ID: 904917244

View in Genome Browser
Species Human (GRCh38)
Location 1:33979112-33979134
Sequence CATGCTCCTGTCTCACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 486}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904917241_904917244 9 Left 904917241 1:33979080-33979102 CCACGTTTCTGTTGCTTTGTGTG 0: 1
1: 0
2: 3
3: 22
4: 272
Right 904917244 1:33979112-33979134 CATGCTCCTGTCTCACCTGCTGG 0: 1
1: 0
2: 1
3: 28
4: 486
904917240_904917244 23 Left 904917240 1:33979066-33979088 CCTGGACTTGAACTCCACGTTTC 0: 1
1: 0
2: 0
3: 17
4: 239
Right 904917244 1:33979112-33979134 CATGCTCCTGTCTCACCTGCTGG 0: 1
1: 0
2: 1
3: 28
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904917244 Original CRISPR CATGCTCCTGTCTCACCTGC TGG Intronic
900216398 1:1484284-1484306 CATTCTCCTGTCTCAGCCTCCGG + Intronic
900647988 1:3717666-3717688 CTTCCTCCTGTCTCCCCAGCAGG - Intronic
900749603 1:4386893-4386915 CAGGCTCCTTTCCCAGCTGCTGG + Intergenic
900989493 1:6091754-6091776 TAAGCTCCTGTCTCTCCTGGAGG + Intronic
901078133 1:6568347-6568369 CATTCTCCTGTCTCAGCCTCCGG - Intronic
902641569 1:17769639-17769661 CATGCCTCTGTCTCTCCTGGAGG - Intronic
903183014 1:21614630-21614652 CACCCTCCTGTCTCACCTGGAGG + Intronic
903583485 1:24390252-24390274 CTTTCTCCTCTCTCACCAGCAGG - Intronic
904458677 1:30662685-30662707 CATGCTTCCTCCTCACCTGCAGG - Intergenic
904917244 1:33979112-33979134 CATGCTCCTGTCTCACCTGCTGG + Intronic
905716980 1:40160659-40160681 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
905788087 1:40773941-40773963 CCTCTTCCTGTCTCCCCTGCAGG - Intergenic
906621002 1:47279175-47279197 CATTCTCCTGCCTCAGCCGCCGG - Intronic
907790414 1:57658407-57658429 CATTCTCCTGTCTCAGCCTCTGG + Intronic
908249942 1:62257449-62257471 CTTGCTCCTCTGTCACCTCCAGG - Intronic
908758800 1:67493051-67493073 GATTCTCCTGTCTCAGCTTCCGG - Intergenic
909140564 1:71859253-71859275 CATGCTCCTGTCTCAGAGCCTGG + Intronic
910347001 1:86250438-86250460 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
912117343 1:106422907-106422929 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
913402404 1:118450520-118450542 AATGCTGCTGTCTCACCCTCCGG + Intergenic
914596805 1:149162297-149162319 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
915122571 1:153639895-153639917 GATTCTCCTGTCTCAGCTACAGG + Intronic
917480935 1:175411555-175411577 CATGCCCCTCTCCCAGCTGCTGG + Intronic
917565971 1:176211938-176211960 CAGATTCCTGACTCACCTGCAGG + Intergenic
919551888 1:199000910-199000932 CATGTTTCTTTCTCACCTGGTGG - Intergenic
920402114 1:205682323-205682345 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
920402746 1:205686936-205686958 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
920721603 1:208392602-208392624 CATCATCCAATCTCACCTGCAGG - Intergenic
922504911 1:226120849-226120871 CATGCTGCCGGCTCACCTGATGG - Intergenic
922878830 1:228963680-228963702 AATCCTCCTGTCTCAGCTTCTGG + Intergenic
922929459 1:229377475-229377497 CAAGCTCCCGCCTCCCCTGCAGG + Intergenic
923087116 1:230710295-230710317 CAAGGTCCTGTCTGCCCTGCAGG - Exonic
923155564 1:231275973-231275995 CAGGCTCCTGTCCCACCTCCTGG - Intronic
923208325 1:231779663-231779685 CATTCTCCTGCCTCAGCCGCCGG + Intronic
923637463 1:235714250-235714272 CATGGTCCTATCCCAGCTGCTGG - Intronic
924175699 1:241389091-241389113 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
924409177 1:243785168-243785190 CATTCTCCTGCCTCAGCCGCAGG + Intronic
1063117514 10:3082366-3082388 CTTGCTCCTGTTTCCACTGCAGG + Exonic
1063249039 10:4253845-4253867 CTTGCTCCTGTCGCACACGCTGG - Intergenic
1063467053 10:6253611-6253633 CATTCTCCTGCCTCAGGTGCTGG + Intergenic
1063765012 10:9129588-9129610 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1064226252 10:13488016-13488038 CATGATCTTGGCTCACCTCCAGG - Intronic
1064232393 10:13540752-13540774 GATCCTCCTGTCTCAGCTTCCGG + Intergenic
1064639921 10:17405263-17405285 AATCCTCCTGTCTCAGCTTCTGG - Intronic
1066279098 10:33897765-33897787 CATGCTTCTGTTTCATCTGCAGG - Intergenic
1066584255 10:36914280-36914302 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1068170252 10:53383397-53383419 AATTCTCCTGCCTCACCTTCTGG - Intergenic
1068549830 10:58393787-58393809 GATCCTCCTGTCTCAACTTCTGG - Intronic
1068604657 10:58991433-58991455 CATTCTCCTGCCTCAGCTTCTGG + Intergenic
1068892833 10:62165525-62165547 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1069837801 10:71319924-71319946 CGTGCTCCTGGGTCACCTGCGGG - Intronic
1070146832 10:73780498-73780520 GATCCTCCTGCCTCAGCTGCTGG - Intergenic
1070377302 10:75845508-75845530 CATGCTCCCTTCCCACCTTCAGG + Intronic
1070620010 10:78002169-78002191 CATGCCCCTCTCTCACCTGCTGG - Intronic
1070911126 10:80119296-80119318 CTTGATCCAGTCCCACCTGCTGG - Intergenic
1071172624 10:82885280-82885302 AATGCTCCTGTTTCAGCTACAGG - Intronic
1072414680 10:95237231-95237253 CATCCTCCTGCCTCAGCTTCCGG - Intergenic
1074848104 10:117416814-117416836 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1074977640 10:118594503-118594525 CATCCTCCTGTCTTACGTCCGGG - Exonic
1075273168 10:121070653-121070675 CTTGCTCCTGTCTCTCCTGTGGG + Intergenic
1075956997 10:126532729-126532751 CATTCTCCTGCCTCACCCTCCGG - Intronic
1076154645 10:128194364-128194386 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1077099780 11:817265-817287 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1077489405 11:2853484-2853506 CATGCTCCTTTCCAGCCTGCAGG + Intergenic
1077533069 11:3106328-3106350 CTTGCTCTTGTCTCGCCTCCCGG + Intronic
1078082152 11:8211808-8211830 CATGCACTTGTCTCACCTGAGGG - Intergenic
1078657786 11:13258252-13258274 CATTCTCCTGTCTCAGCCTCGGG - Intergenic
1079435860 11:20448919-20448941 CAGGCTGCTGCCTCACCTGTAGG - Intronic
1080860910 11:36149538-36149560 CATCCTCATCTCTCACCAGCTGG - Intronic
1082020378 11:47527988-47528010 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1082791734 11:57350402-57350424 CATTCTCCTGCCTCAGCTTCCGG + Intronic
1082822088 11:57551031-57551053 CATAACCCTGGCTCACCTGCAGG + Intergenic
1085323062 11:75586622-75586644 CCTGCTCCTGTTTCATCTGCAGG + Intergenic
1085490509 11:76912259-76912281 CATGCTTCTCTCTCAGCTTCAGG - Intronic
1089782778 11:120885200-120885222 CATACCCCTCTCTCACCTCCAGG - Intronic
1091386264 12:97690-97712 AATCCTCCTGTCTCAGCTACAGG - Intronic
1091564453 12:1638138-1638160 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1091901724 12:4149524-4149546 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1092200824 12:6581648-6581670 CCTGCACCTGTCCCACCTGCTGG - Exonic
1092234267 12:6796401-6796423 CAAGATCTTGTCTCACCAGCAGG + Intronic
1092421841 12:8338199-8338221 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
1093035362 12:14327408-14327430 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1093346760 12:18046355-18046377 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1094213728 12:27919211-27919233 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1095458273 12:42413665-42413687 GATTCTCCTGTCTCAGCTTCTGG + Intronic
1096115828 12:49054512-49054534 CATTCTCCTCACTCACCTCCAGG + Exonic
1097355997 12:58602601-58602623 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1097446789 12:59681238-59681260 CATACACTTGTCTCGCCTGCAGG - Intronic
1097450663 12:59733723-59733745 CAAGCTCCCATCTCACCTCCAGG + Intronic
1100348654 12:93756869-93756891 CATTCTCCTGGCACACCTACAGG + Intronic
1100642944 12:96499914-96499936 CTTGCTCCTGTCACACAGGCTGG - Intronic
1102250522 12:111383812-111383834 CTTGCTCCTGTCACCCATGCTGG - Intergenic
1102300006 12:111764919-111764941 CAATCTCCTGCCTCACCTTCTGG + Intronic
1103746187 12:123125973-123125995 CATTCTCCTGTCTCAGCCTCCGG + Intronic
1103941232 12:124502362-124502384 CTTACTCCCGTCTCACCTGCTGG - Intronic
1105472950 13:20708016-20708038 AATTCTCCTGTCTCAGCTTCTGG + Intronic
1105902229 13:24765119-24765141 CATTCTCCTGTCTCAGCCTCTGG + Intronic
1105926545 13:25014002-25014024 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1106029975 13:25991112-25991134 CTTCCTCCTGTATCTCCTGCAGG - Intronic
1106362449 13:29045047-29045069 CATGCTCCTCTATGACCAGCTGG + Intronic
1106485692 13:30170793-30170815 CATGCTCTCTTCTCACCTCCCGG + Intergenic
1106522353 13:30509038-30509060 CATCCTTCTGCCTCAGCTGCTGG + Intronic
1106939772 13:34765038-34765060 GATTCTCCTGTCTCACATTCTGG + Intergenic
1108984118 13:56561500-56561522 AATGCTCCTGTCTCTCCAGTGGG + Intergenic
1109112482 13:58339405-58339427 CATGCTCCTGAATGACCTGTGGG - Intergenic
1109256765 13:60092543-60092565 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1110664754 13:78103812-78103834 CATGCTCCTTTCTAACCTGGTGG - Intergenic
1110844309 13:80176223-80176245 CTTGCTCCTGTCGCCCATGCTGG - Intergenic
1112192679 13:97193181-97193203 GCTGTTCCTTTCTCACCTGCTGG - Intergenic
1112880107 13:104096945-104096967 CAAGCTCCAGTGTCACCTGGAGG - Intergenic
1113312258 13:109142397-109142419 TATCCTCCTGCCTCACCTGGAGG - Intronic
1113571997 13:111364774-111364796 CATTCTCCTGCCTCAGCTGCCGG + Intergenic
1113701613 13:112392878-112392900 CAAGTTCCAGTCTCTCCTGCGGG - Intronic
1114183409 14:20383218-20383240 CCAGCTCCTCTCTCACCAGCCGG + Exonic
1114371342 14:22092308-22092330 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1115033635 14:28830234-28830256 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1117061106 14:51964768-51964790 CATCCTCCCGCCTCACCTTCCGG - Intronic
1117068083 14:52030743-52030765 CATCCTCCTGCCTCACCCTCTGG - Intronic
1118276860 14:64393291-64393313 CATTCTCCTGTCTCAGCCTCTGG - Intronic
1118387356 14:65267377-65267399 CATTCTCCTGCCTCACCCTCCGG + Intergenic
1119917220 14:78413389-78413411 GATTCTCCTGCCTCAGCTGCTGG + Intronic
1120386951 14:83858265-83858287 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
1121652961 14:95573474-95573496 CATGTTCCTGTCCCAGGTGCTGG - Intergenic
1122866065 14:104604489-104604511 CAGCCTCCTGTCTCTGCTGCTGG - Exonic
1122892282 14:104738354-104738376 CATGCCTCTGTCTCTCATGCAGG + Exonic
1123036027 14:105472302-105472324 CAGGCTGCTGTCTCATCAGCAGG - Intergenic
1123043137 14:105498751-105498773 CATCCTCTCGTCTCACCAGCCGG - Exonic
1126764460 15:51998794-51998816 CATTCTCCTGCCTCAGCCGCCGG + Intronic
1127147151 15:56036018-56036040 CCTGCTCCTGCCTCACCAGTAGG + Intergenic
1127450635 15:59112926-59112948 CATTCTCCTGCCTCAGCTTCTGG - Intronic
1127896314 15:63302439-63302461 CGTTCTCCTGACCCACCTGCTGG + Exonic
1128450823 15:67805025-67805047 GAGGCTCCTGACACACCTGCAGG - Intronic
1130145915 15:81273546-81273568 CAAGATCCTGTCTCAGTTGCTGG + Intronic
1130227152 15:82067908-82067930 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1130664548 15:85858838-85858860 CATGAGCCTGTCTCACCTTGAGG - Intergenic
1132616530 16:843637-843659 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1134022523 16:10930887-10930909 CCTGCTCCTGAGACACCTGCTGG + Exonic
1135386624 16:22047348-22047370 CATTCTCCTGTCTCAGCCTCCGG + Intronic
1135797905 16:25463253-25463275 CAAGCTTCTGGGTCACCTGCGGG + Intergenic
1136228962 16:28876070-28876092 GATCCTCCTGTCACACCTGAGGG - Intergenic
1136518215 16:30780594-30780616 CATTCTCAGGTCTCACCTTCAGG - Exonic
1136707396 16:32201463-32201485 CATGCTCCTGTCTCGCAGGAGGG + Intergenic
1137432415 16:48428814-48428836 CATGCTCCTTTCCCAAGTGCTGG - Intronic
1137433204 16:48434937-48434959 CATGTTCCTGCTTCACCTGAAGG - Intronic
1138538660 16:57674582-57674604 GAAGCTCCTGGATCACCTGCAGG - Intronic
1139035847 16:62945623-62945645 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1139193147 16:64888246-64888268 GATTCTCCTGTCTCAGCTTCTGG + Intergenic
1139922936 16:70471066-70471088 CACGCTCAGGCCTCACCTGCAGG - Exonic
1140072915 16:71668308-71668330 CATCCTCCTGCCTCAGCTTCCGG - Intronic
1140452370 16:75081065-75081087 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1140809955 16:78567445-78567467 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1140837127 16:78805364-78805386 CATTCTCCTGTCTCAGCCTCCGG + Intronic
1141678059 16:85527941-85527963 CATGCTCCTCTCTCTCTTCCAGG - Intergenic
1141945427 16:87305868-87305890 CATGCTGCTGGCACAACTGCTGG - Exonic
1143654044 17:8282821-8282843 TATGCTCCTGTCACCACTGCAGG - Intergenic
1143709221 17:8722433-8722455 CATTCTCCTGCCTCACCCTCCGG + Intergenic
1144727591 17:17509637-17509659 CAGGGCCCTGTCTCACCTGCAGG - Intronic
1144797359 17:17901278-17901300 CATGCTTCTGTCTCTTCTCCTGG - Intronic
1144809360 17:17988884-17988906 GATGCTCCTGTCTGGCATGCAGG - Intronic
1145223207 17:21106117-21106139 CATTCTCCTGCCTCAGCTACAGG + Intergenic
1147115337 17:38295053-38295075 CATTCTCCTGTCTCAGCCTCTGG + Intergenic
1147416620 17:40295905-40295927 CATCCTCCTGCCCCTCCTGCTGG + Intronic
1147793723 17:43028366-43028388 CATGCCCCTTTCTAAGCTGCAGG + Intronic
1148414342 17:47494541-47494563 CATTCTCCTGTCTCAGCCTCTGG - Intergenic
1148812880 17:50305664-50305686 CTTGCTCCTGTCTCCCAAGCTGG + Intergenic
1148879720 17:50716647-50716669 CATTCTCCTGCCTCAGCTTCTGG + Intergenic
1149124565 17:53212439-53212461 CATTCTTCTGTCCCACATGCTGG + Intergenic
1149652045 17:58281652-58281674 CATCCTCCTGTCTTCCCTGGGGG - Intergenic
1150253679 17:63725773-63725795 CATTCTCCTGTCTCAGCCTCTGG + Intronic
1151748123 17:76022393-76022415 CATCCTCCAGGCTCACCTACCGG + Exonic
1152597588 17:81245576-81245598 CAGGCGCCTGTCTAAGCTGCCGG + Exonic
1153390600 18:4553595-4553617 AATCCTCCTGCCTCAGCTGCTGG + Intergenic
1153689254 18:7574924-7574946 CATTCTCCTGCCTCAGCTTCCGG - Intronic
1153850477 18:9089403-9089425 TCTGCTTCTGTCTCACCTGCTGG + Intergenic
1154092508 18:11378643-11378665 GATTCTCCCGCCTCACCTGCAGG + Intergenic
1155041813 18:22071138-22071160 CCTGCTCCGGCCTCACCTCCAGG + Intergenic
1155366587 18:25055269-25055291 CTCGCTTCTGACTCACCTGCAGG - Intergenic
1156364617 18:36414521-36414543 GAAGCTCCTGTCTTACCTGAAGG + Intronic
1156387182 18:36616058-36616080 CATACTCCTTTGTCACCTACTGG - Intronic
1156498227 18:37540185-37540207 CAAGTGCCTGTCTCACTTGCTGG + Intronic
1156567714 18:38214681-38214703 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1157260194 18:46170609-46170631 GATTCTCCTGTCTCAGCTTCCGG + Intergenic
1157613733 18:48975374-48975396 CTCGCGCCTGTCTGACCTGCGGG - Intergenic
1159157168 18:64600121-64600143 CATGCTCCTATCTGACCTCCTGG - Intergenic
1159831243 18:73280566-73280588 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1160125688 18:76169464-76169486 CATGCTCCTGTGTCGGCAGCAGG - Intergenic
1160129699 18:76213791-76213813 CATCTTCCTGTCTCACTTTCTGG - Intergenic
1160321805 18:77903265-77903287 CATGCTTCTGTTTCGCATGCGGG + Intergenic
1160731359 19:643024-643046 CTTGCTCCTCCCTCACATGCTGG + Intronic
1160955543 19:1689999-1690021 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1161228613 19:3160761-3160783 CATGCTTCTCTCTCAGCTTCTGG + Intronic
1161836890 19:6653875-6653897 CTTGCCCCTGTCTCACATTCTGG + Intergenic
1162012549 19:7826627-7826649 CATTCTCCTGCCTCACCCTCCGG - Intergenic
1162202413 19:9030219-9030241 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1162452827 19:10765061-10765083 CATGCTCCTGTCTCAGCCTCCGG + Intronic
1162905527 19:13821176-13821198 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1163145308 19:15375740-15375762 CATTCTCCTGTCTCAGCCTCCGG + Intronic
1163335704 19:16670378-16670400 GATTCTCCTGCCTCAGCTGCCGG + Intronic
1163591329 19:18195729-18195751 CATTCTCCGGTCTCAGCTTCCGG - Intronic
1163833897 19:19562062-19562084 CCTGCAACTGCCTCACCTGCTGG - Exonic
1163893106 19:20034254-20034276 TTTGCTGCTGTCTCATCTGCTGG + Intronic
1164700291 19:30280036-30280058 CATGTTCCATTCTCTCCTGCGGG - Intronic
1164872440 19:31657165-31657187 CAGGCTTGTGTCTCAGCTGCAGG - Intergenic
1165091702 19:33391366-33391388 CATGGTCCAGGCTCACCTGGGGG - Exonic
1165455495 19:35908177-35908199 CCTGCTCCTGCCTCTCCTGCTGG - Exonic
1165664386 19:37614603-37614625 CTTGCTCTTGTCTCCCATGCTGG - Intronic
1165832967 19:38738283-38738305 CATCCTCCTTTTTCACCAGCAGG + Exonic
1166009683 19:39933312-39933334 GATCCTCCTGTCTCAGCTTCTGG + Intronic
1166072106 19:40393815-40393837 CCTGCTCCTGTCTCTCTGGCAGG - Exonic
1166475019 19:43116277-43116299 CATTCTCCTGTCTCAGCCTCTGG + Intronic
1166656825 19:44618372-44618394 CACACTCCTGTGTCCCCTGCTGG - Intronic
1166713667 19:44952919-44952941 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1166715262 19:44962917-44962939 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1166781860 19:45347234-45347256 CATTCTCCTGCCTCAGCTTCCGG - Intronic
1166823762 19:45596930-45596952 CAAGGTTCTGTCTGACCTGCTGG + Intronic
1167451965 19:49576027-49576049 CATTCTCCTGCCTCAGCTTCCGG - Intronic
1168088277 19:54064282-54064304 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
1168193180 19:54755245-54755267 CAGGCTCCTATCTCCCCTCCAGG - Intronic
1168201198 19:54817202-54817224 CAGGCTCCTATCTCAACTCCAGG - Intronic
1168232176 19:55039731-55039753 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1202634094 1_KI270706v1_random:28209-28231 CATTCTCCTGCCTCAACTTCTGG - Intergenic
1202651784 1_KI270707v1_random:11808-11830 CATTCTCCTGCCTCAACTTCCGG + Intergenic
925030910 2:649343-649365 CATGCTTGTGTCTCTCCTACAGG - Intergenic
925159673 2:1675241-1675263 CCAGCTCGAGTCTCACCTGCCGG - Intronic
925197042 2:1934078-1934100 CATGCTCCTGCCTCAGCCTCTGG + Intronic
925878276 2:8330100-8330122 CATGGTTCTGTCACATCTGCTGG - Intergenic
926606488 2:14903836-14903858 CATCCCCCTGTCACACCTGATGG + Intergenic
926884867 2:17587652-17587674 CATCATCTTCTCTCACCTGCAGG - Intronic
927187090 2:20489715-20489737 CATGCACCTGCATCACCTGGAGG + Intergenic
927433672 2:23048456-23048478 CTTGCTCCTGTGTCAACTGCTGG + Intergenic
927616924 2:24607582-24607604 CATTCTCCTGTCTCAGCCTCCGG - Intronic
928201754 2:29251629-29251651 CCTACGCCTGTCCCACCTGCAGG - Intronic
928787307 2:34904421-34904443 CATTCTCCTGCCTCAGCTTCTGG + Intergenic
929292452 2:40209071-40209093 CATGCACCTGTCTCATCTCAAGG - Intronic
929837645 2:45421399-45421421 CATTCTCCTGCCTCAGCTTCTGG - Intronic
930909215 2:56610673-56610695 CATTCTCCTGTCTCAGCTAAGGG - Intergenic
931248185 2:60508363-60508385 CTTGCTCCTGTGGCCCCTGCAGG - Intronic
932450191 2:71804839-71804861 CATGTTCCTCTCTCATCTGATGG - Intergenic
933356471 2:81216329-81216351 AATGATCCTGTCTTACCTACAGG + Intergenic
933501958 2:83124456-83124478 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
933949952 2:87320405-87320427 CATGCTCCTGACTCCCCTCTCGG + Intergenic
934887714 2:98039447-98039469 CATGCTCCCCTCCCACGTGCTGG + Intergenic
935468363 2:103426314-103426336 AATTCTCCTGTCTCAGCTCCCGG - Intergenic
936151614 2:110025055-110025077 CATCCTGCAGCCTCACCTGCTGG + Intergenic
936193060 2:110346314-110346336 CATCCTGCAGCCTCACCTGCTGG - Intergenic
936330240 2:111541192-111541214 CATGCTCCTGACTCCCCTCTCGG - Intergenic
937479683 2:122245109-122245131 CTTTCTCCTGATTCACCTGCTGG - Intergenic
937755587 2:125533890-125533912 CATTCTCCTGCCTCAGCCGCTGG - Intergenic
938085731 2:128400329-128400351 GATTCTCCTGCCTCAGCTGCTGG + Intergenic
938268456 2:129947369-129947391 CTTGATCCAGTCCCACCTGCTGG + Intergenic
938875711 2:135530119-135530141 CATTCTCCTGTCTCAGCCTCCGG - Intronic
940527444 2:154834621-154834643 CATTCTCCTGTCTCAGCCTCCGG - Intronic
941134655 2:161699123-161699145 CATTCTCCTGTCTCAGCTTCAGG + Intronic
942210797 2:173667561-173667583 CCTATTCCTGTCTTACCTGCTGG - Intergenic
942863114 2:180639548-180639570 CATGCTCCTGAATTACCAGCGGG + Intergenic
942939500 2:181599429-181599451 GATTCTCCTGCCTCACCTTCTGG - Intronic
943310592 2:186319998-186320020 CATGCTCCTGAATGACCTGTGGG + Intergenic
943414705 2:187587364-187587386 CATGCTACTATTACACCTGCTGG + Intergenic
943642875 2:190378463-190378485 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
944260479 2:197670567-197670589 AATCCTCCTGCCTCAGCTGCTGG - Intronic
944664779 2:201950863-201950885 CATGCTCCTGTTTCCTCTTCTGG + Intergenic
946276169 2:218633475-218633497 CTCCCTCCTGCCTCACCTGCCGG - Intronic
946382305 2:219357377-219357399 GATTCTCCTGTCTCAGCTTCCGG - Intergenic
946761868 2:223002756-223002778 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
946802169 2:223430032-223430054 CAGACTCATGTCTCACCTGGTGG - Intergenic
946830600 2:223724559-223724581 CATGCTCCTTTCTCACTGGGTGG - Intergenic
948756144 2:240160755-240160777 CATGGTCCTGTGTGACCTCCTGG + Intergenic
1169972478 20:11283235-11283257 CATCCTCCTGTCTCAGCCTCTGG - Intergenic
1170069423 20:12348834-12348856 CATGCCCCTCTCTCATCAGCTGG + Intergenic
1171961276 20:31496810-31496832 CATGCTCTTGCCTCCTCTGCTGG - Intergenic
1172463018 20:35134440-35134462 CATGCCCCTGACTCACTTGACGG - Intronic
1172660144 20:36562423-36562445 AATCCTCCTGCCTCAGCTGCAGG - Intergenic
1173714091 20:45187279-45187301 CAGGTTCCTTTCTCACCTCCTGG + Intergenic
1174131872 20:48350751-48350773 CATGCTCCAGAATCACCAGCAGG + Intergenic
1174634265 20:51985654-51985676 CATTCTCCTGCCTCAGCTTCTGG + Intergenic
1174984835 20:55439628-55439650 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1175587027 20:60149254-60149276 CATGCTCCTCTCCCAAGTGCTGG + Intergenic
1175596712 20:60240478-60240500 CAGGCTCCTGTATTGCCTGCTGG + Intergenic
1175672104 20:60912254-60912276 CTTGCTCCTGTCTCCCAAGCTGG - Intergenic
1176646310 21:9353987-9354009 CATTCTCCTGCCTCAACTTCCGG - Intergenic
1177472671 21:21579479-21579501 CTTGCTCCTGTCTCCCAGGCTGG + Intergenic
1177713405 21:24808866-24808888 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
1178661093 21:34508446-34508468 AATTCTCCTGTCTCAGCTTCCGG + Intergenic
1179232483 21:39517864-39517886 GATTCTCCTGCCTCAGCTGCCGG + Intergenic
1179571702 21:42282413-42282435 GATGCTCCTGACTTACCTGGTGG - Exonic
1180366607 22:11945005-11945027 CATTCTCCTGCCTCAACTTCCGG + Intergenic
1180676756 22:17591722-17591744 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1181189603 22:21128638-21128660 GATTCTCCTGTCTCAGCCGCCGG - Intergenic
1181189822 22:21130099-21130121 GATTCTCCTGTCTCAGCCGCCGG - Intergenic
1181209382 22:21280406-21280428 GATTCTCCTGTCTCAGCCGCCGG + Intergenic
1181289230 22:21778224-21778246 CATTCTCCTGCCTCAGCTTCTGG - Intronic
1181299606 22:21870091-21870113 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
1181542055 22:23578852-23578874 CATTCTCCTGCCTCAGCTTCCGG - Intronic
1181649498 22:24250981-24251003 GATTCTCCTGTCTCAGCCGCCGG + Intergenic
1181707873 22:24659765-24659787 GATTCTCCTGTCTCAGCCGCCGG - Intergenic
1181708088 22:24661226-24661248 GATTCTCCTGTCTCAGCCGCCGG - Intergenic
1181748950 22:24975873-24975895 GATGCTGCTGACTCACCAGCAGG + Intronic
1181750697 22:24987274-24987296 CATTCTCCTGTCTCAGCCTCTGG + Intronic
1181756183 22:25026622-25026644 CATTCTCCTGCCTCAGCTTCCGG - Intronic
1182971962 22:34587573-34587595 CACACTCCTTTCTCACCAGCTGG - Intergenic
1183207606 22:36430503-36430525 CATGATCTTGGCTCACCTCCCGG + Intergenic
1183256935 22:36768514-36768536 CAAGCTCATCTCTCACCTACTGG + Intronic
1183412551 22:37663735-37663757 TTTGCTCCTGCCTCCCCTGCAGG + Intronic
1184014481 22:41775697-41775719 CATCCTCCTGTCTCAGCCTCCGG + Intronic
1184168449 22:42744230-42744252 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1184376489 22:44117008-44117030 CATCCTCCTGTCTCAGATCCTGG - Intronic
1184771341 22:46598574-46598596 CCGGCTCCTGGCTCACCTGTGGG + Intronic
1185320066 22:50196493-50196515 ATTGCCCCTGTCTCACCGGCCGG - Intronic
1185334632 22:50266061-50266083 CCTTCTCCTGTTTCCCCTGCAGG + Intronic
1203217564 22_KI270731v1_random:15037-15059 GATTCTCCTGTCTCAGCCGCTGG - Intergenic
949646166 3:6096931-6096953 CTTGCTCCTGTCTCTCCTGACGG + Intergenic
950181108 3:10914074-10914096 CAAGTTCCTGTCCCACCAGCAGG - Intronic
950428349 3:12936697-12936719 CATTCTCCTCTCCCACCCGCAGG - Exonic
951707971 3:25563101-25563123 CATGCTCCTTGCTCAATTGCTGG + Intronic
952243694 3:31562303-31562325 CATACTCATGCATCACCTGCAGG - Intronic
952268347 3:31808207-31808229 CAACCTCCTGTCAAACCTGCTGG - Intronic
953717699 3:45330060-45330082 CATCCTCCTCTCTCATCTCCAGG + Intergenic
954014212 3:47672318-47672340 CATTCTCCTGCCTCAGCCGCTGG + Intronic
954160791 3:48720302-48720324 GATTCTCCTGTCTCAGCTTCCGG - Intronic
954694065 3:52410855-52410877 CAGGCTCATGTCGCGCCTGCCGG - Exonic
957369505 3:79274384-79274406 TATGCTCCTGAATGACCTGCGGG + Intronic
957829060 3:85491844-85491866 CATTCTCCTGTCTCAGCCTCCGG - Intronic
960630439 3:119725312-119725334 CATCCTCCTGCCTGACCTACAGG + Intronic
960687126 3:120306225-120306247 CATTCTCCTGGCTCAGCTTCCGG - Intergenic
963648563 3:147947560-147947582 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
965215377 3:165856791-165856813 CATGCTACAGTATCACATGCGGG + Intergenic
966201299 3:177361586-177361608 CATGCTCCTCTCTGAGCTGAGGG - Intergenic
968009757 3:195266386-195266408 GATTCTCCTGTCTCAGCTTCCGG - Intronic
968291731 3:197544357-197544379 CAAGCTCCTGGCTCACTTGAGGG - Intronic
1202740573 3_GL000221v1_random:51066-51088 CATTCTCCTGCCTCAACTTCCGG + Intergenic
968566661 4:1316941-1316963 CACACTCCAGACTCACCTGCAGG + Intronic
968566686 4:1317014-1317036 CACACTCCAGACTCACCTGCAGG + Intronic
968566735 4:1317158-1317180 CACACTCCAGACTCACCTGCAGG + Intronic
968566771 4:1317269-1317291 CACACTCCAGACTCACCTGCAGG + Intronic
970724178 4:19024186-19024208 CATTCTCCTGTCTCAGCCTCTGG - Intergenic
971019571 4:22520090-22520112 AATTCTCCTGTCTCAGCTTCCGG - Intergenic
971237027 4:24851514-24851536 TATGCTCCTGTCTCATCTTTTGG - Intronic
973728088 4:53795912-53795934 CATGCTCCTGTCTTAACACCTGG + Intronic
974437083 4:61869830-61869852 GATCCTCCTGTCTCAGCTTCCGG - Intronic
978897330 4:113904588-113904610 CATTCTCCTGCCTCACCCTCCGG + Intronic
980695419 4:136348963-136348985 CATGTCCCTTTCTCAGCTGCAGG + Intergenic
980900223 4:138897870-138897892 CATGCATCTGACTCACCTGCAGG - Intergenic
980928357 4:139160855-139160877 CATTCTTCTGTCTCAGCTTCTGG - Intronic
982016539 4:151160190-151160212 CATTCTCCTGCCTCAGCTTCCGG + Intronic
982047983 4:151468177-151468199 CATTCTCCTGCCTCAGCCGCCGG - Intronic
983346788 4:166536653-166536675 CATTCTCCTGTCTCAGCGTCTGG - Intergenic
983648041 4:170011702-170011724 TATGTTCCTGTGTCCCCTGCCGG - Intronic
985333614 4:188868515-188868537 GATTCTCCTGTCTCAGCTTCTGG - Intergenic
985692394 5:1320665-1320687 CATGCCCACGTCTCACCGGCTGG - Exonic
985879785 5:2629554-2629576 AATTCTCCTGTCTCAGCTTCTGG + Intergenic
985904044 5:2819147-2819169 CATGCTCCTCTATCACCAGGGGG - Intergenic
987137588 5:14914145-14914167 TATTCTCCTGCCTCACCAGCAGG - Intergenic
987566810 5:19599779-19599801 CATTCTCCTGCCTCAGCTACAGG - Intronic
988038530 5:25859021-25859043 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
988492043 5:31713153-31713175 CATGCTCTGGTCTCACCAGAAGG + Intronic
988983785 5:36597371-36597393 CGTGCCCCTGTCCCAGCTGCTGG - Intergenic
989056077 5:37367636-37367658 CATTCTCCTGTCTCAGCCTCCGG + Intronic
989379437 5:40798474-40798496 CAGGCTCCTTTCTCCCCTGGCGG + Intergenic
990362857 5:55038929-55038951 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
991084585 5:62636832-62636854 CCTCTTCCTGTCTCACCTGAGGG - Intergenic
991673246 5:69068288-69068310 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
992343720 5:75853448-75853470 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
992554026 5:77885710-77885732 CATGCTCCCGTCTCCACTACAGG - Intergenic
994243973 5:97457348-97457370 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
994311120 5:98272090-98272112 CATTCTCCTGTCTCAGCTTCCGG + Intergenic
994749919 5:103725241-103725263 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
995750896 5:115452237-115452259 CATGCTCTTATCTGCCCTGCAGG + Intergenic
996007370 5:118437808-118437830 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
996350732 5:122538747-122538769 CTTGCTCTTGTCACACATGCTGG - Intergenic
997454123 5:134004914-134004936 CAGGCTCCTGTGTCTGCTGCCGG - Exonic
997473526 5:134129894-134129916 GAGGCTTCAGTCTCACCTGCTGG - Intronic
998000569 5:138621853-138621875 CATTCTCCTGTCTCAGCCTCTGG - Intronic
999043503 5:148443120-148443142 GATGCTCCTGTCTCAGCCTCCGG + Intergenic
999057422 5:148594540-148594562 CATGTACCTGTCTCACATGTTGG - Intronic
1000876509 5:166645639-166645661 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1001625441 5:173128884-173128906 CATTCTCCTGCCTCAGCCGCCGG + Intronic
1003329332 6:5116828-5116850 CCTGCTCCTTCCTCCCCTGCAGG - Intronic
1003563771 6:7205165-7205187 CAGGCTTCAGTATCACCTGCAGG + Intronic
1003606656 6:7567864-7567886 CATGCCCCTGCAGCACCTGCTGG + Exonic
1004387678 6:15186690-15186712 GATTCTCCTGCCTCAGCTGCTGG + Intergenic
1005116885 6:22348850-22348872 GATGCTCCTGTCTCAACCTCTGG - Intergenic
1005359328 6:25016007-25016029 CATTCTCCTGCCTCAGCTTCCGG + Intronic
1005462836 6:26085522-26085544 CTTGCTCTTGTCTCCCATGCTGG + Intergenic
1006144319 6:31949221-31949243 CATGGTCCTGTCTCTTCTGCAGG + Exonic
1006505590 6:34486668-34486690 CCTACTCCTGTCACCCCTGCAGG + Intronic
1007394064 6:41567327-41567349 CCTGCTCCAGTCTCCACTGCTGG - Intronic
1007697191 6:43741183-43741205 CTTGCTCCTGCCTCCCCTCCTGG + Intergenic
1009300877 6:62018451-62018473 CATTCTCCTGTCTCAGCCTCCGG + Intronic
1009796830 6:68479996-68480018 CATGCTGCTTTCTTACCTGGTGG - Intergenic
1009943473 6:70316930-70316952 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1010813174 6:80323876-80323898 CATTCTCCTGTCTCAGCCTCCGG + Intronic
1011212149 6:84966689-84966711 CATGCTCCTGCCCCACCAGCTGG - Intergenic
1011535832 6:88375043-88375065 CATGCTCCTTTCCCACCTTGTGG + Intergenic
1011625714 6:89281977-89281999 CATGCCCCTCTCTGACCTGGTGG + Intronic
1012328973 6:97960512-97960534 CTTGCTACTGTCTTTCCTGCAGG + Intergenic
1012412193 6:98971282-98971304 TGTGCTCCTTTCTCACCTCCAGG - Intergenic
1013042535 6:106450110-106450132 GATGCTCCTGCCTCAGCAGCTGG - Intergenic
1013370438 6:109465913-109465935 CAGGCTCCTGTGTCAGCTGCAGG + Exonic
1014892191 6:126856365-126856387 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1016345918 6:143113878-143113900 CATTCTCCTGCCTCAGCTTCCGG + Intronic
1017754164 6:157515567-157515589 CATTCTCCTGCCTCAGCTTCCGG + Intronic
1017787896 6:157771803-157771825 CATTCTCCTGCCTCACCCACTGG + Intronic
1018454918 6:163943358-163943380 CATTCTCCTGTCTCAGCCTCTGG - Intergenic
1019706273 7:2498656-2498678 AAAGCTCCTTTCTCACGTGCGGG + Intergenic
1020019409 7:4853932-4853954 CATTTTCCTGTCTCCCTTGCAGG + Intronic
1021222436 7:17989623-17989645 CATCCTCCTGCCTCACCCTCCGG + Intergenic
1021760303 7:23896997-23897019 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
1022150095 7:27593915-27593937 CATTCTCCTGTCTCTGTTGCTGG - Intronic
1023840670 7:44095950-44095972 CATGCTGCTGACTTCCCTGCAGG - Intergenic
1024275844 7:47676338-47676360 CATTCTCCTGCCTCAGCAGCTGG + Intergenic
1025604718 7:63031212-63031234 CATTCTCCTGCCTCACCCTCTGG + Intergenic
1026148871 7:67771525-67771547 CTTGTTCATGTCTCTCCTGCTGG + Intergenic
1027616522 7:80431055-80431077 CATGCTCCTCTCCCAAGTGCTGG + Intronic
1028642194 7:93054732-93054754 CATCCTCCTGCCTCAGCTTCTGG - Intergenic
1028846621 7:95488233-95488255 CATTCTCCTGTCTCAGCCTCGGG - Intronic
1031173025 7:118315315-118315337 CATTCTCCTGTCTCAGCCTCTGG + Intergenic
1032463814 7:132130909-132130931 CTAGCTGCTGTCTAACCTGCAGG - Intronic
1032519226 7:132530079-132530101 CATGCTTCTGTGTCAACTCCAGG + Intronic
1032892793 7:136217354-136217376 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1033106244 7:138527804-138527826 AATCCTCCTGTTTCACCTACTGG - Intronic
1033571511 7:142633480-142633502 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1034139001 7:148799119-148799141 CCCTCTCCCGTCTCACCTGCAGG + Intronic
1034361568 7:150504053-150504075 CATGTCCCAGTCTCACCAGCAGG - Intergenic
1034544580 7:151781508-151781530 CATTGTCCTCTCTCACATGCGGG + Intronic
1034570956 7:151956010-151956032 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
1035000889 7:155611356-155611378 CATGCTCACCTCTCAGCTGCAGG + Exonic
1035466738 7:159084377-159084399 GCTGTTCCTGTCTCACCTGGCGG - Intronic
1036077028 8:5513516-5513538 CATGCTCCTCTCTCCTCTCCCGG - Intergenic
1036928844 8:12932780-12932802 GATGCTCCTGCCTCAGCTTCCGG - Intergenic
1037091645 8:14927212-14927234 CATTCTCCTGCCTCACCCTCCGG + Intronic
1038003427 8:23409827-23409849 CATTCTCCTGTCTCAGCCTCCGG + Intronic
1038197546 8:25382117-25382139 CATCTTCCTGCCTCAGCTGCTGG + Intronic
1038345734 8:26730924-26730946 CATGCTCCTGTCTGCCTTTCTGG + Intergenic
1038582905 8:28765485-28765507 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1038710296 8:29937866-29937888 CATGCTCCTGCCTCACATGGTGG - Intergenic
1039524367 8:38200702-38200724 CATTCTCCTGTCTCAGCCTCTGG + Intronic
1039529455 8:38247257-38247279 CATGCGCCTGTCCCAGCTACTGG - Intronic
1040487144 8:47884231-47884253 CAGCCTCCTGTCTCTGCTGCTGG - Intronic
1040513737 8:48117778-48117800 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1040551229 8:48439085-48439107 CCTGCATCTGTCCCACCTGCCGG - Intergenic
1040871871 8:52108037-52108059 CAAGCTCCTGTCCCTTCTGCAGG - Intergenic
1040938828 8:52811755-52811777 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1041102664 8:54412309-54412331 CATGCTTCCTCCTCACCTGCAGG + Intergenic
1041273472 8:56132550-56132572 CATTCTCTTCTCCCACCTGCAGG + Intergenic
1042811522 8:72830672-72830694 CATGCTTCTGGCTCATCAGCAGG + Intronic
1043372024 8:79606132-79606154 CATTCTCCTGCCTCAGCTTCTGG + Intergenic
1046480993 8:114818316-114818338 CATTCTCCTGCTTCAGCTGCAGG - Intergenic
1047371492 8:124259575-124259597 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
1047450693 8:124962845-124962867 CATGCTCCTCTCCCAAGTGCTGG + Intergenic
1047946466 8:129885883-129885905 CATCCTCCATTCTCACTTGCAGG + Intronic
1048394241 8:133998446-133998468 CTAGCTCCTGTCTCTCCTGGGGG - Intergenic
1048774634 8:137932302-137932324 CATTCTCCTGTCTCAGCCTCTGG + Intergenic
1048903089 8:139058885-139058907 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049571549 8:143372361-143372383 CATGCCCCTCTCCCACCTGTGGG + Intronic
1049620037 8:143593967-143593989 CCTGCTCCGGGCTCTCCTGCTGG - Intronic
1049707049 8:144047829-144047851 CTTGCTCCTGTCTCACCCTGTGG - Intergenic
1050732960 9:8730148-8730170 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1050771580 9:9208118-9208140 CATTCTCCTGTCTCAGCCTCCGG + Intronic
1051034269 9:12724402-12724424 CATCCTCCTGTCTCACTAGTTGG - Intergenic
1051450188 9:17189186-17189208 CATTCTCCTGCCTCAGCTTCTGG + Intronic
1051632978 9:19157142-19157164 CATTCTCCTGTCTCAGCCTCTGG - Intergenic
1051655961 9:19381794-19381816 CATCCTCCTGTCTCAGCCTCTGG + Intergenic
1053694170 9:40620240-40620262 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1054270666 9:63019892-63019914 CATTCTCCTGCCTCAGCTTCTGG + Intergenic
1054305415 9:63419464-63419486 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1054404161 9:64743449-64743471 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1054437783 9:65228949-65228971 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1054492621 9:65793018-65793040 CATTCTCCTGCCTCAGCTTCTGG + Intergenic
1054905788 9:70413012-70413034 CAGGATCCTGTCTCTCCTCCGGG + Exonic
1055119340 9:72640736-72640758 CATTCTCCTGCCTCACCTCCCGG + Intronic
1055563778 9:77548178-77548200 CATGCTCCTCTCCCAGCTCCTGG + Intronic
1057500684 9:95594736-95594758 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
1057515321 9:95715536-95715558 CTTGCTCTTCTCTCTCCTGCTGG + Intergenic
1057570774 9:96202762-96202784 CTTGCTCTTGTCGCCCCTGCTGG - Intergenic
1059105633 9:111509148-111509170 GATTCTCCTGTCTCAGCTTCCGG - Intergenic
1061062591 9:128258090-128258112 CCGGCGCCTGGCTCACCTGCTGG - Exonic
1061167578 9:128932951-128932973 CATTCTCCTGTCTCAGCCTCCGG + Intronic
1061380715 9:130255259-130255281 CAAGCCCCTGCCTCAGCTGCAGG + Intergenic
1062081251 9:134624880-134624902 CATGCCCCTGAGTCACCAGCTGG + Intergenic
1062280343 9:135749075-135749097 CTTGCTCCTGTCTGTCCTGCAGG + Intronic
1062557081 9:137118091-137118113 CATTCTCCTGTCTCAGCCTCCGG + Intergenic
1062585404 9:137247177-137247199 GATTCTCCTGTCTCAGCTTCCGG - Intronic
1203709217 Un_KI270742v1:81005-81027 CATTCTCCTGCCTCAACTTCCGG + Intergenic
1185525876 X:778299-778321 CATTCTCCTGCCTCAGCTTCCGG - Intergenic
1185634493 X:1541741-1541763 CATTCTCCTGTCTCAGCCTCTGG + Intergenic
1185677260 X:1858947-1858969 CATTCTCCTGTCTCAGCCTCCGG - Intergenic
1186072851 X:5841556-5841578 CATGCTCACGTCCCAACTGCTGG + Intronic
1186184606 X:7008067-7008089 CATTCTCCTGTCTCAGCCTCTGG + Intergenic
1186473653 X:9840340-9840362 CATGATCATGGCTCACCTCCTGG + Intronic
1186780927 X:12911352-12911374 CATGCTCCTCTCCCAGCTTCTGG + Intronic
1186882104 X:13876857-13876879 CATGATGCTGTGTCACCTCCTGG + Intronic
1186895701 X:14002607-14002629 CATTCTCCTGCCTCAGCTTCGGG + Intergenic
1188457702 X:30386031-30386053 CATGCCTCTTTCTCACCTTCTGG - Intergenic
1189108286 X:38259309-38259331 CATGCACCTGTCCCAGCTTCTGG + Intronic
1189239363 X:39513924-39513946 CAGGCTCTTGACTCACCTCCAGG - Intergenic
1189419921 X:40847756-40847778 CATGCTCCTCTCCCAAGTGCTGG + Intergenic
1189840620 X:45072568-45072590 CCTGCTCCTCACTCATCTGCTGG + Intronic
1191191711 X:57675107-57675129 CATGCTCCTGTGTTGCCTGAAGG - Intergenic
1192405506 X:70881921-70881943 GATTCTCCTGTCTCACCTTCTGG - Intronic
1192626000 X:72729612-72729634 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1193140048 X:78017879-78017901 CATTCTCCTGCCTCAGCCGCTGG + Intronic
1194160169 X:90439141-90439163 CATGCTCCCCTCCCAACTGCTGG - Intergenic
1194770501 X:97898064-97898086 CAGGCTCCATTTTCACCTGCAGG + Intergenic
1194794295 X:98191614-98191636 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1194850718 X:98865316-98865338 CATGCTCCCCTCTCAAGTGCTGG + Intergenic
1194987590 X:100507669-100507691 CATTCTCCTGCCTCAGCTTCCGG + Intergenic
1195584827 X:106552794-106552816 CATTCTCCTGTCTCAGCCTCAGG - Intergenic
1196977301 X:121174213-121174235 CATTCTCCTGCCTCAGCTTCTGG + Intergenic
1199077525 X:143541149-143541171 GATTCTCCTGCCTCAGCTGCTGG - Intergenic
1199369567 X:147031308-147031330 GATTCTCCTGCCTCACCTTCTGG - Intergenic
1199451162 X:147980556-147980578 CATTCTCCTGCCTCAGCTTCTGG - Intergenic
1199996435 X:153029451-153029473 ACAGCTCCTGCCTCACCTGCAGG - Intergenic
1200506461 Y:4016093-4016115 CATGCTCCCCTCCCAACTGCTGG - Intergenic
1200590474 Y:5067905-5067927 CATTCTCCTGTCTCAGCCTCCGG - Intronic
1202067379 Y:20954010-20954032 CATTCTCCTGTCTCAGCCTCTGG + Intergenic