ID: 904914584

View in Genome Browser
Species Human (GRCh38)
Location 1:33960651-33960673
Sequence GTTTCCATGGGAAATGCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904914584_904914587 12 Left 904914584 1:33960651-33960673 CCGCACGCATTTCCCATGGAAAC 0: 1
1: 0
2: 1
3: 20
4: 201
Right 904914587 1:33960686-33960708 TTGCCAACCTTTCTGAGCTCAGG 0: 1
1: 0
2: 3
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904914584 Original CRISPR GTTTCCATGGGAAATGCGTG CGG (reversed) Intronic
900318804 1:2072495-2072517 GTTTCCATGGGAAAGGTGTGGGG + Intronic
901435912 1:9247386-9247408 GAGACCATGGGAACTGCGTGAGG + Intronic
901677840 1:10897335-10897357 GTTTCCCAGTGAAATGCTTGTGG - Intergenic
904869269 1:33606477-33606499 GTTTCCCTGGGAAATCATTGAGG + Intronic
904914584 1:33960651-33960673 GTTTCCATGGGAAATGCGTGCGG - Intronic
907349123 1:53811458-53811480 GTTTGCATGGGACCTGGGTGAGG + Intronic
907542594 1:55229670-55229692 GTTTGCATGGGATATGATTGTGG - Intergenic
908678913 1:66636802-66636824 GTTTCCATTGGGAATGCCTCTGG - Intronic
909667862 1:78155492-78155514 GTTTCTATGGGAAATGAGTCTGG - Intergenic
909673559 1:78214399-78214421 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
910077581 1:83298879-83298901 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
912901500 1:113655070-113655092 GTTTCCATGGCAACTGCTTTGGG - Intronic
914346044 1:146799323-146799345 GATTGCATGGGAGCTGCGTGAGG + Intergenic
914927144 1:151898277-151898299 GTTTGCATGGGAGCTGGGTGAGG + Intronic
915325708 1:155080395-155080417 GTTTCCATGGGAAGCGAGAGGGG - Intronic
917250038 1:173048949-173048971 GTTTCTATGGGAAAAGCCAGTGG - Intronic
919272887 1:195373619-195373641 GTTTTGATGGGAAAAGCTTGAGG + Intergenic
924768115 1:247053090-247053112 GGCTGCATGGGAACTGCGTGAGG - Intronic
1062920230 10:1273822-1273844 CTTTCCCTGGGAGATGCGGGAGG - Intronic
1065471004 10:26081365-26081387 GTTTGCATGGGAGCTGGGTGAGG - Intronic
1065705837 10:28470931-28470953 GTTTCCATGCAAGATCCGTGTGG - Intergenic
1068480759 10:57585619-57585641 GTTTGCATGGGAACTGGGTGAGG + Intergenic
1070529657 10:77325589-77325611 GCATCCATGGGAAATGCATTTGG - Intronic
1071709748 10:88038580-88038602 GTCTCCATGGGAGATCCCTGAGG - Intergenic
1073562576 10:104509529-104509551 GTTTCCATGGGCCAGGCATGAGG - Intergenic
1074898910 10:117800288-117800310 GTTGCCTTGGGAAATGCTGGGGG - Intergenic
1075579826 10:123608958-123608980 GTTGCCAGGGGCAATGGGTGAGG - Intergenic
1075660648 10:124193383-124193405 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1075982779 10:126755702-126755724 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1076028577 10:127138645-127138667 GTTTCTTTGGGAGAAGCGTGGGG + Intronic
1076582754 10:131523958-131523980 GTTTCAAGGGAAAATGCTTGAGG - Intergenic
1077020531 11:415351-415373 GGTTCCAGGGGTAATGCATGGGG + Intronic
1077061077 11:618157-618179 GTTGGCATGGGAAATGCCTGGGG - Intronic
1077448470 11:2617232-2617254 GTTACCATGGGCAAGGTGTGGGG - Intronic
1080153050 11:29076376-29076398 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1080672566 11:34394877-34394899 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1080977888 11:37364294-37364316 GTCTCCATGGGGAAAGCTTGCGG + Intergenic
1082140509 11:48603361-48603383 GTTTGCATGGGAACTGAGTAAGG - Intergenic
1082567701 11:54700460-54700482 GTTTGCATGGGAACTGGGTGAGG - Intergenic
1083849628 11:65357255-65357277 GTTTCCATGGGAAACAAGAGAGG - Exonic
1084203870 11:67579703-67579725 GTTTCCAGGGGAAGTGTGGGAGG - Intergenic
1084269412 11:68021120-68021142 GTTTCCAAAGGAGATGGGTGGGG + Intronic
1084547405 11:69821310-69821332 GTTTCCCTGGGAACTGCTGGGGG - Intergenic
1084680118 11:70662107-70662129 GCTTCCCTGGAAGATGCGTGTGG - Intronic
1085747796 11:79129574-79129596 GTTTGCATGGGAGCTGGGTGAGG + Intronic
1086334389 11:85785097-85785119 GTTTCCATGTGGAATGGGTGTGG - Intronic
1086951100 11:92890829-92890851 GTTTCGTTGGGGAATGGGTGAGG - Exonic
1087619458 11:100525512-100525534 GTTTGTGTGGGAAATGTGTGAGG + Intergenic
1088206390 11:107397355-107397377 GTTTGCATGGGAGCTGGGTGAGG + Intronic
1090350405 11:126104418-126104440 GGCTCCCTGGGACATGCGTGGGG + Intergenic
1090565405 11:127986237-127986259 AGTTCCCTGGGAAATGCGTGTGG + Intergenic
1095118513 12:38385181-38385203 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1095865050 12:46962397-46962419 GTTTGCATGGAGAATGAGTGTGG - Intergenic
1100175708 12:92028568-92028590 GTTTCCATAGCAAATGTGTGTGG - Intronic
1101635294 12:106535570-106535592 GTTTGCATGGGAGCTGGGTGAGG - Intronic
1104346569 12:128004998-128005020 GTTTCCAGGTGAAATGCATGGGG + Intergenic
1104371703 12:128229198-128229220 GTCTCCATGCAAAATGGGTGCGG - Intergenic
1108463783 13:50694293-50694315 TTTTCCATGGGAGAAGAGTGGGG - Intronic
1108817073 13:54305243-54305265 GTTTACATGGGAGCTGGGTGAGG + Intergenic
1109464402 13:62710601-62710623 GTTTTCATGGGAACTCTGTGTGG - Intergenic
1110204437 13:72895965-72895987 GTTTTCGTGGGAACTGGGTGAGG + Intronic
1110561841 13:76917943-76917965 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1112945297 13:104920184-104920206 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1117510811 14:56448940-56448962 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1122293640 14:100693063-100693085 GAGTACATGGGAAGTGCGTGTGG - Intergenic
1123172885 14:106390819-106390841 GGTGACATGGGGAATGCGTGAGG - Intergenic
1124380705 15:29162499-29162521 GTTTGCATGGGAGCTGGGTGAGG + Intronic
1128414996 15:67436741-67436763 GTTTGCATGGGAGCTGGGTGAGG + Intronic
1129041511 15:72690818-72690840 ATTTCCATGAGCAATGCATGAGG + Intronic
1132671517 16:1103943-1103965 CTTTCCAGGGGAAAGGCCTGAGG - Intergenic
1135891317 16:26359845-26359867 GCTTCCAAGGGAACTGGGTGAGG - Intergenic
1135901563 16:26464744-26464766 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1139195625 16:64915452-64915474 CTTTCCCTGGGATAAGCGTGAGG - Intergenic
1140985131 16:80151530-80151552 GTTTCCCTTGGAAATGGTTGAGG - Intergenic
1142759994 17:2036519-2036541 GTGTCCATGGGAACTGTGGGAGG - Exonic
1143238068 17:5420032-5420054 GCATCCAAGCGAAATGCGTGAGG - Exonic
1144139710 17:12336690-12336712 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1144459434 17:15446298-15446320 GTTTCCATGGGATAGGGGCGGGG - Intronic
1147316004 17:39620643-39620665 ATTTCCAGGGGCAATGGGTGGGG - Intergenic
1147463215 17:40589242-40589264 GTTTGCATGGGACCTGGGTGAGG - Intergenic
1151048372 17:70948088-70948110 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1152037211 17:77880776-77880798 GTTTCCCTGGGAAATGACAGAGG + Intergenic
1152200180 17:78940921-78940943 GTTGCCATGGAAAATACCTGAGG + Intergenic
1153069506 18:1089350-1089372 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1153769843 18:8406705-8406727 GTTTCCAAGGGAAAAGCTTGGGG + Intronic
1153965955 18:10182243-10182265 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1155003775 18:21709927-21709949 GTTTCCATAGCAAATGAGTGGGG + Intronic
1155082197 18:22421330-22421352 GTTTCTCTGGGAAATGCCAGGGG - Intergenic
1156667474 18:39425426-39425448 GGTTGCATGGGAACTGGGTGAGG + Intergenic
1161290706 19:3492125-3492147 GGCCCCATGGGAAATGCTTGGGG + Intronic
1164237818 19:23352229-23352251 GTTTGCATGGGAGCTGAGTGAGG + Intronic
1164320195 19:24137562-24137584 GTTTGCATGGGAGCTGAGTGAGG - Intergenic
1166604279 19:44126841-44126863 GTTTGCATGGGAGCTGGGTGAGG - Intronic
926585113 2:14677147-14677169 TTTTCCATGGGAATTTCTTGTGG - Intergenic
926916025 2:17893219-17893241 GTTTGCATGGGAACTGGGTGAGG - Intronic
931525243 2:63145557-63145579 GTTTGCATGGGAGCTGGGTGAGG - Intronic
932100680 2:68896742-68896764 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
932714274 2:74090261-74090283 GTTTACATGGGAAGAGCCTGGGG - Intronic
933406976 2:81872903-81872925 CTTTCCATGAGAAATGGATGAGG + Intergenic
934063029 2:88313897-88313919 GTTTTCATAGGGAATGAGTGTGG + Intergenic
935551161 2:104456650-104456672 GTTGCCATGGGAAGTGGCTGTGG - Intergenic
937529251 2:122808707-122808729 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
938598279 2:132811550-132811572 GTTTGCATGGGAGCTGGGTGAGG - Intronic
942849750 2:180470440-180470462 ATATCCATGAGAAATACGTGAGG - Intergenic
943621170 2:190150018-190150040 GTTTGCATGGGAGCTGGGTGAGG - Intronic
944859846 2:203804913-203804935 GTTACTATGGGCAGTGCGTGGGG + Intergenic
1169517488 20:6333324-6333346 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1170483727 20:16794214-16794236 GGTTGCATGGGAGATGAGTGAGG - Intergenic
1170863180 20:20127991-20128013 GTTTGCATGGGAGCTGGGTGAGG - Intronic
1172890323 20:38259919-38259941 GCTTCCATGGGAATTGGCTGGGG - Intronic
1174758551 20:53183612-53183634 TTTTCCATGAGAAATGTGAGAGG - Intronic
1175069046 20:56316392-56316414 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1177174461 21:17689333-17689355 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1177195607 21:17900992-17901014 GTTTGCATGGGAGGTGGGTGAGG - Intergenic
1178801656 21:35801258-35801280 GTTTGCATGGGAGCTGGGTGAGG + Intronic
1178850956 21:36211836-36211858 CTTTCCATGGGTAATGTGTAAGG + Intronic
1179343999 21:40539109-40539131 GTCTCCATGGGACAAGCTTGTGG + Intronic
1185225311 22:49648605-49648627 GTTTCCAAGGGATACGCCTGCGG + Intronic
949814235 3:8040982-8041004 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
955692702 3:61606096-61606118 GTTTCCATGGGTCATGAGTCTGG + Intronic
957016415 3:75069603-75069625 GTTTGCATGGGAGCTGCGTGAGG - Intergenic
958263001 3:91404271-91404293 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
961479492 3:127170936-127170958 GTTTCCATGGTTACTGCCTGGGG + Intergenic
962085191 3:132183906-132183928 TTTTCCATGGGAAAGGACTGGGG - Intronic
965211284 3:165792428-165792450 GCTTCCATGAGAAATACTTGAGG + Intronic
965247303 3:166289874-166289896 TTTTCTATGGAAAATGCATGTGG - Intergenic
970210903 4:13708946-13708968 ACTTCCATGGGAAGTGAGTGGGG + Intergenic
971012677 4:22456306-22456328 GTTTCCAGGGGAGATTGGTGCGG + Intronic
971183147 4:24349602-24349624 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
972314364 4:37912258-37912280 TTTTCCATGGGACATTCGAGTGG + Intronic
973767065 4:54172476-54172498 ATTTCCTAGAGAAATGCGTGAGG + Intronic
973787066 4:54342043-54342065 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
976686361 4:87819560-87819582 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
977106983 4:92898803-92898825 GTTTCAATGGGAAATGTGCATGG + Intronic
977667283 4:99655570-99655592 GTTTCCATGGGGCATGCCAGTGG - Intergenic
977746762 4:100558576-100558598 GTTTGCATGGGAGCTGGGTGAGG + Intronic
980195095 4:129578260-129578282 GATTGCATGGGAACTGGGTGAGG - Intergenic
983449767 4:167895319-167895341 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
984042117 4:174747969-174747991 GTCTCCATGTGAAAGGCATGGGG - Intronic
984323548 4:178224256-178224278 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
986846199 5:11757544-11757566 GTCTCCATTGGAAATGCGTTGGG - Intronic
988344581 5:30020963-30020985 GTTTGCATGGGAGCTGAGTGAGG + Intergenic
988712606 5:33793717-33793739 GTTTGCATGGGAGCTGAGTGAGG - Intronic
988902206 5:35745509-35745531 GTTTGCATGGGAGCTGCGTGAGG + Intronic
990233315 5:53739178-53739200 GTTTGCATGGGAACTAAGTGAGG + Intergenic
993692401 5:91018351-91018373 GATTCCATGGGAGATGCCTTTGG + Intronic
993883899 5:93394895-93394917 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
998853960 5:146377005-146377027 GTTTCCATGGGAACCACGAGGGG + Intergenic
998872896 5:146570312-146570334 TTTTCCATGCGAATTGCGTGGGG + Intergenic
998940846 5:147280479-147280501 GTTTTCATGGGAGCTGGGTGAGG + Intronic
1003063121 6:2877570-2877592 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1003097751 6:3156093-3156115 GTCTCCATGGTAACTGCCTGTGG + Exonic
1003101482 6:3179653-3179675 GTCTCCATGGTAACTGCCTGTGG + Intergenic
1006337130 6:33426679-33426701 GTTTCCATGGGAACAGTGAGGGG + Intronic
1007339728 6:41183202-41183224 GTTTCCATGGGAGTTGGGTTGGG - Intergenic
1008402342 6:51078314-51078336 GTTTGCATGGGAATGGGGTGAGG - Intergenic
1008632086 6:53371798-53371820 GTTTCCCAGGGAAATGAATGAGG + Intergenic
1008992406 6:57618616-57618638 GTTTGCATGGGAGCTGGGTGAGG + Intronic
1009181030 6:60517729-60517751 GTTTGCATGGGAGGTGGGTGAGG + Intergenic
1009453152 6:63825092-63825114 GTTTGCATGGGAGCTGGGTGAGG + Intronic
1010717753 6:79249210-79249232 TTATCCATGGGAAATGGGTAAGG - Intergenic
1011789754 6:90885581-90885603 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1012155935 6:95819815-95819837 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1013721064 6:113028503-113028525 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1014531412 6:122563763-122563785 GTTTGCATGGGAGCTGGGTGAGG - Intronic
1019064614 6:169286523-169286545 TTTTCCATGAGAAATGTGTCTGG - Intergenic
1020915221 7:14184467-14184489 GTTTGCATGGGAGCTGTGTGAGG + Intronic
1024745381 7:52400089-52400111 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1027856082 7:83513368-83513390 GATTCCCTGGGAACTGTGTGTGG - Intronic
1028176607 7:87667564-87667586 TTTTCAAGGGGAAATGCGTCTGG + Intronic
1028993588 7:97076093-97076115 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1029460766 7:100692985-100693007 GTTTCCATGCCAAAGGCGAGGGG + Intergenic
1031932610 7:127701433-127701455 GTATCCATGGGAAATCCTTAAGG + Intronic
1033539773 7:142345681-142345703 GTTTCCATGGGGACTGCGGGGGG - Intergenic
1033904458 7:146184695-146184717 TTTTACAAAGGAAATGCGTGTGG + Intronic
1034086566 7:148327851-148327873 GTCTCCATGAGAAAGGGGTGGGG - Intronic
1034294378 7:149959035-149959057 ATTTACATGGGAAATGACTGTGG - Intergenic
1034705505 7:153139603-153139625 GTTTGCTTGGGAACTGGGTGAGG - Intergenic
1034811691 7:154137837-154137859 ATTTACATGGGAAATGACTGTGG + Intronic
1035177037 7:157058843-157058865 GTGCCCATGGGGAAGGCGTGGGG + Intergenic
1036777397 8:11623065-11623087 GCCTCCATGGGAACTGCATGAGG + Intergenic
1038530098 8:28311707-28311729 GTAGCCATGGGACATGCATGGGG + Intergenic
1039268480 8:35854587-35854609 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1040711553 8:50195242-50195264 GTTTGCATGGGAGCTGTGTGAGG - Intronic
1041293774 8:56333576-56333598 GTTTGCATGGGAACTGGGTGAGG - Intergenic
1046005999 8:108484990-108485012 GTTTCTAGGGGAAATGCCAGAGG - Intronic
1046074391 8:109299441-109299463 GATTGCATGGGAATTGGGTGAGG + Intronic
1047341075 8:123981031-123981053 GTTTCCATGGGAATTGTATTTGG - Intronic
1048577846 8:135706850-135706872 GTTTCCAGGGGAAATGGGTAGGG + Intergenic
1049952240 9:656404-656426 GTGTCCTTGGGAAATGGGTGGGG + Intronic
1050502663 9:6315145-6315167 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1051880642 9:21836391-21836413 GGTTCCAAGGCAAATGGGTGGGG + Intronic
1052142894 9:25009271-25009293 GATTCCAGGGGAAATTCTTGTGG - Intergenic
1052537118 9:29761475-29761497 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1052731482 9:32291361-32291383 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1053112455 9:35473784-35473806 AGCTCCATGGGAAATGCATGTGG + Intergenic
1053215306 9:36265689-36265711 TTTTCCATGGGAAGTGGGGGTGG + Intronic
1056857409 9:90144517-90144539 GTTACCAGGGGCAATGGGTGGGG - Intergenic
1057119521 9:92558933-92558955 GTTTGCGTGGGAACTGGGTGAGG - Intronic
1061941653 9:133887203-133887225 GTTTCCATGGGGAGTCCCTGAGG - Intronic
1062028411 9:134351041-134351063 GACTTCATGGGAAGTGCGTGTGG + Intronic
1186446035 X:9629821-9629843 GATTACATGGGAAGTGAGTGTGG + Intronic
1187267594 X:17749473-17749495 GTTTCCATGCGAGATCCCTGTGG + Exonic
1187748362 X:22433533-22433555 GTTTGCATGGGAGCTGCGTGAGG + Intergenic
1188216726 X:27488102-27488124 ATTTCCATTGGCAATGTGTGAGG + Intergenic
1189603158 X:42648670-42648692 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1190691414 X:52916209-52916231 TTCTCCATGGGAACTGCGAGGGG + Intergenic
1190694569 X:52939583-52939605 TTCTCCATGGGAACTGCGAGGGG - Intronic
1191080627 X:56505958-56505980 GTTTGCATGGGAGCTGGGTGAGG + Intergenic
1191779892 X:64854089-64854111 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1191903588 X:66064485-66064507 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1192881133 X:75285100-75285122 GTTTACATGGGAGCTGGGTGAGG - Intronic
1194614699 X:96086734-96086756 GTTTCCATGGGGAAGGCTTATGG + Intergenic
1195441043 X:104898147-104898169 GTTTCCATGGAAACTGGGTTAGG + Intronic
1196737464 X:118992360-118992382 GTTTGCATGGGAGCTGGGTGAGG + Intronic
1197066257 X:122237403-122237425 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1197588893 X:128384093-128384115 GTTTTCATGGGAGCTGGGTGAGG + Intergenic
1197671673 X:129284527-129284549 GTTTGCATGGGAGCTGGGTGAGG - Intergenic
1198814956 X:140580101-140580123 GTTTTCAGGGGAAGTGCGAGGGG + Intergenic
1199799690 X:151237337-151237359 GTTGCCTTGGGAAATGGGTATGG + Intergenic
1200886576 Y:8278068-8278090 GCTTCCATGGGAACAGGGTGGGG - Intergenic
1202043701 Y:20714509-20714531 GTTTGCATGGGAGGTGGGTGAGG + Intergenic