ID: 904910747

View in Genome Browser
Species Human (GRCh38)
Location 1:33932376-33932398
Sequence GTATTTAAGGGGAATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904910733_904910747 8 Left 904910733 1:33932345-33932367 CCCCAGAGAAGAGGCCGAGCTGG 0: 1
1: 0
2: 2
3: 26
4: 226
Right 904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG 0: 1
1: 0
2: 4
3: 20
4: 213
904910737_904910747 6 Left 904910737 1:33932347-33932369 CCAGAGAAGAGGCCGAGCTGGGC 0: 1
1: 0
2: 4
3: 24
4: 243
Right 904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG 0: 1
1: 0
2: 4
3: 20
4: 213
904910735_904910747 7 Left 904910735 1:33932346-33932368 CCCAGAGAAGAGGCCGAGCTGGG 0: 1
1: 0
2: 1
3: 33
4: 258
Right 904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG 0: 1
1: 0
2: 4
3: 20
4: 213
904910738_904910747 -6 Left 904910738 1:33932359-33932381 CCGAGCTGGGCCCTCCAGTATTT 0: 1
1: 0
2: 0
3: 5
4: 151
Right 904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG 0: 1
1: 0
2: 4
3: 20
4: 213
904910731_904910747 26 Left 904910731 1:33932327-33932349 CCAAGAGATGGAAGAAATCCCCA 0: 1
1: 0
2: 1
3: 18
4: 265
Right 904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG 0: 1
1: 0
2: 4
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904910747 Original CRISPR GTATTTAAGGGGAATGAGGG TGG Intronic
901303171 1:8214401-8214423 ATATGTAAAGGGAATGTGGGCGG - Intergenic
901971706 1:12913677-12913699 GAAATAAAGGGGAAGGAGGGAGG - Intronic
902013462 1:13288063-13288085 GAAATAAAGGGGAAGGAGGGAGG + Intergenic
902065513 1:13682424-13682446 ATATTTAAGGGGAAGTAGGATGG + Intergenic
902149055 1:14427702-14427724 GAATTTAAGGAGAATGTGGTTGG + Intergenic
903630101 1:24762119-24762141 GTATTTAAAGTGTATGAGGCTGG + Intronic
904596122 1:31646725-31646747 GGAGCTAAGGGGAATGTGGGAGG - Intergenic
904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG + Intronic
905370213 1:37479043-37479065 GTCTTTAATGGGAGTGGGGGAGG - Intronic
906390831 1:45414512-45414534 TAAGTTAAGGGGGATGAGGGTGG + Intronic
906702462 1:47869878-47869900 CTATGGAAGGGGTATGAGGGTGG + Intronic
909196727 1:72636176-72636198 GTAGGTTAGGGAAATGAGGGAGG - Intergenic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
909784272 1:79590894-79590916 GTTTTTAATAGGAATAAGGGAGG - Intergenic
911672918 1:100627546-100627568 GTAGTTACGGGGAATGAGTCAGG + Intergenic
912583761 1:110743169-110743191 GTATTTCAAGGGCAGGAGGGTGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915304822 1:154971075-154971097 GGAGTACAGGGGAATGAGGGAGG + Intronic
917210100 1:172622344-172622366 GGACTTCAAGGGAATGAGGGAGG - Intergenic
919022811 1:192129981-192130003 GTCTGTCAGGGGAATGAGGTGGG + Intergenic
919401966 1:197129752-197129774 GAATTAACGGGGAATGAGGGTGG + Intronic
920405587 1:205707157-205707179 GAATTTGCGGGGGATGAGGGCGG + Intergenic
921891098 1:220354526-220354548 GTTTTTAAAGTGAATGATGGTGG + Intergenic
922403133 1:225281535-225281557 ATATTTGTGGGGAATGGGGGTGG + Intronic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923226162 1:231940649-231940671 GTATTTGAGAGGAAGGAAGGGGG + Intronic
1067868882 10:49939240-49939262 GTGTTTAAAGGGTATGAGGAAGG - Intronic
1069171571 10:65236782-65236804 GTATTTTATTGGATTGAGGGTGG - Intergenic
1069421620 10:68251442-68251464 CTGTTAAAAGGGAATGAGGGCGG + Intergenic
1070389473 10:75956729-75956751 GTATTTCATGGGAAGAAGGGAGG + Intronic
1070484003 10:76912457-76912479 GTATTTGTGGGGGATGTGGGAGG + Intronic
1070690461 10:78521196-78521218 GCATATAAGAGGAAGGAGGGAGG + Intergenic
1070871488 10:79757796-79757818 TTGTTTCAGGGGAAGGAGGGAGG + Intergenic
1071741396 10:88362522-88362544 GTATTTAAGGGAAATAATAGGGG + Intronic
1072313060 10:94175704-94175726 GTAGTAGAGGGGAGTGAGGGAGG - Intronic
1073006655 10:100330096-100330118 GCATTCATGGGGAATGAGGTGGG + Exonic
1074975930 10:118581692-118581714 GTATTTAACGGGACTGACCGGGG - Intergenic
1078982811 11:16557131-16557153 GTATTTAAGTGAAGTTAGGGTGG - Intronic
1080337779 11:31218787-31218809 CTAGTTAATGGGAGTGAGGGAGG - Intronic
1086383174 11:86280402-86280424 GTATTTCAGGGAAAGGAGAGAGG - Intergenic
1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG + Intergenic
1090119641 11:124012707-124012729 GTATCTAAGAGGAAAGAAGGAGG - Intergenic
1091011399 11:132004138-132004160 GTGTGTCAGGGGAATGAGGGGGG + Intronic
1091443742 12:531228-531250 ATATTTATGGGGGATGCGGGAGG + Intronic
1092001907 12:5039734-5039756 GCATTTAAAGGGACAGAGGGAGG - Intergenic
1092001991 12:5040312-5040334 GCATTTAAAGGGACAGAGGGAGG - Intergenic
1092536126 12:9388857-9388879 GAATTTGAGGGGAATGAGACTGG - Intergenic
1094528254 12:31247720-31247742 TTATTTAGGGGGAATGATGGTGG - Intergenic
1094668801 12:32548625-32548647 GCATTTGAGAGAAATGAGGGAGG + Intronic
1095383149 12:41618356-41618378 GTATTCAAAGAGAATGAGGAAGG - Intergenic
1097071086 12:56355442-56355464 GGATTTAAGGGCTATGATGGAGG - Exonic
1098877063 12:75876951-75876973 ATATTTAAAGGGAAAAAGGGAGG + Intergenic
1099020135 12:77392924-77392946 GTATAAAAGGGAAATGAGAGAGG - Intergenic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1104096662 12:125564578-125564600 GTATTTAAGGGGAATAGGATAGG + Intronic
1105584071 13:21727466-21727488 GTATCTAAGAAGAATTAGGGTGG + Intergenic
1106062534 13:26308809-26308831 ACAGTTAAGTGGAATGAGGGAGG - Intronic
1107694335 13:42985881-42985903 GTTTTTAAGGGGATTCATGGAGG - Intronic
1107749755 13:43552398-43552420 GAATGAAAGGGGAATGAGGAGGG - Intronic
1107954628 13:45499002-45499024 TTCCTTAAGGGGAAAGAGGGTGG + Intronic
1111719085 13:91918609-91918631 GTATTTCAGGGGAATGACGGAGG - Intronic
1112829020 13:103425786-103425808 GTACTTAAGTAGAATGAGGTGGG + Intergenic
1113777786 13:112958587-112958609 GCATTTCAGGGAAATGAGGAAGG - Intronic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1121773147 14:96570276-96570298 GTATGTATGGGGATTGAGAGGGG - Intergenic
1123465372 15:20511105-20511127 GTATTTTAGAGCAATGTGGGTGG - Intergenic
1123652744 15:22489932-22489954 GTATTTTAGAGCAATGTGGGTGG + Intergenic
1123743167 15:23298796-23298818 GTATTTTAGAGCAATGTGGGTGG + Intergenic
1124276098 15:28327084-28327106 GTATTTTAGAGCAATGTGGGTGG - Intergenic
1124306602 15:28584523-28584545 GTATTTTAGAGCAATGTGGGTGG + Intergenic
1125466288 15:39956298-39956320 GTTATAAAGGGGAATGAGGCTGG - Intronic
1126456002 15:48862733-48862755 GGAGTTAAGGGGCATGAGGGTGG - Intronic
1131283249 15:91038006-91038028 GTAGTAGAGGGGAAGGAGGGAGG + Intergenic
1131902250 15:97100476-97100498 ATATTAAATGTGAATGAGGGAGG - Intergenic
1135054404 16:19218938-19218960 GGTTTGAAGAGGAATGAGGGAGG - Intronic
1140301797 16:73765103-73765125 GGATTTAAGGGAAATGAAGGTGG - Intergenic
1143718546 17:8794042-8794064 GAAATTGAGGGGAAAGAGGGGGG - Intergenic
1143936672 17:10493337-10493359 GGAATGGAGGGGAATGAGGGAGG - Intronic
1145078204 17:19872828-19872850 GCATTTTAGGAGAATGAGGCAGG + Intergenic
1146683614 17:34825861-34825883 ATATTTAAGGGGGATGTGAGTGG - Intergenic
1146761930 17:35486786-35486808 ATCTTTAATGGGAATGGGGGTGG + Intronic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147363361 17:39944855-39944877 GTATTTAGGGGGAATAAAGGAGG - Intergenic
1148572302 17:48679861-48679883 TTATTGAAGCGGAGTGAGGGTGG - Intergenic
1148853221 17:50564840-50564862 GAATTGAATGGGATTGAGGGGGG + Intronic
1149466385 17:56883225-56883247 GTGTTCAAGGGGAATCAGGCTGG + Intergenic
1151274198 17:73021621-73021643 GTATGGAAGGGGAAAGAGGCTGG - Intronic
1151390040 17:73780614-73780636 GTATTAATGGGGGATGAGGAGGG - Intergenic
1152305086 17:79515655-79515677 GTACTTAGGGGCAATGTGGGAGG - Intronic
1153049568 18:888865-888887 TTATTTAAGGGGAATCAGAGAGG + Intergenic
1154001747 18:10487643-10487665 GTCTTCAACGGGAATGAGTGCGG + Exonic
1156822957 18:41394685-41394707 TTATTTAAAGGAAATGAGGTAGG - Intergenic
1157892967 18:51436368-51436390 TTAATAATGGGGAATGAGGGCGG + Intergenic
1159558420 18:69968773-69968795 GTCTTTAAAGTGGATGAGGGAGG - Intergenic
1160440690 18:78889203-78889225 CTACTTGAGGGGAAGGAGGGAGG + Intergenic
1166933844 19:46319232-46319254 ATCTTTCAGGGGAATAAGGGTGG + Intronic
1167341441 19:48918842-48918864 GGATTTAAGGGGACTGCAGGAGG - Intronic
1167722135 19:51186141-51186163 GATTCTAAGGGGAGTGAGGGCGG - Intergenic
925521767 2:4754426-4754448 GTATTTGTGGGGGTTGAGGGGGG + Intergenic
926170876 2:10551910-10551932 GAATTTGAGGGGCATGAGGCAGG - Intergenic
930206257 2:48589056-48589078 ATTATTAAGGGGAATGAGAGTGG + Intronic
930699586 2:54445870-54445892 TTACTTATGGGGAATGGGGGTGG + Intergenic
931601856 2:64012191-64012213 GTATTGAAGGTGGATGAGGGAGG - Intronic
931890878 2:66670786-66670808 GAATTGAAGGGACATGAGGGAGG - Intergenic
934150913 2:89146847-89146869 TGCTTTATGGGGAATGAGGGAGG - Intergenic
934216360 2:90035178-90035200 TGCTTTATGGGGAATGAGGGAGG + Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
936818568 2:116490428-116490450 GAACTTTAGGGGAATGTGGGAGG + Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
940102503 2:150057577-150057599 GTTTTTAGGGAGAAAGAGGGTGG + Intergenic
940640086 2:156335054-156335076 GTTTTTAATGGCAATGAGGGAGG - Intronic
942198918 2:173551490-173551512 GGATTTGGGGGGAATGAAGGAGG + Intergenic
948485989 2:238281433-238281455 GACTTTAAGGGGAATGATGCTGG - Intronic
948619299 2:239224090-239224112 GAATTCATGGGGAATGTGGGTGG - Intronic
1169461413 20:5798872-5798894 GTTTTTAAGAGAACTGAGGGAGG - Intronic
1172626798 20:36352053-36352075 GAAGCTCAGGGGAATGAGGGAGG + Intronic
1175124609 20:56741953-56741975 GTCTTTATGGGGATTGAGGGTGG + Intergenic
1176063255 20:63181437-63181459 GGACTTGAGGGGAAGGAGGGTGG - Intergenic
1177935571 21:27341087-27341109 GTATTTAAGGGGAGGAAGGGAGG + Intergenic
1178757286 21:35363820-35363842 GTATGTATGGGGCATTAGGGTGG - Intronic
1181904235 22:26180786-26180808 GGATTTAAGAGCAATAAGGGAGG + Intronic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
951969170 3:28423846-28423868 CTATTTGAGAGGAAGGAGGGTGG - Intronic
952039919 3:29249549-29249571 ATATTTAAGTGGAACGGGGGTGG - Intergenic
953923390 3:46967403-46967425 GTATGGAAGGGGGATGAGGGTGG - Intronic
955538413 3:59949214-59949236 GTAGTTGAAGGGAATGAGAGAGG - Intronic
957040084 3:75329740-75329762 GCCTGGAAGGGGAATGAGGGAGG - Intergenic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
957358922 3:79128909-79128931 GTATTTAAGGAGTATGGGGAGGG - Intronic
957700488 3:83704399-83704421 GTGTTTAAAGGGAAAGAGGGTGG - Intergenic
961044870 3:123701282-123701304 GCCTGGAAGGGGAATGAGGGAGG - Intronic
963306183 3:143655823-143655845 GTCTTTGAGCGGAATGAGTGAGG + Intronic
963956917 3:151264184-151264206 AGATTTTAGGGGAATGTGGGAGG - Intronic
967117194 3:186352663-186352685 GTATGTGAGGGGGCTGAGGGAGG - Intronic
967453101 3:189649737-189649759 GGATCTGAGGGGAATGAGGATGG + Intronic
967710565 3:192702544-192702566 GCATTTTGGGAGAATGAGGGAGG + Intronic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970262818 4:14246701-14246723 CTTCTTAAGGGGAATGATGGTGG + Intergenic
972005265 4:34094525-34094547 ATTTTTGAGGGAAATGAGGGTGG + Intergenic
972715691 4:41644083-41644105 GAATTTGTGGGGAAAGAGGGCGG - Intronic
973704990 4:53572282-53572304 CTATTTCTGGGGAATGAGGGAGG + Intronic
975401644 4:73944843-73944865 GGATTTAAGAGGAATTAAGGAGG + Intergenic
976429476 4:84946315-84946337 GTATTTAAAGGGAAAGAGAAGGG - Intronic
976619340 4:87112327-87112349 GAATTTAAGGGCAGAGAGGGAGG - Intronic
978538818 4:109793769-109793791 GCACTTTAGGGGAATGAGGCAGG - Intronic
978786951 4:112620750-112620772 CTATTTGGGGGGAATGAGGTGGG + Intronic
979822725 4:125193169-125193191 GTATTCGAGGGGACTGAGGCAGG + Intergenic
982545687 4:156730121-156730143 ATATTTGATGGGAATGAGGAAGG - Intergenic
985037876 4:185859589-185859611 ATATTTATGGGGAATCATGGGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990646823 5:57854780-57854802 TTATTTAATGGAAATGAGGAGGG - Intergenic
991216108 5:64158830-64158852 GTATTTAAGGTGACTTAGTGGGG - Intergenic
992302615 5:75399692-75399714 TTATTTAAGGGGAAAGTTGGGGG - Intronic
992340331 5:75816512-75816534 GGATTTGAGGGGAGTGAGGAAGG + Intergenic
993207356 5:84899580-84899602 GTATTCAAGGGGACGGATGGGGG - Intergenic
994085214 5:95750750-95750772 GTCTTTATGGGGAATGGGGGAGG + Intronic
994624456 5:102200943-102200965 GTATTTAAGGGTTTAGAGGGTGG + Intergenic
995830071 5:116345237-116345259 GTATCTCAGGGGTAGGAGGGAGG + Intronic
996019070 5:118572430-118572452 GTATTTATGGGGAGTGAGTAGGG - Intergenic
996303329 5:122015950-122015972 GTATATAAGGAGGATGAAGGGGG - Intronic
997686195 5:135789224-135789246 ATATTTAAGGGGGAAGTGGGTGG + Intergenic
998176040 5:139902699-139902721 GTATGTAGGGGGAATGGGAGTGG + Intronic
998769549 5:145526356-145526378 GTAGTGAAGGGCAATTAGGGAGG + Intronic
999652091 5:153777677-153777699 GTGTGTGAGGGGGATGAGGGTGG - Intronic
1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG + Intergenic
1003122439 6:3329162-3329184 GTGTTTGTGGGGGATGAGGGAGG - Intronic
1004212292 6:13661173-13661195 GTAGTTAAGGGGAAAGAGAGAGG + Intronic
1004422625 6:15485548-15485570 GTATATAAGGGGATTGGGTGTGG + Intronic
1004954241 6:20709827-20709849 GTATGTAATGGGAAAGAGGCTGG + Intronic
1007921330 6:45612193-45612215 GTATTTATGGAGATTGTGGGAGG - Intronic
1011486965 6:87852840-87852862 CTATTAAAGGGGAAGAAGGGAGG - Intergenic
1012477847 6:99634675-99634697 GTATTTGAAGGGAATGATGATGG + Intergenic
1014392546 6:120881053-120881075 GAATTTAAGAGGTATAAGGGAGG - Intergenic
1014447775 6:121548268-121548290 GATTTTAAGGGGAAAGAGTGAGG - Intergenic
1018956744 6:168415502-168415524 GTAGGAAGGGGGAATGAGGGTGG + Intergenic
1019067897 6:169317897-169317919 TTATTCAAGTGGAAGGAGGGAGG + Intergenic
1020409669 7:7877047-7877069 GTGTTTAAGGGGTCTGTGGGTGG + Intronic
1023420851 7:39977999-39978021 GTATTTAAGGAGAAGGAGGGTGG + Intronic
1025111878 7:56223916-56223938 CTTTTTGAGGGGAATGAGGTGGG + Intergenic
1026395332 7:69947107-69947129 GGGTTTAAAGGGATTGAGGGAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026789476 7:73322450-73322472 TTAGTTAATGGGAAGGAGGGAGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1027502001 7:78963977-78963999 GTTTGGGAGGGGAATGAGGGAGG + Intronic
1028153651 7:87405332-87405354 GAGTTTGAGAGGAATGAGGGTGG + Intronic
1028155750 7:87427473-87427495 CTTTTTAATGGGAATGGGGGTGG + Intronic
1029109612 7:98206024-98206046 TTATTCGAGGGGAATGAGGCAGG + Exonic
1029374038 7:100167282-100167304 GTCTAGAAGGGAAATGAGGGGGG + Exonic
1030516159 7:110540989-110541011 TTATTTAAGGGAAATTAAGGAGG - Intergenic
1030945126 7:115709460-115709482 GTATTTAATGGGTCTGAGGGGGG - Intergenic
1031468504 7:122143353-122143375 TGATTTCAGGGGAATGGGGGTGG - Intronic
1031938669 7:127763845-127763867 GTATTTGGGGAGACTGAGGGAGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035826885 8:2654205-2654227 GTGTCAAAGGGGATTGAGGGAGG - Intergenic
1036087051 8:5623743-5623765 ATATTAAAGGGGAATGATCGAGG + Intergenic
1037205520 8:16314920-16314942 ACATTTGAGGGGAATGACGGTGG - Intronic
1038147570 8:24913139-24913161 GAATGCAAGGGGAAGGAGGGAGG + Exonic
1038991493 8:32873081-32873103 TTTTTTAAGGGGACTGAAGGGGG + Intergenic
1039863388 8:41479139-41479161 GGATTTAATGGGAATGTGGACGG - Intergenic
1042602911 8:70516445-70516467 ATATTTAAAGGGAATGGGTGTGG + Intergenic
1043506031 8:80903918-80903940 GTAGTTACAGGGAATGGGGGAGG + Intergenic
1044692336 8:94893999-94894021 TGATTTAAGGAGAAAGAGGGAGG - Intronic
1045054671 8:98358693-98358715 ATGGTTTAGGGGAATGAGGGGGG + Intergenic
1045593403 8:103625106-103625128 GTTTTTAGGGGGAAGGAGGTTGG + Intronic
1048010747 8:130453738-130453760 CCATTTCAGGGGAATGAGGAAGG + Intergenic
1050119263 9:2291595-2291617 GTATTTAGGAGGAAGGAGGAGGG - Intergenic
1050320014 9:4442619-4442641 GTATTTAAGGAGAAAAAAGGAGG - Intergenic
1050435228 9:5601642-5601664 GTATGTAAGGGCACAGAGGGTGG - Intergenic
1051175223 9:14353514-14353536 GGCTTTAAGGCGAATGAAGGGGG + Intronic
1051327046 9:15983171-15983193 GTATTTAAGAGGAAAGGGGAAGG - Intronic
1051544108 9:18254668-18254690 GTATTTAAGAGTACTGGGGGGGG - Intergenic
1051653485 9:19354041-19354063 GTAGAATAGGGGAATGAGGGTGG - Intronic
1053095595 9:35325250-35325272 GTTGTGAAGAGGAATGAGGGGGG + Intronic
1053313188 9:37032345-37032367 GTATGTGTGGGGAATGAGGCGGG - Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1055407229 9:75987642-75987664 ATGTTTAAGGGGAAAAAGGGAGG + Intronic
1056213835 9:84390088-84390110 AAATTTCAGGGGAAGGAGGGTGG + Intergenic
1056335995 9:85569565-85569587 GTAAATAAGGGGAATGAGGGAGG - Intronic
1056933923 9:90901121-90901143 GTGCTTAAGGAGAATTAGGGAGG + Intergenic
1060317895 9:122530078-122530100 ATATTTAAGGGGGTTAAGGGAGG + Intergenic
1061680769 9:132241505-132241527 GTATTTGCGGGGACAGAGGGAGG + Intronic
1062705833 9:137941549-137941571 AAATTTGAGAGGAATGAGGGTGG - Intronic
1186949981 X:14613804-14613826 GTATTTAATGGTAGTGAGTGGGG - Intronic
1187424767 X:19167097-19167119 GTAATTAAAGGGTATGAGGATGG + Intergenic
1189212803 X:39299103-39299125 GGATTTAAGGGGTTTGAAGGAGG - Intergenic
1190278212 X:48912709-48912731 GTATGTAAGGGTAAAGATGGGGG + Intergenic
1197193040 X:123670236-123670258 GTATATAGGGGGAATGAGGATGG - Intronic
1199475202 X:148237317-148237339 GTCTTGAAAGGTAATGAGGGAGG + Intergenic
1199540525 X:148953299-148953321 GTTTTTATGTTGAATGAGGGTGG + Intronic
1200275286 X:154726531-154726553 GTAGTTAAGGGAAATGAGACTGG - Intronic