ID: 904912683

View in Genome Browser
Species Human (GRCh38)
Location 1:33947212-33947234
Sequence GCAGTCTGTTAGGACAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904912683_904912686 13 Left 904912683 1:33947212-33947234 CCAGGGCTGTCCTAACAGACTGC 0: 1
1: 0
2: 4
3: 24
4: 188
Right 904912686 1:33947248-33947270 TTATCTCCTTAACCTCCCCCAGG 0: 1
1: 1
2: 1
3: 14
4: 153
904912683_904912689 18 Left 904912683 1:33947212-33947234 CCAGGGCTGTCCTAACAGACTGC 0: 1
1: 0
2: 4
3: 24
4: 188
Right 904912689 1:33947253-33947275 TCCTTAACCTCCCCCAGGGTGGG 0: 1
1: 0
2: 2
3: 15
4: 321
904912683_904912687 14 Left 904912683 1:33947212-33947234 CCAGGGCTGTCCTAACAGACTGC 0: 1
1: 0
2: 4
3: 24
4: 188
Right 904912687 1:33947249-33947271 TATCTCCTTAACCTCCCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 153
904912683_904912688 17 Left 904912683 1:33947212-33947234 CCAGGGCTGTCCTAACAGACTGC 0: 1
1: 0
2: 4
3: 24
4: 188
Right 904912688 1:33947252-33947274 CTCCTTAACCTCCCCCAGGGTGG 0: 1
1: 0
2: 1
3: 16
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904912683 Original CRISPR GCAGTCTGTTAGGACAGCCC TGG (reversed) Intronic
901889654 1:12251839-12251861 GCAATGTGTTAGGGCTGCCCTGG - Intronic
902087405 1:13874158-13874180 GCATTCTGTTACGGCAGCCTGGG - Intergenic
904503269 1:30930015-30930037 CCAGTGTGTGACGACAGCCCGGG + Intergenic
904885223 1:33732656-33732678 GCACTGTGTTACGGCAGCCCAGG + Intronic
904912683 1:33947212-33947234 GCAGTCTGTTAGGACAGCCCTGG - Intronic
905171724 1:36113732-36113754 GAAGTCTGGTAGGGCAGACCAGG - Intronic
906303505 1:44701098-44701120 GCAGACTCTCAGGACTGCCCAGG + Exonic
908331744 1:63077544-63077566 GTATTTTGTTATGACAGCCCAGG + Intergenic
908978552 1:69926981-69927003 GAGGTCTTTTAGGACAGGCCTGG + Intronic
911200369 1:95037949-95037971 GCAGTCTATCAGGACAGCACAGG + Intronic
912949995 1:114113959-114113981 GAAGCCTGTGAGGAGAGCCCTGG - Intronic
915593711 1:156884613-156884635 GCAGAGTGCTAGGACAGCCTTGG + Intergenic
917664368 1:177209449-177209471 GCAGCCTGTGAGGATGGCCCAGG - Intronic
917843101 1:178998812-178998834 GCTGCCTGTTAGAAGAGCCCTGG + Intergenic
920630155 1:207644875-207644897 GCAGGCTGTCAGGACTGCCTGGG - Intergenic
920640911 1:207751631-207751653 GCAGGCTGTCAGGACTGCCTGGG - Intergenic
921465611 1:215483434-215483456 CCAGTCTGTTAGGACAAACCAGG - Intergenic
922874683 1:228931210-228931232 GCACTTTGTTAGGGCAGTCCTGG - Intergenic
923552759 1:234977371-234977393 GTACTTTGTTATGACAGCCCGGG - Intergenic
924324144 1:242878469-242878491 GCAGTCTTTGAGGACAGGCATGG - Intergenic
924772540 1:247089745-247089767 GCAGTCTGTTTGGACCTCCTGGG - Intergenic
1062791443 10:308895-308917 GCAGGCTGTTGGGACACCCCTGG + Intronic
1062882114 10:987780-987802 GCAGTGCCTTAGGAGAGCCCAGG - Intergenic
1063298917 10:4834103-4834125 GCAGGCTGTCATCACAGCCCAGG - Intronic
1063541681 10:6940498-6940520 GTACTTTGTTAGGGCAGCCCTGG - Intergenic
1066756521 10:38717612-38717634 GCTGGTTGTTAGGACAGCCTGGG + Intergenic
1068767048 10:60775602-60775624 GCATTTTGTTATGGCAGCCCAGG - Intergenic
1068926987 10:62550821-62550843 GCAGTCTGGTTGCAGAGCCCAGG - Intronic
1069656410 10:70092492-70092514 GCATTTTGTTAGAGCAGCCCAGG + Intronic
1069961963 10:72084398-72084420 GCAGTGTGCTGGGACAGCTCTGG - Intronic
1072730848 10:97845559-97845581 GGAGACTGTTAGAGCAGCCCAGG - Intergenic
1072918241 10:99553627-99553649 GCACTCTGTTACAGCAGCCCTGG - Intergenic
1074275506 10:111997805-111997827 GCACTTTGTTGTGACAGCCCTGG + Intergenic
1074847190 10:117408711-117408733 GCAGTTTGTTACAACAGCCGTGG + Intergenic
1074886743 10:117699957-117699979 GCAATCTGTTATGGCAACCCTGG + Intergenic
1076192389 10:128491837-128491859 GCAGTCTGTGCGGAAAGCCTTGG + Intergenic
1077052050 11:571376-571398 GCCGTTTGATATGACAGCCCTGG + Intergenic
1085507597 11:77069005-77069027 GCAGGCTGTCAGATCAGCCCTGG + Intronic
1088060322 11:105641816-105641838 GTACTTTGTTATGACAGCCCTGG - Intronic
1088234336 11:107706290-107706312 GCAGTCTGGAAGGGCAGCACTGG + Intergenic
1088817577 11:113432205-113432227 TCAATCTGTTAGGACAGCCTGGG + Intronic
1088988146 11:114928110-114928132 GCAGGCAGTTAGGCCAGCCTGGG - Intergenic
1089640380 11:119843888-119843910 GCCGTCTGCTAGGACAGCCAGGG - Intergenic
1090029660 11:123195859-123195881 GCAGTCGGTGGGGAGAGCCCTGG - Intergenic
1091097691 11:132839607-132839629 GCAGTGTGGTGGGTCAGCCCTGG - Intronic
1091339474 11:134799247-134799269 GCATTCTGGGAGGACAGCACAGG + Intergenic
1091372011 11:135068752-135068774 GCATTCTGGGAGGACAGCCCCGG + Intergenic
1092015688 12:5156464-5156486 GAAGCCTGTAGGGACAGCCCAGG + Intergenic
1102699384 12:114825903-114825925 ACAGTGTGTTAGGAAAGGCCTGG + Intergenic
1103005208 12:117415426-117415448 GCAATGTGTTGGGACAGTCCTGG - Intronic
1106256830 13:28029943-28029965 GCAGTTGGTCAGGGCAGCCCGGG + Intronic
1106568552 13:30906871-30906893 GCAGGCAGCGAGGACAGCCCAGG - Intronic
1109199880 13:59418541-59418563 ACAGTCTGATAGCACAGCACTGG - Intergenic
1109209182 13:59514867-59514889 GCACGCTCTTAAGACAGCCCAGG + Intergenic
1109825976 13:67722810-67722832 GCATTCTGTTATGGCAGCCCTGG + Intergenic
1111932413 13:94525442-94525464 GCACTTTGTTATGGCAGCCCTGG + Intergenic
1111997088 13:95175864-95175886 GCATTTTGTGAGGGCAGCCCTGG + Intronic
1112006986 13:95262134-95262156 GCAGCCTGGGAGCACAGCCCTGG + Intronic
1114957050 14:27835554-27835576 GCAATTTGTTATGACAACCCTGG - Intergenic
1120208132 14:81608167-81608189 GTAATTTGTTAGGGCAGCCCTGG - Intergenic
1121643137 14:95499745-95499767 GCAGTCCCTTAGCAGAGCCCAGG + Intergenic
1122150556 14:99723896-99723918 GCACTTTGTTACAACAGCCCTGG - Intronic
1122281467 14:100625157-100625179 GCATTTTGTTATGACAGCCCAGG - Intergenic
1123165704 14:106323335-106323357 GCAGTCTCTGAGATCAGCCCTGG - Intergenic
1123994126 15:25706489-25706511 GCAGGCTGATCGGACAGCCTGGG - Intronic
1126423045 15:48495531-48495553 GGAGTCTGCAAGAACAGCCCAGG - Exonic
1128324812 15:66717418-66717440 GCATTCTCTTGGGACAGCCATGG + Intronic
1129824342 15:78624951-78624973 GCATTCAGAGAGGACAGCCCAGG + Exonic
1130563343 15:84975878-84975900 GCAGTGTGTCAGGACAGCCCCGG - Intergenic
1131352403 15:91713219-91713241 GTACTTTGTTAGCACAGCCCTGG - Intergenic
1131662385 15:94531800-94531822 GTAATTTGTTATGACAGCCCTGG - Intergenic
1132533697 16:466897-466919 GCAGTGAGATAGGAGAGCCCTGG - Intronic
1133530051 16:6646980-6647002 GCAGTTTGTTAGGGTAGCCCAGG - Intronic
1135050450 16:19188622-19188644 GTACTCTGTTATGGCAGCCCTGG - Intronic
1136726067 16:32358713-32358735 GCTGGTTGTTAGGACAGCCTGGG - Intergenic
1136844399 16:33564758-33564780 GCTGGTTGTTAGGACAGCCTGGG - Intergenic
1138718350 16:59049536-59049558 GTAGTTTGTTATGACAGCCATGG - Intergenic
1139093938 16:63682075-63682097 ACAGTCTGTTGGGACATGCCTGG - Intergenic
1140044805 16:71433172-71433194 GCAGTCTGTTGGGAGTGCCCTGG - Intergenic
1140903752 16:79393242-79393264 CCAGTCTGTAGGTACAGCCCAGG - Intergenic
1141172591 16:81700721-81700743 GCAGGCTGTGGGGACATCCCGGG + Intronic
1141550815 16:84805598-84805620 GCAGTTTATTAGGACATCCCCGG + Intergenic
1141760419 16:86025498-86025520 GTTGTCTCTTAGCACAGCCCCGG + Intergenic
1203000364 16_KI270728v1_random:159043-159065 GCTGGTTGTTAGGACAGCCTGGG + Intergenic
1203131966 16_KI270728v1_random:1695446-1695468 GCTGGTTGTTAGGACAGCCTGGG + Intergenic
1203154566 16_KI270728v1_random:1865057-1865079 GCTGGTTGTTAGGACAGCCTGGG - Intergenic
1143400395 17:6639226-6639248 GCAGTCTGTGGGGCCACCCCTGG - Intronic
1145739041 17:27256658-27256680 CCAGTCTGTTTGGAGATCCCAGG - Intergenic
1149474698 17:56950157-56950179 GCAGTCTGTGATGACAGCCCTGG + Exonic
1149815708 17:59721803-59721825 GTATTCTGTTATGACAACCCTGG - Intronic
1151569617 17:74919746-74919768 GCAGGCTGTTGGCACTGCCCAGG + Exonic
1152023793 17:77795942-77795964 ACCGGCTGTCAGGACAGCCCAGG + Intergenic
1152571693 17:81123886-81123908 GCAGCCTCTTGGGACAGCCAGGG - Intronic
1152704643 17:81836673-81836695 GTGGTCTGTGAAGACAGCCCCGG - Intergenic
1154147617 18:11879395-11879417 GCACTTTGTTATGGCAGCCCGGG - Intronic
1155792416 18:29990070-29990092 GCAATTTGTTATGGCAGCCCTGG + Intergenic
1156891617 18:42196848-42196870 TCAGTCTGTTATGAAAGCCCAGG + Intergenic
1158413964 18:57232952-57232974 GCAGCCTGGTTGGACAGGCCAGG - Intergenic
1159085082 18:63780893-63780915 GCTGTCTTTTAGGACAGAACAGG + Intronic
1159118051 18:64137376-64137398 GCACTTTGTTAGGACAACCCTGG + Intergenic
1162055728 19:8062764-8062786 GCCGTCTGTTAGGAGAGCTTGGG - Intronic
1163087479 19:14992798-14992820 GCAGTCGTCTGGGACAGCCCGGG - Intronic
1163301061 19:16446671-16446693 GCACCCTGTAATGACAGCCCAGG + Intronic
1163369066 19:16892035-16892057 GCACTTTGTCAGGGCAGCCCAGG + Exonic
1166569838 19:43787107-43787129 GCATTCTGTTAGGACAGGACTGG - Intergenic
1166714212 19:44956097-44956119 GCAGTGTGTTAAGACAGCAGTGG - Intronic
1167036722 19:46999205-46999227 GCCTTCTCTGAGGACAGCCCAGG - Intronic
925103835 2:1272486-1272508 GGATTCTGTTAGGACATCCCAGG + Intronic
926246618 2:11126302-11126324 GCATTGTGTTAGGGCAGCTCTGG + Intergenic
926984916 2:18612150-18612172 GTACTTTGTTATGACAGCCCTGG - Intergenic
927475316 2:23410180-23410202 GCATTCTGCAAAGACAGCCCTGG + Intronic
928620747 2:33085292-33085314 GCAATTTGTTAGAGCAGCCCTGG + Intronic
934319820 2:91961868-91961890 GCTGGTTGTTAGGACAGCCTGGG + Intergenic
935310089 2:101775097-101775119 GCAGTATTTCAGGACAACCCCGG + Intronic
935754190 2:106264467-106264489 GTAGGCAGTTACGACAGCCCTGG - Intergenic
936096458 2:109533960-109533982 GCAGTCAGTGAGGCCAGACCGGG + Intergenic
940833930 2:158499331-158499353 GCAGGCTGTTGGGACTGCTCTGG - Intronic
946112107 2:217429169-217429191 GTAATATGTTGGGACAGCCCTGG - Intronic
947770547 2:232666863-232666885 TCAGTCTGTGAACACAGCCCTGG - Intronic
948396670 2:237649868-237649890 GCAGTATATTAGGACATGCCGGG - Intronic
949031194 2:241798285-241798307 GGTGTCTGTTGTGACAGCCCGGG - Intronic
1168949202 20:1784950-1784972 TCAGCCTGTTAGGCCAGCACAGG - Intergenic
1170861106 20:20104683-20104705 GCACTTTGTTATGGCAGCCCTGG - Intronic
1175170003 20:57073735-57073757 GCAATTTGTTACGGCAGCCCTGG - Intergenic
1175310418 20:58007904-58007926 GTATTTTGTTAGGGCAGCCCAGG + Intergenic
1176044801 20:63087029-63087051 GCAGGCTGTTAGAACAGCTGAGG - Intergenic
1179125170 21:38583935-38583957 GCAGTTTGTTACAACAGCACTGG + Intronic
1179253655 21:39696775-39696797 GCACTCTGATTGGCCAGCCCTGG - Intergenic
1179556993 21:42185449-42185471 TCAGTATCTTAGGACAGCCAGGG + Intergenic
1180057078 21:45364608-45364630 GAAGTCTGTGAGCTCAGCCCGGG + Intergenic
1180308070 22:11145912-11145934 GCTGGTTGTTAGGACAGCCTGGG + Intergenic
1180546546 22:16507725-16507747 GCTGGTTGTTAGGACAGCCTGGG + Intergenic
1181148739 22:20867410-20867432 ACAGTCTGTAAGGACAGGCCAGG - Intronic
1181462663 22:23094693-23094715 GCACTCTGATGGGCCAGCCCAGG - Intronic
1182148651 22:28013316-28013338 GTAGACTGTTAGGAAAGCCCAGG - Intronic
1182510189 22:30814168-30814190 GCATTTTGTGATGACAGCCCAGG - Intronic
1182992560 22:34782082-34782104 GCATTTTGTTATGGCAGCCCTGG - Intergenic
1183404696 22:37624735-37624757 CCAGTGTGTTGAGACAGCCCAGG + Intronic
1184137972 22:42560590-42560612 GCAGGCTGTGAGGACGTCCCAGG + Intronic
1185055730 22:48577398-48577420 CCAGTCTGATATGACAGGCCAGG - Intronic
1185232535 22:49691438-49691460 GCATTCTGTGAGGGCAACCCAGG + Intergenic
950580395 3:13858284-13858306 CCAGTCTTTGAGGACAGGCCAGG - Intronic
951409817 3:22348871-22348893 GTACTTTGTTATGACAGCCCTGG + Intronic
953393234 3:42545840-42545862 GCAGTCAGTTATGAGAGCTCTGG - Intergenic
953847381 3:46438511-46438533 GCAGGCTGCTAGGAAAACCCAGG + Intronic
955264499 3:57428251-57428273 GCAATTTGTTATGACAGCCCTGG + Intronic
955890730 3:63647148-63647170 GGAGTCTTTTAGGGCAGGCCTGG - Intergenic
962135477 3:132727290-132727312 TCTGTCTGTTAGGACAGGCTGGG - Intergenic
962412171 3:135150892-135150914 GCAGTTTGAGAGGAGAGCCCAGG - Intronic
963934688 3:151040051-151040073 TCATTCTGTTAGGAGAGCACTGG + Intergenic
965966216 3:174493560-174493582 GTAGTTTGTTATGGCAGCCCTGG + Intronic
966397057 3:179514840-179514862 GCATTTTGTTATGGCAGCCCTGG + Intergenic
966409700 3:179635433-179635455 GTACTTTGTTAGGGCAGCCCTGG + Intergenic
968900681 4:3430298-3430320 ATAGGGTGTTAGGACAGCCCAGG + Intronic
969835499 4:9836780-9836802 GCAGGCTGTTGGGGCAGTCCAGG + Intronic
972519208 4:39837946-39837968 GCAGTGGGTCAGGAGAGCCCTGG - Exonic
972742164 4:41897829-41897851 GTACCTTGTTAGGACAGCCCTGG - Intergenic
974656534 4:64830943-64830965 GCAGTTTGTTACAGCAGCCCTGG - Intergenic
974972098 4:68843014-68843036 GCACTCTGATAGGACAGACATGG - Intergenic
976660374 4:87534501-87534523 GTAATTTGTTATGACAGCCCAGG - Intergenic
977895596 4:102361270-102361292 GTATTTTGTTAGGGCAGCCCTGG + Intronic
979642455 4:123024826-123024848 GCAGTCTGTGATGACAGCCCAGG - Intronic
979885376 4:126021545-126021567 CCTGTTTGTTAGGACAGTCCTGG - Intergenic
986745270 5:10738177-10738199 GCATTTTGTTAAGGCAGCCCTGG + Intronic
988335632 5:29904958-29904980 GCAGTGAGTTATGACAGCCAGGG + Intergenic
994776581 5:104042214-104042236 GCATTGTGTTATGACAGCCCAGG + Intergenic
997472469 5:134124525-134124547 GTAGTCTGCTAGCAGAGCCCAGG - Intronic
1001133137 5:169080704-169080726 ACAGTCAGTCAGGTCAGCCCCGG - Intronic
1003089347 6:3088517-3088539 GCTGGCAGGTAGGACAGCCCTGG + Intronic
1006889915 6:37418000-37418022 GTATTTTGTTAGGACAGCCCTGG - Intergenic
1010393921 6:75368927-75368949 CCAGTCTGTTGGGGCAGGCCAGG + Intronic
1010904397 6:81469970-81469992 GAGGTCTTTTAGGACAGGCCTGG - Intergenic
1017095456 6:150800721-150800743 ACACTCTGTTAGCACAGCCACGG - Exonic
1017788057 6:157772674-157772696 GTAGTTTGTTATGGCAGCCCAGG + Intronic
1019743092 7:2684814-2684836 TCTGTCTGTTGGGTCAGCCCGGG - Intronic
1021201553 7:17733389-17733411 GCACTCTGATAGGACAGCAATGG + Intergenic
1023302997 7:38793562-38793584 GCAGTCTGTTATAGCAGCCATGG - Intronic
1023882296 7:44327196-44327218 TCTGTCTGTTAGGATGGCCCAGG - Intronic
1023956643 7:44891911-44891933 GCAGGCTTTTAGTCCAGCCCAGG - Intergenic
1024833161 7:53485306-53485328 GCACTTTGTTATGGCAGCCCTGG - Intergenic
1025036241 7:55594075-55594097 GCAGTCGGGGAGGACACCCCAGG - Intergenic
1026385853 7:69847002-69847024 GCAATCTAGTAGCACAGCCCAGG + Intronic
1027476852 7:78642841-78642863 GCAGTCTGGCAGTACAGGCCAGG + Intronic
1036719424 8:11159381-11159403 GCAGTCTGTTACGACAGCTATGG + Intronic
1039717606 8:40127211-40127233 GCACTTTGTTATAACAGCCCTGG - Intergenic
1040316539 8:46263858-46263880 ACAGCCTCTCAGGACAGCCCTGG - Intergenic
1040472553 8:47746919-47746941 GCATTCTATTAGGAGAGACCAGG - Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1044729899 8:95221255-95221277 GGAGTCTGTAAGTAGAGCCCCGG - Intergenic
1044806455 8:96013146-96013168 GCACTTTGTTACTACAGCCCTGG + Intergenic
1045443827 8:102239715-102239737 GCAGTCTCTCAGGACAGGCCAGG - Intergenic
1045980812 8:108185129-108185151 GCATTTTGTTATGGCAGCCCTGG + Intergenic
1049415987 8:142495422-142495444 GCAGTTTGTTAGGGCAGCCCTGG - Intronic
1049482689 8:142834497-142834519 GCAGCCTGTTGGCACCGCCCAGG - Intronic
1050360248 9:4823401-4823423 CCAGTCCTTTAGGAAAGCCCAGG + Intronic
1052790824 9:32874075-32874097 GCAGTCTGTTGCCACAGCACAGG + Intergenic
1056768269 9:89458457-89458479 GCAGTCTTTTAGGTGGGCCCAGG - Intronic
1057279400 9:93699131-93699153 CCAGTCTTTCAGGTCAGCCCTGG + Intergenic
1057931129 9:99194215-99194237 GCAGTCTGGAGGGACAGCCTGGG + Intergenic
1060059165 9:120443703-120443725 GCAGCCTACCAGGACAGCCCAGG - Exonic
1060112726 9:120918184-120918206 GCACTTTGTTATGGCAGCCCTGG + Intronic
1060486160 9:124048071-124048093 GGAATGTGTTAGGATAGCCCAGG - Intergenic
1061991218 9:134159724-134159746 GCAGTCTGTTGTGACAGACACGG + Exonic
1203554648 Un_KI270743v1:195502-195524 GAACTCTTTTAGGACAGGCCTGG - Intergenic
1187676973 X:21725965-21725987 GCAGACTGTGAGGACAGCGAAGG + Intronic
1188199745 X:27283588-27283610 GCAGTCAATGAGGACAGACCCGG + Intergenic
1188266374 X:28080864-28080886 GCATTTTGTTATGACAGCCCAGG + Intergenic
1189199862 X:39184542-39184564 GAACTCTTTTAGGACAGGCCTGG + Intergenic
1189470864 X:41313033-41313055 GCAGTCTGGTGGGGCAGCCTTGG + Intergenic
1192676247 X:73199681-73199703 GTAGTCTGTCAGTACACCCCAGG + Intergenic
1194150774 X:90323197-90323219 GCAGTCTGTGAAATCAGCCCTGG - Intergenic
1198419825 X:136460010-136460032 GCAATTTGTTATGGCAGCCCTGG + Intergenic
1199471048 X:148197017-148197039 GCAGGCTGTTAGGAAGGGCCTGG + Intergenic
1199635361 X:149807695-149807717 GCAGACTGCAAGCACAGCCCTGG - Intergenic
1199875242 X:151923159-151923181 GCAGACTGTAAGCACAGCCCCGG - Intronic
1200766319 Y:7083609-7083631 GCAGCCTGCTGGGAGAGCCCAGG - Intronic
1201187342 Y:11416960-11416982 GCTGGTTGTTAGGACAGCCTGGG + Intergenic