ID: 904917916

View in Genome Browser
Species Human (GRCh38)
Location 1:33983673-33983695
Sequence TCCTACTACCTCTGAGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904917907_904917916 -6 Left 904917907 1:33983656-33983678 CCCCAGCCCATCACCCATCCTAC 0: 1
1: 0
2: 3
3: 33
4: 375
Right 904917916 1:33983673-33983695 TCCTACTACCTCTGAGGTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 135
904917909_904917916 -8 Left 904917909 1:33983658-33983680 CCAGCCCATCACCCATCCTACTA 0: 1
1: 0
2: 0
3: 16
4: 559
Right 904917916 1:33983673-33983695 TCCTACTACCTCTGAGGTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 135
904917908_904917916 -7 Left 904917908 1:33983657-33983679 CCCAGCCCATCACCCATCCTACT 0: 1
1: 0
2: 2
3: 29
4: 264
Right 904917916 1:33983673-33983695 TCCTACTACCTCTGAGGTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904917916 Original CRISPR TCCTACTACCTCTGAGGTCA GGG Intronic
902512980 1:16976246-16976268 TCCCAGTATCTGTGAGGTCAGGG + Intronic
902608891 1:17585549-17585571 CCCAACTTCCTCTGAGGCCACGG - Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903565729 1:24264127-24264149 TCCTAATCCCTCTGAGGACAGGG + Intergenic
903888708 1:26555838-26555860 CCCTACTCCCTCTGGGGACAAGG + Intronic
904917916 1:33983673-33983695 TCCTACTACCTCTGAGGTCAGGG + Intronic
905771062 1:40638287-40638309 TTCTCCTCCCTCTGAGGTCATGG - Intronic
906673370 1:47676330-47676352 TCCCACTTTCTCTGAGGCCAAGG - Intergenic
908583189 1:65539808-65539830 GCCTACTACCTCTGAGCTCCGGG - Intronic
911993729 1:104736242-104736264 TCCTACTGCCACTGAAGTCTGGG - Intergenic
912098913 1:106181489-106181511 TCTTACTACCACTGATGTCTTGG - Intergenic
912778863 1:112525424-112525446 TCCCTTTACCTTTGAGGTCAGGG - Exonic
915706944 1:157853153-157853175 GCTTACCACCCCTGAGGTCAAGG + Intronic
916220942 1:162444714-162444736 TCCTACCCCCTGGGAGGTCAAGG - Intergenic
921753646 1:218826819-218826841 TCCTACTGCCTCTGAACTAAAGG + Intergenic
923568108 1:235091848-235091870 TCCCAGCACCTCGGAGGTCAAGG + Intergenic
1063934195 10:11060160-11060182 TGCTGGTACCTCTGAGATCATGG - Intronic
1066549001 10:36534587-36534609 GCCGATTATCTCTGAGGTCATGG + Intergenic
1069514559 10:69067360-69067382 TCCTACTAGGTGTGAGGCCATGG - Intergenic
1070171411 10:73935695-73935717 TCCTGCCACCTCTCAGGTCCGGG + Intergenic
1072115727 10:92368750-92368772 TCCTCCCACCTCTGATCTCAAGG + Intergenic
1073482729 10:103797250-103797272 ACCTGCTACCTGTGAGGTCTTGG - Intronic
1073685547 10:105748932-105748954 CCCTACTAGCTCTGAATTCAAGG + Intergenic
1073963293 10:108958764-108958786 ACCTACATGCTCTGAGGTCAAGG - Intergenic
1075518271 10:123127052-123127074 TCCTCCTGACTCTGTGGTCAGGG - Intergenic
1084290725 11:68164630-68164652 TATGACTAACTCTGAGGTCATGG - Intronic
1085106751 11:73850648-73850670 TTTTACTACTTCTGAGGTCTGGG + Intronic
1086194762 11:84124353-84124375 TCTTACAACCTGTGAGGTAAGGG - Intronic
1089059762 11:115617018-115617040 TCCCCGGACCTCTGAGGTCAGGG + Intergenic
1089828156 11:121298214-121298236 TTCTCCAACCTCTGAGCTCAAGG + Intronic
1092277948 12:7076516-7076538 TCCTCCTACCTTGGTGGTCATGG + Intergenic
1093903825 12:24665786-24665808 TCCCACTTCCTTTGAGGGCAGGG + Intergenic
1095166973 12:38984373-38984395 TCCCAATGACTCTGAGGTCAAGG - Intergenic
1097869572 12:64589665-64589687 TCCCAGTACCTTTGAGGCCAAGG + Intergenic
1098444878 12:70556218-70556240 TCCAACTAGCTCTGAGATCTAGG + Intronic
1101446245 12:104738704-104738726 ACCTACTAGCTATGAGGTCCGGG - Intronic
1102810495 12:115820009-115820031 ACCTACTACCTCTGATGTCCTGG - Intergenic
1103165134 12:118763947-118763969 TCCTTCCATCTCTGAGTTCATGG + Intergenic
1105836194 13:24214119-24214141 TCCTGCTGCCTCAAAGGTCAAGG - Intronic
1106118319 13:26836597-26836619 TCCTCTTAACTCTGAGGACAGGG - Intergenic
1107372595 13:39768644-39768666 TCATACTACCTTTGCAGTCAAGG + Intronic
1111963971 13:94842005-94842027 TGCTGCTGCCTCTGAGGACATGG - Intergenic
1112757549 13:102655036-102655058 TCATTCTCCCTCTGAGGTCAGGG - Intronic
1119488607 14:75010177-75010199 TCCTACTGCATCTGATCTCAGGG + Exonic
1119916483 14:78406774-78406796 ACCTCCAACCTCTGAGGTCTAGG - Intronic
1120868589 14:89317403-89317425 TCCTTCTACCTCTGAGAGCCAGG + Intronic
1121215103 14:92241739-92241761 TCCTTCTACCTGTTAGGTCTGGG + Intergenic
1121282489 14:92709455-92709477 CCCTACTACCGAAGAGGTCAAGG + Intronic
1121344965 14:93128862-93128884 TCCTTCTTACTGTGAGGTCAAGG + Intergenic
1121741386 14:96254670-96254692 TCCTACTGTCTCTGGGGCCAAGG - Intronic
1121775598 14:96588533-96588555 TCCTTCTATTTCTGATGTCAAGG + Intergenic
1128432776 15:67614623-67614645 TCTAAATACCTCTGAGATCAAGG - Intronic
1128451793 15:67810112-67810134 TCCCGCGACCTCTGAGGGCAGGG - Intergenic
1128576904 15:68782553-68782575 TCCTGCTACCTATCAGTTCAAGG + Intronic
1130097124 15:80864084-80864106 TCCTGCTACCTCAGAGGGCCAGG - Intronic
1130264396 15:82386536-82386558 TCCAACTACTTCTGAGGCCGAGG + Intergenic
1130312336 15:82766383-82766405 TCATAATGTCTCTGAGGTCAGGG + Intronic
1130971365 15:88736319-88736341 TCCTCCTCCCACTGAGCTCAGGG + Intergenic
1132113640 15:99120257-99120279 TCATCCTACCACTGAGGACAGGG - Intronic
1133199691 16:4195757-4195779 ACCCACCACCTCTGAGTTCACGG - Exonic
1136501038 16:30669750-30669772 ACCAGCCACCTCTGAGGTCATGG + Exonic
1136534742 16:30893104-30893126 TCCTGCTGCATCTGAGGTCTCGG + Intronic
1137522034 16:49202742-49202764 TCCTCCTTCCTCTGAGGACATGG + Intergenic
1142593931 17:1020547-1020569 TCCTGCTCCCTCGGAGGTGACGG - Intronic
1142917645 17:3154837-3154859 TCCTCCGACCTCTGAGCTCCTGG - Intergenic
1147947043 17:44086245-44086267 TCCTTCTCCCTGTGAGGTCTGGG - Intronic
1150556783 17:66261849-66261871 TCTTACCAGCTCTGAGGTGATGG - Intergenic
1151504408 17:74517086-74517108 TCCTTCTTGCTCTGTGGTCATGG - Intergenic
1157659454 18:49426816-49426838 GCCCTCTACCTCTGAGGTAAAGG + Intronic
1159712321 18:71776403-71776425 TCCTCTTAGCTCTGTGGTCATGG - Intronic
1160106209 18:75979376-75979398 TCCTCATTCTTCTGAGGTCATGG + Intergenic
1160536705 18:79598303-79598325 TCCTGCCACCTCTGAGCTCTAGG + Intergenic
1167516884 19:49928896-49928918 TCTTTCTGCCTCTGAGGTCTGGG - Exonic
1167661758 19:50799483-50799505 TCCGACTGCCACTGAGGACACGG - Intronic
926004134 2:9358852-9358874 TCCCAGTACATCTAAGGTCAGGG - Exonic
927197562 2:20558825-20558847 CCCTACCCCCTCTGTGGTCATGG - Intergenic
927579025 2:24224991-24225013 TGCTCTTACCTCTGATGTCAGGG + Intronic
928313366 2:30228760-30228782 GCCTACAACCTCTGAGTTCCAGG + Intergenic
929597672 2:43186605-43186627 TCCCACTACCCCTCAGGGCAAGG - Intergenic
931247882 2:60506209-60506231 TCCCACTTTCTCTGAGGGCATGG + Intronic
935168987 2:100595429-100595451 TGTTAATATCTCTGAGGTCAGGG - Intergenic
936084151 2:109455169-109455191 TCCTAGTCCCTGGGAGGTCATGG + Intronic
938942676 2:136182687-136182709 TCCTCCTGCCTCTGAGGGTAGGG + Intergenic
943399990 2:187396087-187396109 TCCTACTACCTAATAGCTCACGG + Intronic
1170531391 20:17296030-17296052 TCCTGCACCCTCTGAGGTTATGG - Intronic
1170697667 20:18674586-18674608 TCCTAGTGCCTCTGTGGACAAGG + Intronic
1171197706 20:23213916-23213938 TTTTATTTCCTCTGAGGTCAGGG - Intergenic
1172179791 20:32995666-32995688 TCATGCTACCTCGGAGGTCCTGG + Exonic
1173551495 20:43935979-43936001 TCCGTCTAGCTCTGAAGTCATGG + Intronic
1174407047 20:50309318-50309340 TCCAGCCACCTGTGAGGTCAGGG - Intergenic
1177826133 21:26085430-26085452 TCCTACTAATTTTGAAGTCATGG - Intronic
1180222674 21:46369322-46369344 TCCAACTACCTGGGAGGCCAAGG - Intronic
1180905401 22:19407060-19407082 TTCCACTACTTATGAGGTCAGGG + Intronic
1181587022 22:23858296-23858318 GCTTACTGCCTCTGAGGTCAGGG - Intronic
1182110797 22:27721784-27721806 TCCTAGCACTTCTGAGGCCAAGG + Intergenic
1182498384 22:30727249-30727271 TTCTTCTACCTCTCAGGTCAAGG - Intronic
949855247 3:8455454-8455476 TCCTTCTAATTCTGAGGACAAGG - Intergenic
950194024 3:10996318-10996340 ACCTAAGACCTCTGGGGTCAGGG + Intronic
954632692 3:52055843-52055865 GCCTACTACCTCCAAGGTGAGGG - Exonic
963374963 3:144452569-144452591 TACTAATATCTGTGAGGTCAAGG + Intergenic
963403397 3:144831903-144831925 AACTACTACCTCTGTGGTCCTGG - Intergenic
965838233 3:172874475-172874497 TCCTAAGACCTGTGAGATCAAGG + Intergenic
966207757 3:177422283-177422305 TAATACAACCTCTGAGGTCTTGG - Intergenic
967241061 3:187440057-187440079 AACAACTACCTCTAAGGTCAGGG - Intergenic
969612657 4:8235938-8235960 TCCCCCTTCCTCTGAGCTCATGG + Intronic
976801810 4:89001145-89001167 ACCTACAATCTCAGAGGTCATGG + Intronic
979823984 4:125210311-125210333 TCATCCTACCTCTGAGAACAAGG - Intergenic
981509410 4:145539114-145539136 TACCACCACCTGTGAGGTCAAGG - Intronic
981615876 4:146643198-146643220 TCCCACCAACTCTGATGTCAGGG - Intergenic
981948443 4:150377041-150377063 TCCTACTACTTTGGAGGCCAAGG + Intronic
982890246 4:160838873-160838895 TCCTACCATCTCTGAGGTAGAGG + Intergenic
983658400 4:170106902-170106924 TCCTACTAGCTGTCAGGGCAGGG - Intergenic
986272142 5:6242721-6242743 TCCCACTAATTCTGAGGCCAGGG - Intergenic
986647659 5:9933652-9933674 TCCTCCTTCCTCTGAGGCCTGGG - Intergenic
987055143 5:14184053-14184075 GCCTAGGAGCTCTGAGGTCAAGG - Intronic
989126906 5:38063469-38063491 TCCTAGTACCTTTAAGGGCAAGG + Intergenic
992225849 5:74619180-74619202 TCTTCCTACCTCTGAGAACAAGG - Intergenic
992531604 5:77657901-77657923 TAATACTACCTCAAAGGTCAAGG - Intergenic
999685365 5:154097925-154097947 TCCTTCTTCCTCTGAGCTCTGGG - Intronic
1004310047 6:14537309-14537331 TCCTACTCCCTTTGAGATCTGGG - Intergenic
1004407177 6:15343987-15344009 TCCCACTAACTCTCAGGTCCGGG - Intronic
1006603061 6:35238523-35238545 TCCTACTAGCTCTGTGATCCTGG + Intronic
1011618217 6:89217506-89217528 TCCTCCTACGTCAGATGTCAGGG + Intronic
1011659097 6:89578829-89578851 ACCTACTACTTCTTTGGTCATGG - Intronic
1012375582 6:98558034-98558056 TACTAGTTCCTCTGAGGTCTGGG - Intergenic
1014938666 6:127413191-127413213 TCCCTCCACCTCTGAGGGCAGGG - Intergenic
1022039320 7:26565271-26565293 TCATAATGCCTGTGAGGTCAGGG - Intergenic
1028907990 7:96176126-96176148 CTCTCCTCCCTCTGAGGTCAAGG - Intronic
1031905072 7:127451473-127451495 GCCTACTGCCTCTGTGGGCAGGG + Intergenic
1035487475 7:159237221-159237243 TCCGACTACCACTGAGGGGAGGG + Intergenic
1036056713 8:5263207-5263229 TCCTTCCACCTCAGAGGCCATGG - Intergenic
1036159384 8:6372317-6372339 TCTTACCACCTCTGAGGGCCAGG - Intergenic
1038402250 8:27293587-27293609 TCCAACTACCTGGGAGGCCAAGG + Intronic
1043951304 8:86311860-86311882 GCCCACTGCCGCTGAGGTCAAGG - Intronic
1045024070 8:98070053-98070075 ACCTACTAGCTCTGAGACCAGGG - Intronic
1045420265 8:102007742-102007764 TCCTCCTCCCTCTGAGATTAAGG + Intronic
1055727337 9:79245096-79245118 GCCTTCTACCTAAGAGGTCATGG - Intergenic
1055868319 9:80842618-80842640 CCCCCCTACCTCTGAGGTCATGG - Intergenic
1056056033 9:82824847-82824869 TTCTACTAATTCTGAGCTCATGG + Intergenic
1057890209 9:98864296-98864318 TGCTACTACCTCTGAGGGGGTGG + Intergenic
1060008956 9:120026589-120026611 TCCCAGTTCCTCTGGGGTCATGG + Intergenic
1061140798 9:128765142-128765164 TCCTACTGCCTGTGAGCTCTGGG + Intronic
1187546536 X:20259081-20259103 TACAAATACCTCTGGGGTCAGGG - Intronic
1194035571 X:88867035-88867057 ACCTACTACTTCAGAGGTGATGG + Intergenic
1195247018 X:103004049-103004071 TCCTAACAGCCCTGAGGTCAGGG - Intergenic