenic
1182381816 22:29896381-29896403 ATGGTCGACATTGAGTTCTTCGG + Intronic
1182396863 22:30042427-30042449 ATGATAGAATTGATGTTCTATGG + Intergenic
1182997015 22:34822902-34822924 ATATTATACTTTAAGTTCTAGGG - Intergenic
949872976 3:8605371-8605393 TTTATATACTTTAAGTTCTATGG + Intergenic
952987963 3:38803778-38803800 TTTATATACTTTAAGTTCTAGGG - Intergenic
954528023 3:51290664-51290686 ATATTATACTTTAAGTTCTAGGG - Intronic
955669195 3:61384406-61384428 TTGTTATACTTTAAGTTCTAGGG - Intergenic
956113213 3:65891867-65891889 ATATTATACTTTAAGTTCTAGGG - Intronic
956317442 3:67953918-67953940 ATATTATACTTTAAGTTCTAGGG - Intergenic
957373748 3:79330240-79330262 ATATTATACTTTAAGTTCTAGGG - Intronic
957489709 3:80907740-80907762 TTTTTCTACTTTAAGTTCTAGGG - Intergenic
957780240 3:84809773-84809795 TTTATATACTTTAAGTTCTAGGG + Intergenic
957783668 3:84851186-84851208 TTAATATACTTTAAGTTCTAGGG + Intergenic
958110317 3:89134121-89134143 ATGGTCAACTTTGAGTTCTTCGG + Intronic
958163506 3:89849351-89849373 ATATTATACTTTAAGTTCTAGGG - Intergenic
958619075 3:96533140-96533162 TTGTTATACTTTAAGTTCTAGGG - Intergenic
958672543 3:97223086-97223108 AAGATCTCCTTTAATTTCTATGG - Intronic
958885780 3:99725426-99725448 ATTATATACTTTAAGTTTTAGGG + Intronic
959078680 3:101778248-101778270 TTAATATACTTTAAGTTCTAGGG - Intergenic
959108485 3:102093684-102093706 ATCATAGACTTTACATTCTAGGG - Intergenic
959215823 3:103448767-103448789 TTGTTATACTTTAAGTTCTAGGG + Intergenic
959498537 3:107078807-107078829 TTTATATACTTTAAGTTCTAGGG + Intergenic
960612000 3:119563191-119563213 TTATTCTACTTTAAGTTCTAGGG + Intergenic
961716721 3:128862711-128862733 ATATTATACTTTAAGTTCTAAGG - Intergenic
961993317 3:131215402-131215424 TTGTTATACTTTAAGTTCTAGGG - Intronic
963101098 3:141604885-141604907 TTGTTATACTTTAAGTTCTAGGG - Intronic
963316290 3:143762320-143762342 ATTTTATACTTTAAGTTCTAGGG - Intronic
964738485 3:159941087-159941109 TTTATATACTTTAAGTTCTAGGG - Intergenic
964804540 3:160593666-160593688 TTTATATACTTTAAGTTCTAGGG - Intergenic
965182820 3:165426567-165426589 TTAATATACTTTAAGTTCTAGGG + Intergenic
965204650 3:165705745-165705767 TTAATATACTTTAAGTTCTAGGG - Intergenic
965218816 3:165900351-165900373 TTGTTATACTTTAAGTTCTAGGG + Intergenic
965259512 3:166463205-166463227 ATGATAGAGTTTAATTTCAAAGG + Intergenic
966114723 3:176448151-176448173 ATAAAATACTTTAAGTTCTAGGG + Intergenic
967568328 3:190997823-190997845 TTGTTATACTTTAAGTTCTAGGG + Intergenic
967569339 3:191010553-191010575 TTATTCTACTTTAAGTTCTAGGG + Intergenic
967895578 3:194393842-194393864 TTTATATACTTTAAGTTCTAGGG + Intergenic
1202749176 3_GL000221v1_random:140888-140910 TTATTCTACTTTAAGTTCTAGGG - Intergenic
969976312 4:11105607-11105629 TTAATATACTTTAAGTTCTAGGG - Intergenic
971665911 4:29484465-29484487 ATGGTCGACGTTGAGTTCTTCGG + Intergenic
972868610 4:43267780-43267802 ATAATATACTTTAAGTTCTAGGG + Intergenic
973103929 4:46307380-46307402 ATGATCTACTTTACGTTGGAAGG + Intronic
973632038 4:52828614-52828636 TTGTTATACTTTAAGTTCTAGGG + Intergenic
974702961 4:65474150-65474172 TTGTTATACTTTAAGTTCTAGGG - Intronic
974735535 4:65926959-65926981 TTATTAGACTTTAAGTTCTAAGG + Intergenic
974758346 4:66242694-66242716 TTTATATACTTTAAGTTCTAGGG + Intergenic
974827100 4:67145042-67145064 TTGTTATACTTTAAGTTCTAGGG - Intergenic
975035721 4:69678184-69678206 ATATTATACTTTAAGTTCTAGGG + Intergenic
975218183 4:71781365-71781387 TTGTTATACTTTAAGTTCTAGGG - Intronic
976024392 4:80670000-80670022 AAAATATACTTTAAGTTCTAGGG + Intronic
976359533 4:84161291-84161313 ATATTATACTTTAAGTTCTAGGG + Intergenic
976383266 4:84424766-84424788 ATATTATACTTTAAGTTCTAGGG - Intergenic
976992877 4:91390568-91390590 ATAAAATACTTTAAGTTCTAGGG - Intronic
977537585 4:98272991-98273013 ATGGTCGACATTGAGTTCTTCGG + Intronic
977829964 4:101578602-101578624 TTTTTCTACTTTAAGTTCTATGG - Intronic
977857310 4:101909521-101909543 GTGTTATACTTTAAGTTCTAGGG - Intronic
977931664 4:102756608-102756630 TTGTTATACTTTAAGTTCTAGGG - Intronic
978123084 4:105105014-105105036 TTAATATACTTTAAGTTCTAGGG + Intergenic
978465093 4:109000095-109000117 TTGTTATACTTTAAGTTCTAGGG - Intronic
978547295 4:109884902-109884924 TTGTTATACTTTAAGTTCTAGGG + Intergenic
978714660 4:111826909-111826931 AAGATCGACATTGAGTTCTTCGG + Intergenic
979423058 4:120530399-120530421 AATATATACTTTAAGTTCTAGGG + Intergenic
980001125 4:127489181-127489203 GTAATATACTTTAAGTTCTAGGG + Intergenic
980551089 4:134336207-134336229 TTGTTATACTTTAAGTTCTAGGG + Intergenic
980696541 4:136363658-136363680 TTTATATACTTTAAGTTCTAGGG - Intergenic
981108304 4:140906093-140906115 AAGAGCACCTTTAAGTTCTAAGG - Intronic
982580602 4:157174902-157174924 TTAATAGACTTTAAGTTTTAGGG + Intergenic
983183186 4:164672226-164672248 TTTATATACTTTAAGTTCTAGGG - Intergenic
983278183 4:165644301-165644323 TTTATATACTTTAAGTTCTAGGG - Intergenic
983451327 4:167914681-167914703 TTTATATACTTTAAGTTCTAGGG - Intergenic
983729393 4:170974881-170974903 TTGATCCACTTTGAGTTGTATGG + Intergenic
983963392 4:173781087-173781109 ATGTTATACTTTAAGTTTTAGGG - Intergenic
984160452 4:176246026-176246048 TTTATATACTTTAAGTTCTAGGG - Intronic
984384424 4:179036358-179036380 TTGTTATACTTTAAGTTCTAGGG - Intergenic
984518777 4:180775250-180775272 TTTATATACTTTAAGTTCTAGGG + Intergenic
984538742 4:181010827-181010849 TTGTTATACTTTAAGTTCTAGGG + Intergenic
985141161 4:186841372-186841394 TTTATATACTTTAAGTTCTAGGG + Intergenic
1202752617 4_GL000008v2_random:22549-22571 TTATTCTACTTTAAGTTCTAGGG + Intergenic
985917629 5:2935506-2935528 TTAATATACTTTAAGTTCTAGGG - Intergenic
986871969 5:12059184-12059206 ATAAAATACTTTAAGTTCTAGGG - Intergenic
987908743 5:24114209-24114231 ATATTATACTTTAAGTTCTAGGG + Intronic
987985811 5:25144324-25144346 TTTATATACTTTAAGTTCTAGGG - Intergenic
988049028 5:25999426-25999448 ATATTATACTTTAAGTTCTAGGG - Intergenic
988096241 5:26614555-26614577 ATATTATACTTTAAGTTCTAGGG + Intergenic
988908772 5:35818159-35818181 TTGTTATACTTTAAGTTCTAGGG + Intergenic
989551818 5:42744396-42744418 TTGTTATACTTTAAGTTCTAGGG - Intergenic
989666882 5:43864742-43864764 ATTTTATACTTTAAGTTCTAGGG - Intergenic
990096539 5:52120996-52121018 ATGAGTGACTTAAAATTCTAAGG + Intergenic
990827730 5:59920994-59921016 TTAATATACTTTAAGTTCTAGGG - Intronic
990888510 5:60621663-60621685 AGGGTATACTTTAAGTTCTAGGG - Intronic
991196488 5:63940452-63940474 ATGGTCAACTTTGAATTCTATGG - Intergenic
991424860 5:66480189-66480211 TTGTTATACTTTAAGTTCTAGGG + Intergenic
992307268 5:75454718-75454740 ATGGTCGACATTGAGTTCTTCGG - Intronic
992772627 5:80062546-80062568 TTGTTATACTTTAAGTTCTAGGG + Intronic
992811287 5:80391155-80391177 TTTATATACTTTAAGTTCTAGGG + Intergenic
992853951 5:80840917-80840939 TTAATATACTTTAAGTTCTAGGG + Intronic
992972733 5:82079378-82079400 TTTATATACTTTAAGTTCTAGGG + Intronic
992973403 5:82085618-82085640 TTGTTATACTTTAAGTTCTAGGG - Intronic
993117708 5:83737129-83737151 ATAAAATACTTTAAGTTCTAGGG + Intergenic
993171685 5:84428378-84428400 TTGTTATACTTTAAGTTCTAGGG + Intergenic
993296335 5:86146255-86146277 TTGTTTTACTTTAAGTTCTAGGG + Intergenic
993525745 5:88963577-88963599 ATTTTTTACTTTAAGTTCTAGGG - Intergenic
993592124 5:89807010-89807032 ATTTTGTACTTTAAGTTCTAGGG - Intergenic
994497669 5:100534616-100534638 TTAATATACTTTAAGTTCTAGGG + Intergenic
994647992 5:102493046-102493068 TTAATACACTTTAAGTTCTAGGG - Intronic
995270297 5:110212879-110212901 TTGTTACACTTTAAGTTCTAGGG + Intergenic
995413772 5:111886952-111886974 TTAATCTACTTTAAGTTTTAGGG - Intronic
995690106 5:114816261-114816283 ATGTTATACTTTAAGTTCTAGGG + Intergenic
995993194 5:118267452-118267474 ATTATATACTTTAAGTTCTAGGG - Intergenic
996175672 5:120353188-120353210 TTTATTTACTTTAAGTTCTAGGG - Intergenic
996276939 5:121678305-121678327 TTTATATACTTTAAGTTCTAGGG - Intergenic
996314556 5:122147386-122147408 TTTATATACTTTAAGTTCTAGGG + Intronic
996333555 5:122358217-122358239 ATAAAATACTTTAAGTTCTAGGG + Intronic
996355555 5:122592551-122592573 TTTATATACTTTAAGTTCTAGGG + Intergenic
996419876 5:123250942-123250964 GTGTTACACTTTAAGTTCTAGGG + Intergenic
997172330 5:131735438-131735460 ATAAAATACTTTAAGTTCTAGGG - Intronic
998329374 5:141310488-141310510 TTTATATACTTTAAGTTCTAGGG + Intergenic
998580796 5:143373591-143373613 ATATTATACTTTAAGTTCTAGGG - Intronic
998720036 5:144934374-144934396 ATTATTAACTTTAAGTTTTAGGG - Intergenic
999675112 5:153992039-153992061 ATGATAGGATTTAACTTCTAAGG - Exonic
999738232 5:154528854-154528876 TTAATATACTTTAAGTTCTAGGG - Intergenic
1000505314 5:162109371-162109393 ATATTATACTTTAAGTTCTAGGG - Intronic
1001355309 5:171016545-171016567 TTGTTATACTTTAAGTTCTAGGG + Intronic
1001912838 5:175535145-175535167 TTTATATACTTTAAGTTCTAAGG + Intergenic
1003691307 6:8356421-8356443 TTATTCTACTTTAAGTTCTAGGG - Intergenic
1004416393 6:15428280-15428302 TTGTTATACTTTAAGTTCTAGGG + Intronic
1004964419 6:20831861-20831883 ATGGTCGACGTTGAGTTCTTCGG + Intronic
1005664384 6:28036478-28036500 ATAAAATACTTTAAGTTCTAAGG - Intergenic
1005697867 6:28367898-28367920 ATTTTATACTTTAAGTTCTAGGG + Exonic
1007158349 6:39768277-39768299 ATATTATACTTTAAGTTCTAGGG - Intergenic
1007885322 6:45221350-45221372 ATATTATACTTTAAGTTCTAGGG - Intronic
1007892546 6:45308721-45308743 TTGTTATACTTTAAGTTCTAGGG - Intronic
1008505432 6:52225397-52225419 ATGATCGATTTTGGGTTTTAGGG - Intergenic
1008715262 6:54281174-54281196 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1008767953 6:54942448-54942470 AAGATTAACTTGAAGTTCTACGG + Intergenic
1009002154 6:57731263-57731285 ATTATATACTTTAAGTTCTAGGG + Intergenic
1009449018 6:63779760-63779782 TTGTTATACTTTAAGTTCTAGGG + Intronic
1009728158 6:67560750-67560772 ATGTTCAACTTTATGTTCTTGGG + Intergenic
1010121476 6:72380376-72380398 ATATTATACTTTAAGTTCTAGGG - Intronic
1010683329 6:78821829-78821851 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1010727582 6:79352902-79352924 TTAATATACTTTAAGTTCTAGGG - Intergenic
1010789433 6:80048098-80048120 ATATTATACTTTAAGTTCTATGG + Intergenic
1011455358 6:87542944-87542966 ATTTTATACTTTAAGTTCTAGGG - Intronic
1011874303 6:91938298-91938320 ATTATTTACTTTAAGTTTTAGGG + Intergenic
1011908289 6:92402035-92402057 TTTATATACTTTAAGTTCTAGGG + Intergenic
1012204892 6:96449397-96449419 TTTATATACTTTAAGTTCTAGGG + Intergenic
1012726870 6:102824772-102824794 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1012842458 6:104346363-104346385 ATGGTTGACATTAAGTTCTTCGG - Intergenic
1012984307 6:105858524-105858546 TTCATATACTTTAAGTTCTAGGG + Intergenic
1013406126 6:109845635-109845657 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1013526677 6:110981055-110981077 ATAATCTACTTTATGTTCAATGG - Intergenic
1013998693 6:116340501-116340523 TTATTCTACTTTAAGTTCTAGGG + Intronic
1014097338 6:117474698-117474720 TTAATATACTTTAAGTTCTAGGG - Intronic
1014133709 6:117864081-117864103 ATATTATACTTTAAGTTCTAGGG + Intergenic
1014650650 6:124032390-124032412 TTAATATACTTTAAGTTCTAGGG - Intronic
1015548502 6:134386979-134387001 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1016196293 6:141346576-141346598 AAAATATACTTTAAGTTCTAGGG + Intergenic
1017513852 6:155138443-155138465 TTAATATACTTTAAGTTCTAGGG + Intronic
1018099392 6:160422843-160422865 AAGTTATACTTTAAGTTCTAGGG + Intronic
1018307394 6:162472216-162472238 TTTATATACTTTAAGTTCTAGGG + Intronic
1019880052 7:3850987-3851009 TTGTTATACTTTAAGTTCTAGGG - Intronic
1020554621 7:9655415-9655437 ATATTATACTTTAAGTTCTAGGG + Intergenic
1020711954 7:11617966-11617988 TTGTTATACTTTAAGTTCTAGGG - Intronic
1020780072 7:12506770-12506792 ATTTTATACTTTAAGTTCTAGGG - Intergenic
1021771676 7:24008982-24009004 ATATTATACTTTAAGTTCTAGGG + Intergenic
1021797614 7:24272992-24273014 ATATTATACTTTAAGTTCTAGGG + Intergenic
1022119208 7:27291105-27291127 TTATTCTACTTTAAGTTCTAGGG + Intergenic
1022347851 7:29534531-29534553 ATTATATACTTTAAGTTCTAGGG - Intergenic
1022635406 7:32128884-32128906 TTGTTATACTTTAAGTTCTAGGG - Intronic
1022950177 7:35331061-35331083 TTATTAGACTTTAAGTTCTAGGG + Intergenic
1024459210 7:49642849-49642871 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1024475072 7:49800933-49800955 AAGATTGATTTTAACTTCTAAGG + Intronic
1024822383 7:53348039-53348061 ATATTATACTTTAAGTTCTAGGG - Intergenic
1025214963 7:57048531-57048553 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1025656989 7:63528286-63528308 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1026537375 7:71251030-71251052 TTGTTATACTTTAAGTTCTAGGG + Intronic
1027335135 7:77142342-77142364 ATATTATACTTTAAGTTCTAGGG + Intronic
1027534402 7:79378968-79378990 ATATTAAACTTTAAGTTCTAGGG + Intronic
1027691339 7:81349743-81349765 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1028257732 7:88621153-88621175 ATATTATACTTTAAGTTCTAGGG - Intergenic
1029780656 7:102728718-102728740 ATATTATACTTTAAGTTCTAGGG - Intergenic
1029783911 7:102766288-102766310 AGGCTCTATTTTAAGTTCTATGG + Intronic
1030154176 7:106436479-106436501 TTTATTTACTTTAAGTTCTAGGG + Intergenic
1030459658 7:109817106-109817128 ATAAAATACTTTAAGTTCTAGGG + Intergenic
1030462972 7:109863621-109863643 TTTATATACTTTAAGTTCTAGGG - Intergenic
1030540679 7:110826816-110826838 TTAATATACTTTAAGTTCTAGGG - Intronic
1030561746 7:111095685-111095707 ATCATCCACTATAAGTTTTAAGG + Intronic
1030966146 7:115995324-115995346 TTAATATACTTTAAGTTCTAGGG - Intronic
1031428536 7:121637144-121637166 ATATTATACTTTAAGTTCTAGGG - Intergenic
1031462825 7:122072680-122072702 ATTTTATACTTTAAGTTCTAGGG + Intergenic
1031517262 7:122716658-122716680 TTGTTATACTTTAAGTTCTAGGG - Intronic
1035121128 7:156568048-156568070 ATTCTATACTTTAAGTTCTAGGG + Intergenic
1035861347 8:3031444-3031466 TTGTTAGACTTTAAGTTTTAGGG - Intronic
1038103004 8:24400649-24400671 ATATTATACTTTAAGTTCTAGGG + Intronic
1039459705 8:37733833-37733855 ATGATAAACTTTAAGTTGTATGG - Intergenic
1039626309 8:39058474-39058496 ATGATTAAGTTTAAGTTCAATGG - Intronic
1040141278 8:43918134-43918156 ATGATGCACTTTCAGTCCTACGG + Intergenic
1041783079 8:61599449-61599471 TTAATATACTTTAAGTTCTAGGG - Intronic
1041990994 8:63991542-63991564 TTAATTTACTTTAAGTTCTAGGG - Intergenic
1043208687 8:77482146-77482168 ATTAAAGACTTTAATTTCTATGG - Intergenic
1043614536 8:82109143-82109165 ATATTATACTTTAAGTTCTAGGG - Intergenic
1044069769 8:87742989-87743011 ATATTATACTTTAAGTTCTAGGG - Intergenic
1044251582 8:90009017-90009039 ATGATCTGCCTTAAGTTTTAAGG - Intronic
1044548837 8:93489356-93489378 ATATTATACTTTAAGTTCTAGGG - Intergenic
1045123841 8:99067622-99067644 AAGTTATACTTTAAGTTCTAGGG - Intronic
1045603023 8:103739508-103739530 ATATTATACTTTAAGTTCTAGGG - Intronic
1046732486 8:117740340-117740362 ATATTATACTTTAAGTTCTAGGG + Intergenic
1046736920 8:117786849-117786871 TTATTAGACTTTAAGTTCTAGGG + Intergenic
1047299266 8:123598906-123598928 ATATTATACTTTAAGTTCTAGGG - Intergenic
1047707150 8:127511113-127511135 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1047736408 8:127769168-127769190 ATTTTATACTTTAAGTTCTAGGG + Intergenic
1048122221 8:131594724-131594746 ATATTATACTTTAAGTTCTAGGG + Intergenic
1048414033 8:134206448-134206470 ATGGTCGACATTGAGTTCTTTGG + Intergenic
1048729912 8:137426985-137427007 TTGTTTTACTTTAAGTTCTAGGG + Intergenic
1050462505 9:5888735-5888757 ATGATCGACGTTGAGTTCTTCGG - Intronic
1050650151 9:7767168-7767190 TTAATATACTTTAAGTTCTAGGG + Intergenic
1050678137 9:8079474-8079496 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1050985628 9:12078528-12078550 TTCATATACTTTAAGTTCTAGGG + Intergenic
1051042616 9:12830853-12830875 ATGGTCGACGTTGAGTTCTTTGG + Intergenic
1051555241 9:18375355-18375377 ATATTATACTTTAAGTTCTAGGG + Intergenic
1052392845 9:27901392-27901414 AATATATACTTTAAGTTCTAGGG + Intergenic
1052566865 9:30165821-30165843 TTTATACACTTTAAGTTCTAGGG + Intergenic
1053561834 9:39204193-39204215 TTTATATACTTTAAGTTCTAGGG - Intronic
1054135284 9:61414759-61414781 TTTATATACTTTAAGTTCTAGGG + Intergenic
1054997930 9:71413226-71413248 TTGTTATACTTTAAGTTCTAGGG - Intronic
1055165775 9:73190882-73190904 TTGTTGTACTTTAAGTTCTAGGG - Intergenic
1055268712 9:74530735-74530757 ATATTATACTTTAAGTTCTAGGG + Intronic
1055617581 9:78089021-78089043 ATATTATACTTTAAGTTCTAGGG - Intergenic
1056032763 9:82570110-82570132 TTAATATACTTTAAGTTCTAGGG - Intergenic
1056347895 9:85717691-85717713 TTAATATACTTTAAGTTCTAGGG + Intronic
1057325123 9:94055732-94055754 TTTATATACTTTAAGTTCTAGGG - Intronic
1058096999 9:100872903-100872925 ATATTATACTTTAAGTTCTAGGG - Intergenic
1059056915 9:110993136-110993158 TTAATATACTTTAAGTTCTAGGG + Intronic
1059865600 9:118510649-118510671 ATTATTTACTTTAAGTTCTAGGG - Intergenic
1060610445 9:124959550-124959572 ATAAAATACTTTAAGTTCTAGGG + Intronic
1203517484 Un_GL000213v1:16489-16511 TTATTAGACTTTAAGTTCTAGGG + Intergenic
1203758452 Un_GL000218v1:158304-158326 GTGTTATACTTTAAGTTCTAGGG - Intergenic
1203411280 Un_KI270579v1:7820-7842 ATTATATACTTTAAGTTTTAGGG - Intergenic
1203717813 Un_KI270742v1:170978-171000 TTATTCTACTTTAAGTTCTAGGG - Intergenic
1185881066 X:3741367-3741389 TTATTCTACTTTAAGTTCTAGGG - Intergenic
1186184753 X:7009815-7009837 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1186351015 X:8739688-8739710 AAGGTCGACTTTGAGTTCCATGG + Intergenic
1186668343 X:11742516-11742538 ATACTAGATTTTAAGTTCTAGGG - Intergenic
1186803745 X:13118778-13118800 TTTATATACTTTAAGTTCTAGGG - Intergenic
1187596384 X:20777292-20777314 TTATTCTACTTTAAGTTCTAGGG - Intergenic
1188110057 X:26186323-26186345 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1188874562 X:35414188-35414210 TTTATATACTTTAAGTTCTAGGG + Intergenic
1188951140 X:36376635-36376657 TTGTTATACTTTAAGTTCTAGGG + Intronic
1190126040 X:47706499-47706521 ATCCTCTACTTTAAGTTCAATGG + Intergenic
1190767343 X:53486440-53486462 ATGATACAGTTTAAGTTCAAAGG + Intergenic
1191113250 X:56824728-56824750 TTATTCTACTTTAAGTTCTAGGG - Intergenic
1192000958 X:67150932-67150954 ATATTTTACTTTAAGTTCTATGG + Intergenic
1192012125 X:67285748-67285770 ATAATATACTTTAAGTTCTGGGG + Intergenic
1192253442 X:69433736-69433758 TTAATAAACTTTAAGTTCTAGGG + Intergenic
1192567411 X:72176763-72176785 ATATTATACTTTAAGTTCTAGGG - Intergenic
1192754566 X:74033955-74033977 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1192948543 X:75991631-75991653 ATACTATACTTTAAGTTCTAGGG + Intergenic
1193030433 X:76892281-76892303 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1193338781 X:80321389-80321411 TTTATATACTTTAAGTTCTAGGG - Intergenic
1193339177 X:80325552-80325574 ATAAAATACTTTAAGTTCTAGGG - Intergenic
1193579547 X:83247312-83247334 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1194454498 X:94085531-94085553 TTAATATACTTTAAGTTCTAGGG + Intergenic
1194652302 X:96530534-96530556 ATATTATACTTTAAGTTCTAGGG - Intergenic
1194943754 X:100043710-100043732 ATATTATACTTTAAGTTCTAGGG + Intergenic
1194989774 X:100534649-100534671 TTATTCTACTTTAAGTTCTAGGG - Intergenic
1195155012 X:102114036-102114058 AAATTAGACTTTAAGTTCTAGGG - Intergenic
1195342903 X:103922219-103922241 GTGCTATACTTTAAGTTCTAGGG + Intronic
1195787381 X:108542120-108542142 TTGTTATACTTTAAGTTCTAGGG + Intronic
1195788706 X:108557937-108557959 ATTTTGTACTTTAAGTTCTAGGG + Intronic
1196147379 X:112332810-112332832 ATTGTTAACTTTAAGTTCTAGGG - Intergenic
1196547628 X:116981590-116981612 ATATTCTACTTTAAGTTCTGGGG - Intergenic
1197123805 X:122920986-122921008 TTAATATACTTTAAGTTCTAGGG - Intergenic
1197347458 X:125341819-125341841 ATTATATACTTTAAGTTCTAGGG + Intergenic
1197527438 X:127579940-127579962 TTATTCTACTTTAAGTTCTAGGG + Intergenic
1197528121 X:127587424-127587446 ATTATATACTTTAAGTTTTAGGG - Intergenic
1197678604 X:129357932-129357954 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1197908349 X:131451323-131451345 TTTATATACTTTAAGTTCTAGGG - Intergenic
1197915557 X:131530598-131530620 ATATTATACTTTAAGTTCTAGGG - Intergenic
1198050430 X:132946746-132946768 AATATATACTTTAAGTTCTAGGG - Intronic
1198071830 X:133156483-133156505 ATATTATACTTTAAGTTCTAGGG + Intergenic
1198490869 X:137139901-137139923 TTTATATACTTTAAGTTCTAGGG - Intergenic
1198564006 X:137884612-137884634 AATATATACTTTAAGTTCTAGGG - Intergenic
1198689572 X:139265644-139265666 TTAATATACTTTAAGTTCTACGG - Intergenic
1198926005 X:141796449-141796471 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1198954335 X:142110973-142110995 TTGTTATACTTTAAGTTCTAGGG - Intergenic
1199665231 X:150091190-150091212 ATTATATACTTTAAGTTCTAGGG + Intergenic
1199938958 X:152605834-152605856 TTGTTATACTTTAAGTTCTAGGG + Intergenic
1200883452 Y:8244663-8244685 AAAATATACTTTAAGTTCTAGGG - Intergenic
1201510468 Y:14755207-14755229 ATGATCCTCTTTAAGTTTTGTGG + Intronic
1202594693 Y:26524583-26524605 TTTATATACTTTAAGTTCTAGGG - Intergenic