ID: 904917677

View in Genome Browser
Species Human (GRCh38)
Location 1:33982142-33982164
Sequence AGGCAAACAGAAGTGGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 1, 2: 3, 3: 42, 4: 496}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904917677 Original CRISPR AGGCAAACAGAAGTGGGTGA TGG Intronic
900251604 1:1673350-1673372 AGGGAAACTGAAGTTGGTGGTGG + Intronic
900261965 1:1735886-1735908 AGGGAAACTGAAGTTGGTGGTGG + Intronic
903475590 1:23617121-23617143 AGACAAACAGAACTGACTGATGG + Intronic
903860596 1:26362105-26362127 AGGGAAAGAGAGGTGGGTCATGG - Intronic
903865209 1:26392776-26392798 GGGTAAAAAGAAGTGGGTGGGGG + Intergenic
903920231 1:26794810-26794832 TGGCAGACAGAATTGGGTGTAGG - Exonic
903967423 1:27099399-27099421 AGGCAGAGAGACGTGGGGGAGGG + Exonic
904149279 1:28423860-28423882 ATTCAAACAGAATTGGGAGAAGG + Intronic
904475711 1:30763539-30763561 AGGAAAACAGAAGTTGGAGTGGG - Intergenic
904590577 1:31613113-31613135 AGGGACACACAAGTGGGGGAAGG - Intergenic
904917677 1:33982142-33982164 AGGCAAACAGAAGTGGGTGATGG + Intronic
905466065 1:38154341-38154363 AGGCAAAAAGGAGAGGGTGGGGG - Intergenic
905562527 1:38938781-38938803 ATGCAAACAGAGGTTGCTGATGG - Intronic
906124592 1:43419950-43419972 AGGCACACTGAGGTGGGTGTGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
910382671 1:86645436-86645458 AGGCAAAGAGAGGTCAGTGAAGG - Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911055345 1:93703781-93703803 AGGTCAACAGAAGTGGCAGAGGG - Intronic
911253830 1:95611199-95611221 TACCAAAGAGAAGTGGGTGAAGG - Intergenic
911286715 1:96003375-96003397 AGGAACACAGAAGTGGGGGAAGG - Intergenic
912558447 1:110533153-110533175 AGACAAACAGAAATTGGTGGGGG + Intergenic
912723909 1:112042537-112042559 AAGCCATCAGAAGTGGGTGAGGG - Intergenic
913130506 1:115834354-115834376 GGGCAAAGAGAAGAAGGTGAAGG + Intergenic
915874421 1:159597379-159597401 AAGTAAAGAGAAGTGGATGATGG - Intergenic
916396234 1:164390716-164390738 AGAGAAACAGACTTGGGTGAAGG - Intergenic
916821614 1:168404191-168404213 AGGAGAAGAGAAGTGGGTGTTGG + Intergenic
917307432 1:173640886-173640908 AGGCTGACAGAAATAGGTGAGGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917910408 1:179638717-179638739 GGGGAAAAAGAAGTGGGGGATGG + Intronic
918083465 1:181224978-181225000 AAGCAGGGAGAAGTGGGTGATGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920361988 1:205425238-205425260 AGCCAAATAGAAGAGGGTTATGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921562774 1:216678466-216678488 TGGCAAAAAGAAGTGGGGGAAGG - Intronic
921584440 1:216930924-216930946 GAGCAACTAGAAGTGGGTGATGG + Intronic
922354129 1:224760271-224760293 AGGAAAACAGACGTGGGAGCTGG + Intergenic
922723172 1:227909418-227909440 AAGAAAACAGAGGTGGGGGAAGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923135645 1:231116074-231116096 AGGCACTAAGGAGTGGGTGATGG + Intergenic
923731736 1:236557810-236557832 AGTCAAAAAGCAGTGGGTGAAGG - Intronic
1062777343 10:163681-163703 AGGCAAACAGAAGAGGGTAAAGG - Intronic
1063391102 10:5650316-5650338 AGGAAAACAGAATTTGGGGAAGG - Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065307850 10:24385193-24385215 AGGCAGACTGAAGTGAGGGAAGG - Intronic
1066018978 10:31277631-31277653 AAGCAAGCAGGAGTGGGTGATGG + Intergenic
1066438751 10:35417482-35417504 AGGGAAAGAGAAGTTGATGATGG + Intronic
1067762547 10:49058959-49058981 AGGCAGACAGATGAGGGTGCTGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069581837 10:69572022-69572044 AGGCAGACAGACTTGAGTGAGGG + Exonic
1070069019 10:73067664-73067686 AGGGAGACAGGAGTGGGTGTGGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1072710980 10:97715243-97715265 ATGCAAACAGATATGGGGGAGGG - Exonic
1073355018 10:102847168-102847190 AGGCTCACAGAGGTGGGAGATGG + Intergenic
1075021518 10:118956003-118956025 AGGAAAGCAGAGCTGGGTGACGG + Intergenic
1075296528 10:121281201-121281223 AGGCAACAAGAAGTCTGTGAGGG + Intergenic
1075556530 10:123436359-123436381 AGGCACACAGTGGTGGGTGTTGG - Intergenic
1075557636 10:123444921-123444943 AGGCAAAAAGGAGAGGGTGTGGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076434465 10:130430623-130430645 AGGGAAGCAAGAGTGGGTGAGGG + Intergenic
1076750969 10:132542785-132542807 AAGGAAAAAGAAATGGGTGAGGG - Intronic
1077485721 11:2837604-2837626 GGGCAGACAGAGGTGGGGGATGG + Intronic
1077836795 11:5933281-5933303 AAGCACACAGGAGTGGGGGAAGG - Intronic
1079237751 11:18701867-18701889 AGGAAAACAGAATTTGTTGAGGG - Exonic
1079570062 11:21931977-21931999 GCGCAAACAGAAGTGAGTTAAGG - Intergenic
1079615004 11:22481267-22481289 AGGGAAACATAACTGGGTGAAGG + Intergenic
1079647895 11:22890545-22890567 AGGGAAACAGGAGTTGTTGATGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079962165 11:26938046-26938068 AGGAAAAGAAAAGTGGTTGAAGG - Intergenic
1080220223 11:29894409-29894431 AGGCAATCAGAAGCGGGGAAGGG + Intergenic
1080872607 11:36250359-36250381 AGGTAAAGAGAAGAGGGAGAAGG - Intergenic
1083161320 11:60855943-60855965 GGGCAGACAGAGGTGGGAGAGGG + Exonic
1083480204 11:62939357-62939379 AGGGAATTAGAAGTGGGTAATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085984786 11:81772394-81772416 AGCCAAAAAAAAGTGGGGGAGGG - Intergenic
1086242681 11:84714749-84714771 AGGCAAACAGAAGAAGGAGCAGG - Intronic
1087989384 11:104729542-104729564 AGGAAAGAAGAACTGGGTGAAGG + Intergenic
1088485873 11:110339822-110339844 AGAGAAAAGGAAGTGGGTGAAGG + Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089115113 11:116088512-116088534 AGGCAAAGTGAAGAGGGAGAGGG + Intergenic
1089385698 11:118066152-118066174 TGGCAAACAGAGGTGGGTTTGGG - Intergenic
1090161130 11:124497074-124497096 AGGTTAACAGCAGAGGGTGAAGG + Intergenic
1090436957 11:126695050-126695072 TCGCAGACAGAAGGGGGTGAGGG - Intronic
1090628403 11:128625535-128625557 AGGAAAAGAGAAGTTGGTGGGGG - Intergenic
1091216101 11:133903090-133903112 AGCCATACAGAAGTGGGGAAAGG + Intergenic
1091352900 11:134911867-134911889 AGGCAAACGGGAGTCTGTGAGGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094510053 12:31090897-31090919 AGGCAAACAGACGGGAGGGAAGG - Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095569227 12:43664175-43664197 GGGCAAACTGAGGTGGGTGGGGG - Intergenic
1095644876 12:44531614-44531636 AGTGAAACAGACTTGGGTGATGG - Intronic
1095691010 12:45088455-45088477 GGGCAAAAAGGAATGGGTGAAGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096510745 12:52126648-52126670 CGGCAAACAAAAGTGGGTGGAGG + Intergenic
1097712158 12:62928823-62928845 AGGCAAAGAGTAGAGTGTGAGGG - Intronic
1097722421 12:63037440-63037462 AGGGAAACAGAACAAGGTGAAGG - Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1097884071 12:64711542-64711564 TGGGAAAGAGAAGTGGGTGCTGG - Intergenic
1097957588 12:65501910-65501932 TGTCAGACAGAAGTGGGTGGAGG + Intergenic
1098570948 12:71986691-71986713 AGGAAAACAGAACTGGGTGCAGG - Intronic
1101276444 12:103206971-103206993 AGGGAAACAGAACTGGTTGGAGG - Intergenic
1101643445 12:106605924-106605946 AGGCTACAAGAAGTGGGAGAGGG - Intronic
1102415430 12:112758266-112758288 AGACAAAAGGAAGTGGATGATGG - Intronic
1102660534 12:114523650-114523672 AGGGAAACAGAAGTGGTTCTGGG + Intergenic
1102930013 12:116855107-116855129 AGGAAAACAGAATTGAGGGATGG - Intergenic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103844273 12:123890638-123890660 AGGGGAACAGGAGTGGGAGAGGG + Intronic
1104182209 12:126393188-126393210 AGGCCATCAGAGGTGGGTGAAGG - Intergenic
1104794960 12:131511034-131511056 GGGGAAACAGAAGGGGGTCATGG - Intergenic
1105317679 13:19282041-19282063 ACCCAATCAAAAGTGGGTGAAGG + Intergenic
1105782104 13:23714620-23714642 AGACAAACAGGAGGGGGAGAAGG - Intergenic
1106006885 13:25778980-25779002 AGACAAACAGATGGTGGTGATGG + Intronic
1106745189 13:32696621-32696643 AGGCTAACACAACAGGGTGAGGG + Intronic
1107780371 13:43895318-43895340 AGTGAGATAGAAGTGGGTGAGGG - Intergenic
1107971918 13:45651424-45651446 AGGCAAAAAGAAGGGAGAGAGGG - Intergenic
1108870335 13:54976710-54976732 AGGGAAACTAAAGTGGGTGAAGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109651531 13:65333624-65333646 AAGTAAACAGATTTGGGTGAAGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110491184 13:76109971-76109993 AGCCCATCAAAAGTGGGTGAAGG - Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112011355 13:95296424-95296446 AAGCAAACACAAGTGGCTGAGGG - Intronic
1112497046 13:99913558-99913580 AGACAGACAGGAGTGGGAGAAGG + Intergenic
1112760900 13:102692236-102692258 AGGCAAAGGGAAGTGGGTCTTGG + Intronic
1113270515 13:108668654-108668676 AGGCAAACTGAAGCGTGAGAAGG - Intronic
1113306601 13:109085871-109085893 ATGGAAACAGAAATGTGTGACGG + Intronic
1113479921 13:110613196-110613218 TAGGAAACAGAAGTGTGTGATGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114724384 14:24919751-24919773 ATGAAAACAGTAGTGGGAGAAGG + Intronic
1116865059 14:50025161-50025183 AAGCAAACAGAAATAAGTGAGGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117907928 14:60610015-60610037 AGGCAAACAGGATTGGGCAAAGG + Intergenic
1117996756 14:61485018-61485040 AGCCAAACAGAAGTGGAGGCCGG - Intronic
1118105086 14:62649625-62649647 AGGGAAACAGAAGGGGGAAATGG + Intergenic
1118728777 14:68652020-68652042 AGGCCATCAGGAGTGAGTGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119099046 14:71862755-71862777 AGGCTCACAGAAGTGGGTCAGGG - Intergenic
1119606700 14:76024740-76024762 AGGCTAACAAATGTGGCTGAAGG - Intronic
1121633113 14:95435746-95435768 AGGGAAACAGAAGTGAGCTAGGG + Intronic
1122441723 14:101736756-101736778 ATGCAAGCAGAAGGGGATGACGG - Intergenic
1122662112 14:103303390-103303412 AGGCAATTAGAAGCGGGGGAAGG + Intergenic
1122670133 14:103365447-103365469 AGACAGACAGACGTGGGTAAAGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124153100 15:27199912-27199934 AGGGAAAGAGAAATGGCTGAAGG - Intronic
1125721895 15:41849211-41849233 AGGGAAGGAGATGTGGGTGAGGG + Intronic
1125909111 15:43420607-43420629 AGACGAACAGATGTGGGTGCTGG - Exonic
1126778685 15:52120084-52120106 AGGCAGAAAGGTGTGGGTGATGG - Exonic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127466649 15:59250505-59250527 AGCCAAACAAAAGAGGTTGAGGG - Intronic
1127819198 15:62640367-62640389 AGGCAGAGAGAAGAGGGGGACGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128676385 15:69612129-69612151 AGGAAAAAAAAACTGGGTGATGG - Intergenic
1128856828 15:71024735-71024757 AAGGACACAGAACTGGGTGAAGG + Intronic
1129685420 15:77683708-77683730 AGGCCAACAGCAGTGGGACATGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130798531 15:87236253-87236275 AGGCATAAAGTACTGGGTGAAGG + Intergenic
1131434486 15:92412176-92412198 AAGGAAGGAGAAGTGGGTGAGGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131949508 15:97665852-97665874 AGGGAAACAGAGGAAGGTGATGG - Intergenic
1133161453 16:3914807-3914829 AGGCAGAGAGAAGTGGAAGAGGG - Intergenic
1133707932 16:8373018-8373040 AAGCAAGCAGAGGTGGGAGATGG + Intergenic
1134107660 16:11495310-11495332 AGGCAAACAGGAGGGGGTTCAGG + Intronic
1136580698 16:31149318-31149340 GGGCAAACTGAAGTGGGTGGAGG - Intronic
1137609566 16:49809725-49809747 AGGCCATCAGAAGTGGGAGCAGG - Intronic
1138036299 16:53610057-53610079 AGGCAAGGAGAAGTGGGCAATGG + Intronic
1138217166 16:55214512-55214534 AGGGAAAGAGAAGAGGGAGAAGG + Intergenic
1138499488 16:57430500-57430522 AGGGAGACAGAAGTGGGAGGAGG + Intronic
1141272155 16:82551120-82551142 AACCAAACAGAAGTGGAAGAAGG + Intergenic
1142541906 17:666311-666333 AGCCAAACAGAAGTGTTTGAAGG + Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143554291 17:7651105-7651127 AGGCAGAGAGAGGTGGGGGAGGG - Exonic
1143734433 17:8900600-8900622 AGGCCATCAGCAGTGAGTGATGG + Intronic
1146269084 17:31472727-31472749 AGCCAGACAGAAGTGAGGGATGG + Intronic
1146375836 17:32293804-32293826 AAGCAAACAGAAGTGGGTGAGGG + Intronic
1147044911 17:37744894-37744916 ACGGAAAAAGAAGGGGGTGAGGG + Exonic
1147522706 17:41189885-41189907 AGGGGAACAGCAGTGGGTCATGG - Exonic
1147530416 17:41271309-41271331 AGGGGAACAGCAGTGGGTCATGG - Intergenic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1148201515 17:45753000-45753022 AGATAACCAGAACTGGGTGAGGG + Intergenic
1148888264 17:50789166-50789188 AGGGAAACAGAATTGGGTAGGGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149623629 17:58064346-58064368 GGGCATGCAGAAGTGGGTCAAGG + Intergenic
1149681937 17:58513408-58513430 AGACAAAGAGGAGTGGGTGGGGG + Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151964899 17:77426124-77426146 AGGCAACCAGAGGTGGGGGGCGG - Intronic
1152303069 17:79506674-79506696 TGACAAACAGAACAGGGTGAAGG - Intronic
1152684793 17:81688677-81688699 AGGCAGGGAGAAGGGGGTGAGGG - Intronic
1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG + Intergenic
1153174666 18:2357450-2357472 AGGCAGACAGAGATGGGTGTTGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153835627 18:8961652-8961674 AGGTGAACACAAGAGGGTGAGGG + Intergenic
1154964719 18:21345302-21345324 AGGCAAACTGGGGTGGATGATGG - Intronic
1155527519 18:26731982-26732004 AGGGAAAAAGAAATAGGTGAAGG + Intergenic
1156675991 18:39528099-39528121 AGTGAAACAGAAGGGGGTGTGGG - Intergenic
1156748075 18:40416710-40416732 AGGCACATAGAGGTGGGTGTTGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157794837 18:50563972-50563994 AGGCACAGACAAGTGGGTGTTGG + Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158189661 18:54812240-54812262 TGGCAAACAGAAATGAATGAAGG + Intronic
1158868607 18:61662195-61662217 AGGCCAACAGGAGTGGTTGGTGG - Intergenic
1159254412 18:65927655-65927677 AGGCAAAAAAAAGGGAGTGAAGG - Intergenic
1159809024 18:72994234-72994256 AGGTAAAAAAAAGTGAGTGAGGG + Intergenic
1160075186 18:75667722-75667744 AGGCAAAGAGAAGAGTGAGAAGG - Intergenic
1160221945 18:76984406-76984428 AGTCAAGCAGACGTGGGTGTCGG - Intronic
1160413795 18:78693401-78693423 AGGCAGACAGACAAGGGTGATGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1165530044 19:36391113-36391135 AGACAACCAAAAGTTGGTGAAGG - Intronic
1165896748 19:39145960-39145982 AGGCCAACAGAGGTGGGGCAGGG - Intronic
1165902202 19:39174197-39174219 AGGGACAGAGATGTGGGTGAGGG - Intronic
1167123293 19:47531900-47531922 AGGCCATCAGGAGTGGGTGCTGG - Intronic
1167694246 19:51004943-51004965 TGGTAAACAGAAGTCGGGGACGG + Intronic
1168075190 19:53977500-53977522 AAGCAAGCAGAGGTGTGTGAGGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925430937 2:3792355-3792377 AGGCCAACAGAAGTAGGACAAGG - Intronic
925769472 2:7267936-7267958 ATGCAAACAGAACTGGGGAAGGG + Intergenic
925973535 2:9124904-9124926 AGGCAGACAGAAGTGAGTCCTGG + Intergenic
926030808 2:9586157-9586179 AATTAAATAGAAGTGGGTGATGG + Intronic
926705767 2:15836359-15836381 GAGGAAACAGAAGTGGGTCAGGG + Intergenic
927314382 2:21665068-21665090 AGAAAAAAAGAAGTGGGTAATGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
928713000 2:34028580-34028602 AGGCAAACAGTAGTGATTTATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930219734 2:48734367-48734389 AGAGGAACAGAAGTGGGAGAAGG + Intronic
930528600 2:52563005-52563027 AAGAAAACAGAAGTGGCTGGGGG + Intergenic
930641150 2:53855642-53855664 AGGCTAAGAGAAGTGGGGGTAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931067630 2:58604681-58604703 AGGCAAAGAGAAGAGGGCCAAGG - Intergenic
931240756 2:60450322-60450344 AGGATAACAGAAGTGGATAAAGG - Intergenic
932502596 2:72197017-72197039 AGGTAAACAGAAGAGAATGAAGG + Intronic
932655430 2:73607489-73607511 TGGGAAACAGATGGGGGTGAGGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933215369 2:79624037-79624059 AGGGAAAGAGAAGTGGGCAAGGG - Intronic
934568513 2:95353675-95353697 GGGCAAGCAGAAGTGGGTGCAGG + Intronic
935072532 2:99707872-99707894 AGAGAAACAGAAGGGGGTAAAGG - Intronic
935072627 2:99709010-99709032 AGAGAAACAGAAGGGGGTAAAGG + Intronic
936772046 2:115925392-115925414 AAGCAAACAAAAGTGGGTACAGG - Intergenic
937323788 2:120976805-120976827 AGACAGACAGAGCTGGGTGAAGG - Intronic
937774990 2:125765626-125765648 AGGCCAACAGAAGTGGAATAAGG + Intergenic
937856513 2:126675513-126675535 AGGCTCACAGGAGTGGATGATGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941784744 2:169485034-169485056 AGGCAAACAGAGGTGGTTGGTGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942898239 2:181084115-181084137 AAGCAAACAGAATTTGCTGAAGG + Intergenic
943544338 2:189256177-189256199 AGGCAAAAAGAAGTTTGTGAAGG + Intergenic
944761335 2:202818198-202818220 AAGTAAACAGAAATGAGTGAAGG + Intronic
945248727 2:207745093-207745115 GGACAAACAGGAGTGGGTTAAGG + Intronic
946350331 2:219146897-219146919 GGGCAAAAAGTAGTGGGAGAGGG + Intronic
947652896 2:231802313-231802335 AGAAAAAGAGAACTGGGTGATGG - Intronic
948145000 2:235702128-235702150 AGCCAAACAGAATTGGGGGCTGG + Intronic
948453426 2:238092824-238092846 AGGCAGAAAGGAATGGGTGAGGG - Intronic
948474378 2:238207554-238207576 AGGCGAAGAGAAGTGGGTCCTGG + Intergenic
948858540 2:240741908-240741930 TGGTAGACAGAGGTGGGTGAAGG - Intronic
1168980452 20:1999055-1999077 AGACTGACAGAGGTGGGTGAGGG - Intergenic
1169274952 20:4227543-4227565 GGGCCAACAGGAGTTGGTGATGG - Intronic
1170428300 20:16257043-16257065 AACCAAACAGATGTGGGAGAGGG - Intergenic
1170946548 20:20896016-20896038 AGGAAAAGAGAAGAGGGGGAAGG + Intergenic
1170996260 20:21362672-21362694 AAGGTAACAGAAGTGGGTTATGG - Intronic
1171070257 20:22061780-22061802 AGGCAAACAGAAGAGAGAGATGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172029151 20:31969109-31969131 AGGCAGAGAGGAGTGGGTTATGG - Intronic
1172936864 20:38626717-38626739 TGGAAAACAGAGGTGGGTGAAGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173870749 20:46340542-46340564 AGATGAACAGAAGTGGATGAAGG - Intergenic
1173919343 20:46732044-46732066 AGCCCTACAGCAGTGGGTGACGG - Intronic
1173952644 20:47005612-47005634 AGGCAAGGAGAACAGGGTGATGG + Intronic
1174289836 20:49500242-49500264 AAGCAAACAGCAGGAGGTGATGG - Intergenic
1174508885 20:51036168-51036190 AGGAAAAGTGAAGTAGGTGAGGG + Intergenic
1175206832 20:57317594-57317616 AGACATACAGAAGAGGGCGAAGG + Intergenic
1175461149 20:59152813-59152835 AGGCAACCAGAAGTGGGGCTTGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177403095 21:20631663-20631685 GGGGAAACAGAAGTTTGTGATGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178142831 21:29703216-29703238 AGGCACACAGAAGTTAGTTAAGG - Intronic
1178163772 21:29948549-29948571 AGGCAAAAAGAAGGAGGAGAAGG - Intergenic
1178674564 21:34620217-34620239 AGGCCATCAGAGGTGGGGGATGG + Intergenic
1178696923 21:34801045-34801067 AGGCAAACAGAAATAGCAGACGG + Intronic
1178761268 21:35405072-35405094 AGCCAAACAGAAGTGGGGCAGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1180823275 22:18846672-18846694 AGGCAAAGTGAACTGGGGGATGG - Intronic
1181123701 22:20689771-20689793 AGGCAAAGTGAACTGGGGGATGG - Intergenic
1181189468 22:21127874-21127896 AGGCAAAGTGAACTGGGGGATGG + Exonic
1181387899 22:22558344-22558366 AGGGAGACAGAAGGGGGGGAGGG + Intronic
1181399780 22:22644323-22644345 AGGCAAAGTGAACTGGGGGATGG + Intergenic
1181649631 22:24251745-24251767 AGGCAAAGTGAACTGGGGGATGG - Intergenic
1181875625 22:25938358-25938380 AATGAAACAGAGGTGGGTGAGGG + Intronic
1182485629 22:30636924-30636946 CGGCCAACTGAAGTGGGTGGTGG - Exonic
1183371002 22:37432386-37432408 AGGGAGACTGAAGTGGGGGAGGG - Intergenic
1183573161 22:38669445-38669467 GGGCATGCAGAAGTGGATGAAGG + Intronic
1184152329 22:42646328-42646350 AGGCAAGGAGAGGCGGGTGATGG - Intronic
1185033286 22:48457133-48457155 AAGCAAAGAGAGGTGGGTGGCGG - Intergenic
1203217214 22_KI270731v1_random:12812-12834 AGGCAAAGTGAACTGGGGGATGG + Intergenic
1203273416 22_KI270734v1_random:72578-72600 AGGCAAAGTGAACTGGGGGATGG - Intergenic
949405811 3:3713366-3713388 AGCAAAACAGGAGGGGGTGATGG - Intronic
949461760 3:4302299-4302321 AGACAACGAGAAGCGGGTGAGGG + Intronic
949592387 3:5508001-5508023 AGGAAAACAGGAGAGGGTGTGGG + Intergenic
951065331 3:18258178-18258200 AAGCAAACATAATTGGGTGGAGG + Intronic
951154784 3:19337929-19337951 AGGAAACAAGAAGAGGGTGAGGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951599342 3:24356123-24356145 AGGAAAAAAGGAGAGGGTGAAGG + Intronic
952226543 3:31382395-31382417 AGGCATACAGAACAGAGTGATGG + Intergenic
952934592 3:38386291-38386313 AGGCAAACAGAAGTGGCTCAAGG - Intronic
953282970 3:41576379-41576401 AGGCACTCAGCATTGGGTGAGGG - Intronic
953926363 3:46984652-46984674 AGACAAGCAGAAGTGGGACAGGG - Intronic
953928542 3:46994586-46994608 AGGCAACCAGAACTGAGTCAGGG + Intronic
954110641 3:48430941-48430963 AGGAAAGCCAAAGTGGGTGAGGG - Intergenic
954328743 3:49877806-49877828 TGGGAGGCAGAAGTGGGTGAGGG + Intergenic
954558472 3:51536806-51536828 AGGAAAAGAGAAGTGGGGGGAGG + Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955563002 3:60213254-60213276 AGACAAACAGAATTGGGAGACGG - Intronic
955615198 3:60800158-60800180 AGGCAGAGAGAAGTGGGGGAAGG - Intronic
955663713 3:61328224-61328246 AGGAAGTCAGAAGTGGGGGATGG + Intergenic
955900470 3:63748358-63748380 AGGCAGACTGATGTGGGGGATGG - Intergenic
957870105 3:86081040-86081062 AGGCAAACAGAATTTGATAAGGG - Intergenic
959181612 3:102987450-102987472 TCTTAAACAGAAGTGGGTGAGGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960740671 3:120830153-120830175 AGGGAATCAGAAGTGTGGGATGG + Intergenic
961061464 3:123832300-123832322 AGGAAAACAAAAGTGTCTGAAGG - Intronic
961244565 3:125440370-125440392 AGGCAAACAGAAGTGAGTTTAGG + Intergenic
961812643 3:129530766-129530788 AGGCAACCAGGAGTGGGAGAGGG - Intronic
962251498 3:133838707-133838729 GGGCAGGCAGAAGTGGGTGAGGG + Intronic
962716561 3:138131155-138131177 AGGCAAACAGAAGAGGCAGCTGG + Exonic
962847919 3:139287247-139287269 AGGCTAACACAGGTGGGTGCTGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963414385 3:144976107-144976129 AAGGAAACAGAAGTGCTTGAAGG - Intergenic
964162125 3:153658230-153658252 GTGCTAACAGAAGTGGGTGGTGG - Intergenic
967149071 3:186631549-186631571 ACAAAAACAGATGTGGGTGACGG - Intergenic
967765655 3:193276762-193276784 AGCCACACAGAATTGGGTGAGGG + Exonic
969130607 4:4988511-4988533 AGGAAGGCAAAAGTGGGTGAAGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969215484 4:5719125-5719147 AGGCGAGCAGAAGTGGCTGCTGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
972903213 4:43711111-43711133 AGACAGACAGAAGTGAGGGAGGG - Intergenic
973531625 4:51842331-51842353 GGGCATACAGATGTGTGTGACGG + Intergenic
973801838 4:54486118-54486140 ACACACACAGAATTGGGTGATGG + Intergenic
973918537 4:55661460-55661482 AGGTAAACAATAGTGAGTGATGG + Intergenic
973918561 4:55661670-55661692 AGGTAAACAATAGTGAGTGATGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975797307 4:78021213-78021235 ATGCAAACAGTAGAGAGTGATGG - Intergenic
976209500 4:82653260-82653282 AGGAAAAGAGAAGAGGGTGTGGG - Intronic
976358380 4:84147753-84147775 AGGCAAACAGTGAAGGGTGAAGG - Intergenic
977189861 4:93986199-93986221 AGACCAACAGAAGCGGGTGGTGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977995346 4:103493530-103493552 AGGCTAAAAAAAGTGGGTAAGGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979279123 4:118844908-118844930 GGGCAGAGAGAGGTGGGTGAGGG + Intergenic
979870061 4:125808025-125808047 AGGCAAACAGGAGTGAAAGAGGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980889382 4:138797729-138797751 AGGGAAACAGAGTTGGGAGAGGG + Intergenic
981667713 4:147248337-147248359 GAGCAAACAGAAGTGGATGGAGG - Intergenic
981980252 4:150783230-150783252 AGGGAAAAAGAAGTTGGTTAGGG - Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983900540 4:173128727-173128749 AGGCAAACAGCAAATGGTGAAGG - Intergenic
984947976 4:184984545-184984567 AGGCAACAAGAAGTTGGGGAAGG + Intergenic
985652289 5:1112582-1112604 GGGCAAACAGGAGGGGGTGCGGG - Intergenic
985841254 5:2307704-2307726 AGGCACGCAAAAGTGTGTGATGG + Intergenic
986014426 5:3745690-3745712 ATGAAAGCAAAAGTGGGTGATGG + Intergenic
986733025 5:10649229-10649251 ACACAAACAGAAGTGGGTGGCGG - Intronic
986762647 5:10894347-10894369 CGGGAAACAGAATTGGATGATGG + Intergenic
986977093 5:13407807-13407829 AGGCAAAAAGGAGTGTGTGTAGG + Intergenic
987208207 5:15649794-15649816 AGATAATCAGAAGTGAGTGAGGG - Intronic
987450203 5:18074069-18074091 ATGCAGACATAAGTGGGAGACGG - Intergenic
987500254 5:18699818-18699840 AGGCAAACAGACTTAGGAGAGGG + Intergenic
987762700 5:22186299-22186321 AATCAAAATGAAGTGGGTGAAGG - Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988657546 5:33228818-33228840 AGGCAAGCAGAAGTGGGAACAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989404823 5:41048639-41048661 AGGGAAAAAGAAATGGGAGAAGG - Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
991562846 5:67972666-67972688 AGGGAAACAGAGGTGGGGGGAGG + Intergenic
991897488 5:71419688-71419710 AATCAAAATGAAGTGGGTGAAGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992607627 5:78475475-78475497 AGGCACAAAAAAGTGGGAGAAGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995192652 5:109334559-109334581 AGCCAGACAGAAGTAGTTGATGG - Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996491800 5:124106635-124106657 AGGCAAAGAGAAGAGAGTAAGGG + Intergenic
996819345 5:127608873-127608895 ATGCAAAGAAGAGTGGGTGAGGG + Intergenic
998071981 5:139205167-139205189 AGGGAAACAGAGGAGGGGGAGGG - Intronic
998261939 5:140638452-140638474 AGGAAAACAAAAGTGTGTGTGGG + Intergenic
998939201 5:147262203-147262225 AGGCAAACAGAAGTGGGGTGAGG - Intronic
999637214 5:153635385-153635407 AGCCAAAGAGAAGTGGGTTGTGG - Intronic
1000434396 5:161190220-161190242 AGACAAAAAGAAGTGTATGAGGG - Intergenic
1000908496 5:166993028-166993050 ATGCAAGCAGGAGTGGGGGAGGG - Intergenic
1001448940 5:171809319-171809341 AGGCAAACAGAGGTTAGGGAAGG - Intergenic
1001649330 5:173304249-173304271 AGGCAGACAGAAATAGGTGAAGG - Intergenic
1003047859 6:2751267-2751289 GGGCAAACAGAGGTGGCTGTGGG - Intergenic
1003183078 6:3808368-3808390 AGTTGAACAGAAATGGGTGAAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005526301 6:26653755-26653777 AGGAAAACAGAATTGGGTGGAGG + Intronic
1007503831 6:42319039-42319061 AGGGAAACAGAAGATGGAGAAGG - Intronic
1007782558 6:44262938-44262960 GGGCAAAGAGGAGTGGGTGTGGG - Intronic
1007842721 6:44730033-44730055 AAGGAAACAGAGGTGTGTGAAGG - Intergenic
1008031435 6:46699255-46699277 GGGCAAACAGAACTGTGTGGTGG - Intronic
1008100022 6:47380231-47380253 AAACAAACAGAAATGGGTGATGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008821782 6:55641570-55641592 AGGAAAACAGAATTGGAAGAAGG + Intergenic
1009039900 6:58163669-58163691 ATGCAAACAGAAGAGGGGGCAGG - Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1010186407 6:73148956-73148978 TGTCAAAGAGCAGTGGGTGATGG + Intronic
1010405503 6:75501004-75501026 AGAGGAAGAGAAGTGGGTGAGGG + Intergenic
1011435412 6:87330860-87330882 AGGGAACAAGAAGTGGGTGATGG + Intronic
1011500986 6:87989543-87989565 AGGGAAAAAAAAGTGGGTAAAGG + Intergenic
1012133199 6:95521000-95521022 AGGCAAACAGGAGGGGATCAAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013723432 6:113060942-113060964 ACAGAAACAGAAGTGAGTGATGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014946349 6:127503216-127503238 AGGCAGACAGACTTGGGTGTGGG + Intronic
1015045714 6:128774084-128774106 GGGGACACAGGAGTGGGTGAAGG - Intergenic
1015771109 6:136769554-136769576 AAGTATACAGAAGTGGGTTAGGG + Intronic
1015926676 6:138317117-138317139 AGGCTAACAACACTGGGTGATGG + Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017048687 6:150370822-150370844 AAGCTATCATAAGTGGGTGAGGG + Intronic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1019843777 7:3476279-3476301 CAGCAAACAGCTGTGGGTGATGG - Intronic
1020846636 7:13293534-13293556 AGTCAAACAGCAGGGGGTGGGGG - Intergenic
1021576868 7:22112992-22113014 AGGTAGAGAGAGGTGGGTGAGGG + Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022643957 7:32213621-32213643 AGGCAAGCAGCAGTGTTTGAGGG - Intronic
1022935358 7:35169700-35169722 ATGAAAAAAAAAGTGGGTGAAGG + Intergenic
1023632729 7:42179906-42179928 ATCCAAACAGAAGTGTCTGATGG + Intronic
1026494139 7:70888137-70888159 AGGGAGAGAGAAGGGGGTGAGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028462509 7:91111409-91111431 AGGCAGCCAGAAGTGGGTGAGGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028981646 7:96973698-96973720 AGGAAAACAAAAGTGAATGAGGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1030908298 7:115213614-115213636 AGACAAACAGAGGTGGATGGTGG + Intergenic
1030932203 7:115538005-115538027 AGGCAAACAGAAGCGTTTTAGGG + Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031992957 7:128209761-128209783 AGCCAGACAGCAGTGGGAGAAGG + Intergenic
1034112277 7:148548513-148548535 AAGAAAACAGAAGTGGAGGAAGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034641479 7:152607438-152607460 AGGCAAACAGAGATGAGGGAAGG + Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035055873 7:156035842-156035864 AGGCACACATCAGTGTGTGATGG - Intergenic
1035676309 8:1458793-1458815 ATGAAAACAGGAGTGGGAGAAGG + Intergenic
1036007009 8:4676406-4676428 AGGCTCCCAGAAGTGGTTGAGGG - Intronic
1036070706 8:5438708-5438730 ATGGAAACAGAAGTGGGGAAAGG + Intergenic
1036098303 8:5749653-5749675 AATCAAACAGAGGTGAGTGACGG + Intergenic
1036137884 8:6179073-6179095 CAGCAAACAGAAGGGGTTGAAGG - Intergenic
1036515153 8:9437030-9437052 AGTCACACAGAAGTGGGAGAAGG - Intergenic
1036662521 8:10717044-10717066 AAGCAGAGAGAAGTCGGTGAAGG - Intergenic
1039456795 8:37712594-37712616 AGGGAAACAGAAGGAGGTGGGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039833796 8:41238885-41238907 AGGAAAACAGAGGTGGGGGCAGG + Intergenic
1040395739 8:46998639-46998661 GAGCAAACAAAATTGGGTGAAGG - Intergenic
1040449353 8:47528566-47528588 AGGCAAGAACAGGTGGGTGAAGG + Intronic
1041895860 8:62924127-62924149 AGGAAAACAGATGTGGCTGGAGG - Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1043720689 8:83544584-83544606 AGACACAGAGAAGGGGGTGAGGG - Intergenic
1044874399 8:96650148-96650170 AGACAAACAGGTGTGGGTGCTGG + Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045947192 8:107809668-107809690 ATGGAGACATAAGTGGGTGAAGG + Intergenic
1045947558 8:107813834-107813856 AGGCAATAAGAAGTGGGCTAGGG - Intergenic
1045949024 8:107830546-107830568 AGGGAAACAGAATTGGGAGAAGG - Intergenic
1047500301 8:125435309-125435331 GAGCAAACAAAAGTGGCTGATGG - Intronic
1048081473 8:131132798-131132820 AGGCAAAGAGCAGTGTGAGAAGG - Intergenic
1048159293 8:131998473-131998495 AGGGAAACAGAAGTTTGTTATGG - Intronic
1048264877 8:132976857-132976879 CATCAAACAGAAGTGGGTGGTGG + Intronic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1051612141 9:18971282-18971304 AGGCAAGCAGCAGTGGGGCATGG - Intronic
1052078566 9:24175201-24175223 AGGAATACAAAAGTGAGTGAAGG + Intergenic
1052291998 9:26852497-26852519 AGGTGAACAGAAGTAGGTTAGGG + Intronic
1052723860 9:32205665-32205687 AGTCTAACAAAAGTGGGAGATGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053324243 9:37128349-37128371 ATGAAAGCAGAAGTGGGAGAGGG + Intronic
1053440576 9:38112915-38112937 AGGGAGACAGACGTGGGTGAGGG + Intergenic
1055852675 9:80651124-80651146 AGACATACGGACGTGGGTGATGG + Intergenic
1056688795 9:88788369-88788391 AGGCAGGGAGAATTGGGTGAGGG - Intergenic
1057019642 9:91686549-91686571 AGGCAAACAGAAGCAGGTGGTGG - Intronic
1057179995 9:93024646-93024668 AAGGAAGCAGAAGTGGGTGGAGG + Intronic
1057541181 9:95972897-95972919 AGAGAAACTGAAGTGGCTGACGG - Intronic
1057724407 9:97557968-97557990 ACGTCAACAGAAGTGAGTGACGG - Intronic
1057832773 9:98419571-98419593 AGGCAAAGAGGAGTGGGAGGTGG + Intronic
1059145862 9:111898135-111898157 AGTAAAATAGAACTGGGTGATGG + Intronic
1059504554 9:114786344-114786366 ATGGAAACAGAATTGGGTAAGGG + Exonic
1060267560 9:122121250-122121272 AGGCTGACATAGGTGGGTGAAGG + Intergenic
1060686043 9:125613573-125613595 AGGAAAACAGAATTGGGTAGAGG - Intronic
1062237833 9:135521188-135521210 AGGGAAACTGAAGGGAGTGAAGG - Intergenic
1186548122 X:10472713-10472735 AGGCAAAAAGAAAGGGGTGGAGG - Intronic
1186789343 X:12981888-12981910 AGGCAAACAGAGGAAGGGGAAGG - Intergenic
1186900928 X:14054975-14054997 AGGCAAACACTTGTGGGTAAAGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188757265 X:33977536-33977558 AGGCAAACAGGAATGGGTTCTGG - Intergenic
1189439924 X:41026187-41026209 AGGCAAAAAGAAGGGGGAGAAGG + Intergenic
1189535178 X:41927890-41927912 AGGCACACAGAAATGGGAAAGGG - Intergenic
1189736857 X:44080252-44080274 GGGCACACAGAAGTGTGTGTGGG - Intergenic
1190031550 X:46977951-46977973 AGGTAAACAGGATTGGGTGGGGG + Intronic
1190526485 X:51333476-51333498 AGACAAACAGAAGTCTGTGCGGG - Intronic
1191006787 X:55718030-55718052 AGGAAAAGAGAGGTGGGTTAGGG - Exonic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191665598 X:63699199-63699221 AGGGAAAAAAAAGTGGGAGAAGG - Intronic
1192216838 X:69165047-69165069 AGGCAGGGAGAAGTGGGAGAGGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193284113 X:79691839-79691861 ATGCATAAAAAAGTGGGTGAAGG - Intergenic
1193300354 X:79881600-79881622 AGGGAAGCAGCAGTGGGTAAAGG - Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197810248 X:130434899-130434921 AGTCAGAAAGAAGGGGGTGAGGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198253909 X:134908456-134908478 AGGGAAACAGAAGGAGGGGAGGG - Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199765991 X:150941988-150942010 AGGCAAAGGGAAGAGGGGGAAGG + Intergenic
1199815360 X:151392408-151392430 CGGCAAACAGAAGTAGGCAATGG - Intergenic
1200065809 X:153503643-153503665 AGGCAAGCAGAGGTGGGTGCTGG + Intronic
1200152804 X:153959561-153959583 AGGCCAACAGAAGTGGCTCAGGG - Intronic