ID: 904917725

View in Genome Browser
Species Human (GRCh38)
Location 1:33982455-33982477
Sequence CCTCATTAGCAAACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904917719_904917725 15 Left 904917719 1:33982417-33982439 CCTTGAGAAAGCCATTTAACCAC 0: 1
1: 1
2: 5
3: 75
4: 620
Right 904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 141
904917720_904917725 4 Left 904917720 1:33982428-33982450 CCATTTAACCACACCGTGCTTCA 0: 1
1: 0
2: 1
3: 11
4: 107
Right 904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 141
904917722_904917725 -9 Left 904917722 1:33982441-33982463 CCGTGCTTCAGTTTCCTCATTAG 0: 1
1: 5
2: 54
3: 373
4: 1801
Right 904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 141
904917721_904917725 -4 Left 904917721 1:33982436-33982458 CCACACCGTGCTTCAGTTTCCTC 0: 1
1: 4
2: 91
3: 901
4: 3606
Right 904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904917725 Original CRISPR CCTCATTAGCAAACTGTGGA AGG Intronic
901858563 1:12059705-12059727 CCTCCAGAGCAAGCTGTGGAAGG - Intergenic
903919140 1:26787373-26787395 CCTCATTAGCCACCTGAGGTGGG + Intergenic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG + Intronic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
908363848 1:63397143-63397165 CCTCAATAAAAATCTGTGGAAGG + Intronic
909342647 1:74549023-74549045 CCTCATTAGCACACTGGGTAGGG + Intergenic
912960603 1:114192247-114192269 CCTCCCTAGCCAGCTGTGGAGGG + Intergenic
913440082 1:118887721-118887743 TGTCCTTAGCACACTGTGGATGG - Intronic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
916661436 1:166925578-166925600 ACTCTTGGGCAAACTGTGGATGG - Intronic
918141762 1:181725798-181725820 TCTCATGAGCAACCTGTGGATGG + Intronic
1067251637 10:44591675-44591697 CCTCGTTTGCAAACTCTGAAAGG + Intergenic
1071344551 10:84680215-84680237 CCTCTTTTGCACCCTGTGGATGG - Intergenic
1074198307 10:111208432-111208454 CCTCATCATCAAAATGTGGAGGG - Intergenic
1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG + Intergenic
1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG + Intergenic
1077257342 11:1592623-1592645 CCTCACTAGCCATCTGTGGGTGG - Intergenic
1078945823 11:16067588-16067610 CCTCATTAGCAGCATGAGGATGG + Intronic
1079554589 11:21743103-21743125 CCTCATTAGCAAAGTCAGAATGG - Intergenic
1079963779 11:26955483-26955505 CATCATTTGCAAAATGTTGATGG - Intergenic
1080719225 11:34832872-34832894 TCTTAGTAGCAAACTGTTGATGG - Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086270327 11:85055685-85055707 ATTCATTAGCAAAGTGGGGAAGG + Intronic
1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG + Intergenic
1101036202 12:100709555-100709577 CATCATTATCAAAATGTGTACGG - Intergenic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1104652034 12:130542069-130542091 CCTTATTGGGAAAATGTGGATGG + Intronic
1105575918 13:21651801-21651823 CCTCATTGGCACACTGGGAACGG - Intergenic
1106942122 13:34791017-34791039 CCTGGTTTGCAAACTCTGGATGG + Intergenic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1110584964 13:77178841-77178863 ACTCTTTAGTAAACTTTGGAAGG + Intronic
1110657823 13:78021099-78021121 CCTCATCAGGATTCTGTGGAAGG + Intergenic
1112816429 13:103278888-103278910 CCTCCTTGGCTCACTGTGGAAGG - Intergenic
1116490809 14:45500744-45500766 GCCCATTAGGAAACTGTGGCAGG - Intergenic
1116541536 14:46107726-46107748 CCTCATTTTCAAGCTGGGGAAGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1120011406 14:79419740-79419762 CCTCATTGACAAAATGAGGATGG + Intronic
1126002114 15:44220503-44220525 CTTCATTAGTAAAATGTGGGAGG + Intergenic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1129720650 15:77876218-77876240 CCTCAGGAGCCAGCTGTGGAAGG - Intergenic
1129937701 15:79464441-79464463 CCTCATTTGTAAACTGAAGATGG - Intronic
1130745708 15:86651696-86651718 ACTTATTAGCAATCTATGGAGGG - Intronic
1141553060 16:84819101-84819123 CCTCAGTCACAAAATGTGGACGG - Intergenic
1143756780 17:9073171-9073193 CCGCATTTGCAAACAGTGGCTGG + Intronic
1143867495 17:9934644-9934666 CCTCATCAGCAAACCAGGGAGGG - Intronic
1144566241 17:16361950-16361972 CATCATTTGCACATTGTGGATGG + Intergenic
1144599373 17:16599123-16599145 CCTCTTTAGAAAACTGGGGAGGG - Intergenic
1151112524 17:71696001-71696023 CATAATTAGCAAACTCTTGAGGG - Intergenic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152288703 17:79426635-79426657 CCTCATTTCCAAATTTTGGAGGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1155083582 18:22433481-22433503 CCTCATGAGCAAAGTGTTAAAGG - Intergenic
1155106389 18:22670194-22670216 CCTCCACAGCAAACTGTGGGTGG - Intergenic
1155297646 18:24399679-24399701 TTTCATTTGCAAACTGTAGAAGG - Intergenic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1158525386 18:58208599-58208621 CCTCATTAGAAAACTGTCTAAGG - Intronic
1159448398 18:68568306-68568328 CCTCATTAAAAAAATGTGGATGG - Intergenic
1161216732 19:3098436-3098458 TCTCACTGGTAAACTGTGGAGGG + Intronic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1167978102 19:53248743-53248765 ACACATAATCAAACTGTGGAAGG - Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
925230141 2:2225799-2225821 CCACAATAGCAATCTGAGGAGGG + Intronic
927744345 2:25602561-25602583 TTTCATTAGCAGACTGTAGAAGG - Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
932494493 2:72139730-72139752 CCGCCTTAGAAAGCTGTGGATGG + Intronic
932617696 2:73245436-73245458 GCTCAGTAGCCAAGTGTGGATGG - Intronic
933234144 2:79845913-79845935 CCTCTTTACTAAACTGTGGGAGG - Intronic
933565256 2:83942731-83942753 CATCATAAGCAAACTGTACATGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
940134612 2:150422398-150422420 GCTCAATAGAAAACTGTTGAAGG - Intergenic
941423251 2:165310103-165310125 GTTCATTAGAAAACTGTGAATGG - Intronic
943155171 2:184166337-184166359 GCTCATTAGAAAACTGAGAAGGG - Intergenic
945387499 2:209220383-209220405 CATCAATAGCCAACTGTGGTAGG + Intergenic
945947360 2:216007122-216007144 CCTCAATGGCCAACTGGGGATGG + Intronic
946095630 2:217271922-217271944 CCTCCTTAGGAATCTGAGGAAGG + Intergenic
946582043 2:221140304-221140326 ACTCATTAGGAAACTGGGGAAGG - Intergenic
947647168 2:231751024-231751046 CCTCATTACCAATCTAGGGATGG + Intronic
1169006588 20:2212461-2212483 ACTCATTAGCAGAATGTGTAAGG - Intergenic
1171840955 20:30210477-30210499 ACTCATTAGAAAACTGGGGTAGG + Intergenic
1174671121 20:52308539-52308561 CCTCATTAACATACTCTGTATGG + Intergenic
1175343021 20:58246896-58246918 CCATATTAGCAAACACTGGAGGG + Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1181321359 22:22009160-22009182 CTTTATAAGAAAACTGTGGAGGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
955298293 3:57754279-57754301 ACTCATTAGGGATCTGTGGAGGG + Intergenic
955375940 3:58397398-58397420 ACTGATTGGAAAACTGTGGAGGG + Intronic
956248867 3:67214762-67214784 ACTCATTACCAAAGTGTGAAGGG + Intergenic
959810171 3:110608807-110608829 CCACATTAACAAAATGAGGAAGG + Intergenic
961770417 3:129245544-129245566 CCGCCTTTGCAAACTGTGAAGGG - Intergenic
963538022 3:146552523-146552545 CCTCTTTAACAAACTGTAGCCGG + Intergenic
964029517 3:152120326-152120348 CCTCAGTAGACAACTGGGGATGG + Intergenic
966476170 3:180349580-180349602 GCTCTTTAGTAAACTGTGTATGG - Intergenic
969629019 4:8324543-8324565 CCTCTTTACCAACCTGTGGGTGG + Intergenic
975979611 4:80142500-80142522 CCTCATTAGGAAACTATGAATGG - Intergenic
978512923 4:109541260-109541282 CCCCATCAACAAACTTTGGAAGG + Intergenic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
986447363 5:7832860-7832882 CCTCAGGAGAAAACTGTGGCAGG - Intronic
987329821 5:16846788-16846810 ACACATTAGCAAAATGTTGATGG - Intronic
989344267 5:40411593-40411615 ACTCTTTAGGAAACTGTGGTAGG + Intergenic
989776229 5:45210543-45210565 TCTTAATAGGAAACTGTGGAAGG + Intergenic
990683084 5:58268098-58268120 CCTCATTTGCAATCTGTTGGGGG + Intergenic
992030388 5:72715287-72715309 CCTCATCAGCAATGTGAGGAAGG - Intergenic
992278133 5:75142677-75142699 CCTAATTGGAAATCTGTGGAGGG + Intronic
993132400 5:83915181-83915203 GCTCCTTAGGAAACTGTGGTGGG + Intergenic
996525895 5:124479031-124479053 CCTCATTGTCTAATTGTGGAAGG - Intergenic
998420688 5:141982817-141982839 CTTCATTATCAAACAGTGAATGG + Intronic
999119289 5:149196652-149196674 CCTGATTAGCAATCAGAGGAAGG - Intronic
1000437272 5:161228303-161228325 CTTCATTAGCAAAGTGTTAAAGG - Intergenic
1000681810 5:164194532-164194554 CCTCATAAGGAAATTGTGGTAGG - Intergenic
1001626727 5:173142501-173142523 CCACATTAGCACACTGTGCTTGG + Intergenic
1002077455 5:176717444-176717466 CCTCCTTTGTAAGCTGTGGAGGG - Intergenic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1010188911 6:73174739-73174761 CCTCACTGGCAAACTGGGGATGG + Intronic
1015046520 6:128782693-128782715 GCTCATTAAAAAACTGAGGAAGG - Intergenic
1017583461 6:155893904-155893926 CCTCATCAGAAAACTATGGCTGG + Intergenic
1018280661 6:162181937-162181959 ACTCATTATCAAACTGAGAATGG - Intronic
1023505205 7:40892199-40892221 CATCAATAGCAAAGTGTGGAGGG + Intergenic
1023554807 7:41410141-41410163 CTGCATTACAAAACTGTGGAAGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024565773 7:50679223-50679245 TGTCATTAGCAAACTGAGGCTGG + Intronic
1024879696 7:54071267-54071289 CCTCATTCCAAAACAGTGGAGGG + Intergenic
1026135577 7:67657805-67657827 ACACATAATCAAACTGTGGAAGG + Intergenic
1028583138 7:92427017-92427039 CCCCATAAGCTATCTGTGGATGG - Intergenic
1030338589 7:108351453-108351475 CTTCATCACCAAACTCTGGAGGG + Intronic
1033585582 7:142772161-142772183 CCTCATCAGCGAACAGTGGGTGG + Intergenic
1035111110 7:156482829-156482851 CTTCATGAGAAAACCGTGGAAGG + Intergenic
1037017609 8:13927990-13928012 TCACACTAGCAAACTGTGGTTGG + Intergenic
1039947768 8:42144634-42144656 CCTCATTCACCAACAGTGGAAGG + Intergenic
1040954409 8:52965028-52965050 CCTCACTTCCAAACTGTGCACGG + Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044396310 8:91717025-91717047 CCTGAATTGAAAACTGTGGAAGG - Intergenic
1046906943 8:119583508-119583530 CCCCATTAGTCAACTGTTGAAGG + Intronic
1047765926 8:127989888-127989910 CCTCATTAGTAAAATAGGGATGG + Intergenic
1048078676 8:131101334-131101356 CCTCATTAGAAAACTCCAGAAGG - Intergenic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1052882686 9:33613874-33613896 CCTCATCAGCGAACAGTGGGTGG - Intergenic
1052901299 9:33796755-33796777 CCTCATCAGCGAACAGTGGGTGG + Exonic
1053459823 9:38259572-38259594 CCTCATTGCCCACCTGTGGAGGG - Intergenic
1055424753 9:76182615-76182637 CATCATTAGCAAACAGACGAAGG + Intronic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055887002 9:81075251-81075273 CCTCATTTTCAAAGTGTTGAAGG + Intergenic
1057110737 9:92468382-92468404 CATCATTAACAAACAGTGTAAGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058622174 9:106895256-106895278 GCTCATTAGTTAACTCTGGATGG + Intronic
1185684584 X:1917871-1917893 CCTTTTTAGCACACGGTGGAAGG - Intergenic
1193468586 X:81874333-81874355 GCTCATTAGGGATCTGTGGAAGG - Intergenic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic