ID: 904925198

View in Genome Browser
Species Human (GRCh38)
Location 1:34042135-34042157
Sequence CTTACATTTACTCCAGTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904925198_904925202 16 Left 904925198 1:34042135-34042157 CCCATTACTGGAGTAAATGTAAG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 904925202 1:34042174-34042196 ATAGAAAAACATAGAAGACAGGG 0: 1
1: 0
2: 6
3: 125
4: 1279
904925198_904925203 24 Left 904925198 1:34042135-34042157 CCCATTACTGGAGTAAATGTAAG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 904925203 1:34042182-34042204 ACATAGAAGACAGGGAAAGACGG 0: 1
1: 0
2: 1
3: 97
4: 844
904925198_904925201 15 Left 904925198 1:34042135-34042157 CCCATTACTGGAGTAAATGTAAG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 904925201 1:34042173-34042195 GATAGAAAAACATAGAAGACAGG 0: 1
1: 0
2: 0
3: 30
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904925198 Original CRISPR CTTACATTTACTCCAGTAAT GGG (reversed) Intronic