ID: 904916911

View in Genome Browser
Species Human (GRCh38)
Location 1:33976899-33976921
Sequence TTTAGGTTCTTCAAGTGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904916911 Original CRISPR TTTAGGTTCTTCAAGTGTCG TGG Intronic
904838657 1:33356011-33356033 TTTAGGTTCTTAAAGTATCCAGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
906642234 1:47448406-47448428 TTTCGGATCTTCCAGTGTGGTGG + Intergenic
913549998 1:119907853-119907875 TTTAAGGTCCTCAAGGGTCGAGG + Intergenic
919507247 1:198414732-198414754 TTAAGGTTCTTCAAATTTCAAGG + Intergenic
920807074 1:209245048-209245070 ATTAGGTTATTCCAGTGTCTAGG - Intergenic
1064456651 10:15493274-15493296 TTTGAGTTCTTCAAGAGTCTTGG - Intergenic
1065038679 10:21667345-21667367 TTGAGGTTCTTAAACTGTGGGGG + Intronic
1065218179 10:23470903-23470925 TTTATGTTCAGCAAGTGTCCTGG + Intergenic
1068807177 10:61210436-61210458 TTTAGGACCCTCAAGTGTGGGGG - Intergenic
1068824157 10:61414466-61414488 TTTAAATGCTTCAAGTGTAGAGG + Intronic
1071271544 10:84012002-84012024 TTTAGAATCTTCAAGTGAAGTGG - Intergenic
1072185909 10:93038801-93038823 TTTGAGTTCTTCAAGGGTAGAGG - Intronic
1073668767 10:105563413-105563435 TTTATTTTCTTTAAGTTTCGGGG - Intergenic
1073751287 10:106530006-106530028 TTTTTGTCCTTCAAGTGTCTGGG + Intergenic
1084570149 11:69954685-69954707 TTTAGATTCTGCAAGAGTAGTGG + Intergenic
1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG + Intronic
1090232895 11:125121730-125121752 TTTCAGTTTTTCAAGTGTCCAGG + Intergenic
1097006932 12:55926761-55926783 TTTAGGTTCTTCAGGCTTGGGGG - Intronic
1097201495 12:57282649-57282671 TTTTGCTTTTTCAAGAGTCGGGG - Intronic
1097631964 12:62074987-62075009 TTCAAGATCTTCAAGTGTGGTGG - Intronic
1100868142 12:98879929-98879951 TTTTGTTTATTCAAGTGTCATGG - Intronic
1102366795 12:112344415-112344437 TTTAGTTTCTTATAGTGTGGCGG - Intronic
1102737785 12:115178699-115178721 TTTAGGGTCTTCAACAGTTGAGG - Intergenic
1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG + Intergenic
1124658709 15:31528099-31528121 TTTAGGAACTTCATGTGTCCCGG - Intronic
1147642642 17:42013678-42013700 TTTATGTTTTTCATGTGTCCTGG - Intronic
1149484705 17:57033362-57033384 TTTAGTTGCTTCAAGTGTAAAGG + Intergenic
1150880545 17:69020953-69020975 TTTATGTTCTTGAAGGGTAGAGG - Intronic
1156497518 18:37535882-37535904 TTTGGGTTCCTCTAGTCTCGAGG + Intronic
926830949 2:16961151-16961173 TTTAGGTGAGTCAAGTGTCTGGG + Intergenic
928882370 2:36112342-36112364 TTTAGGCACTTCATGTGTCTAGG - Intergenic
930146063 2:48005810-48005832 TTTGGGTTCTTCAAATTTTGGGG + Intergenic
932548783 2:72744558-72744580 TTCACGTTCTCCAAGTGTCAAGG - Intronic
939240863 2:139558547-139558569 TTTAGGTTCTTTAGATGTCTGGG + Intergenic
940073411 2:149714716-149714738 TTTTTGTTCTTTAAGTTTCGGGG - Intergenic
944091248 2:195914446-195914468 TATAGGTTCTTCAAGTGATTGGG + Intronic
1169502356 20:6173159-6173181 TTTAGCTACTTCAAGTTTGGGGG - Intergenic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1175353147 20:58340643-58340665 TTTAAGTTCTTTGAGTGTAGGGG - Intronic
951440184 3:22713634-22713656 TGTAGGTTCTTCAGGTGTTTGGG + Intergenic
951517226 3:23573727-23573749 TTTAGGTATTGCAAGTGTGGAGG - Intronic
955469034 3:59266964-59266986 TTTAGGTTGTTTATGTGTCTTGG + Intergenic
964072611 3:152653133-152653155 TTTAGGTTCTTGAATTCTGGTGG - Intergenic
970516492 4:16836238-16836260 TTGAGATTCTTCAAATGTTGAGG - Intronic
975771321 4:77726041-77726063 TTTAGATTCTTAAAATGTCTAGG - Intronic
980138007 4:128879376-128879398 TATAGGTTCTCCAAGTGTCATGG - Intronic
985218989 4:187682704-187682726 TTCAGTTTCTTAAAGTGTTGGGG - Intergenic
992425139 5:76649290-76649312 TCCAGGTTCTACAAGTGTCTGGG - Intronic
994959461 5:106579789-106579811 TTTTGGTTCTACAAGTGCCCTGG - Intergenic
996591189 5:125149532-125149554 TTGTGGTTCTTCAAATGTGGCGG - Intergenic
999739197 5:154536828-154536850 TTTAGGTTGTTCTAGTATCTTGG + Intergenic
1001764614 5:174235579-174235601 TTTAAGTTCTTGAAGTGATGGGG - Intronic
1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG + Intronic
1007538462 6:42618357-42618379 TCAAGGATCTTCAAGTGTCCTGG - Intronic
1013974591 6:116062545-116062567 TTTAGATTTTTGAATTGTCGGGG + Intergenic
1021491664 7:21225746-21225768 TTTAAGTTCAACAAGTGTCAGGG - Intergenic
1023788141 7:43728979-43729001 TTTCTGTTATTCAAGTGTGGTGG + Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1038973764 8:32668418-32668440 TGTAGGTTATTGAAGTGTCAGGG + Intronic
1039198792 8:35063005-35063027 TTTGGGGGCTTCAAGTTTCGTGG - Intergenic
1047155580 8:122313988-122314010 GTTAGGTTTTGCAAATGTCGTGG - Intergenic
1048209243 8:132441147-132441169 TTTGAGGTCTTCAAGTGTTGGGG - Intronic
1059162056 9:112043752-112043774 TCTAGCTTCTTAAAGTGTCAAGG - Intronic