ID: 904925964

View in Genome Browser
Species Human (GRCh38)
Location 1:34048496-34048518
Sequence CAGCTGTCCGAGGGGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 175}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904925964_904925972 -7 Left 904925964 1:34048496-34048518 CCACCTACCCCCTCGGACAGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 904925972 1:34048512-34048534 ACAGCTGCTCAGGCCAACCTGGG 0: 1
1: 0
2: 0
3: 15
4: 197
904925964_904925975 4 Left 904925964 1:34048496-34048518 CCACCTACCCCCTCGGACAGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 904925975 1:34048523-34048545 GGCCAACCTGGGGAAGGAGCAGG 0: 1
1: 0
2: 2
3: 45
4: 509
904925964_904925971 -8 Left 904925964 1:34048496-34048518 CCACCTACCCCCTCGGACAGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 904925971 1:34048511-34048533 GACAGCTGCTCAGGCCAACCTGG 0: 1
1: 0
2: 2
3: 18
4: 163
904925964_904925973 -6 Left 904925964 1:34048496-34048518 CCACCTACCCCCTCGGACAGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 904925973 1:34048513-34048535 CAGCTGCTCAGGCCAACCTGGGG 0: 1
1: 0
2: 0
3: 28
4: 264
904925964_904925974 -2 Left 904925964 1:34048496-34048518 CCACCTACCCCCTCGGACAGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 904925974 1:34048517-34048539 TGCTCAGGCCAACCTGGGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 289
904925964_904925979 30 Left 904925964 1:34048496-34048518 CCACCTACCCCCTCGGACAGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 904925979 1:34048549-34048571 AGCCTCTGAGAATTCTAAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 218
904925964_904925977 7 Left 904925964 1:34048496-34048518 CCACCTACCCCCTCGGACAGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 904925977 1:34048526-34048548 CAACCTGGGGAAGGAGCAGGTGG 0: 1
1: 0
2: 6
3: 68
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904925964 Original CRISPR CAGCTGTCCGAGGGGGTAGG TGG (reversed) Intronic
900126665 1:1071829-1071851 CAGAGGCCCGAGGGGGGAGGCGG + Exonic
901185501 1:7370131-7370153 CAGCTCTCCGCGGGGGCAGCAGG + Intronic
901453214 1:9348734-9348756 AAGCTGGCCGAGGGAGTACGGGG + Intronic
901771295 1:11531642-11531664 CAGCTGTCCCACGGGGCAGTGGG + Exonic
904801540 1:33096531-33096553 CAGCTGGCCAAGAAGGTAGGAGG - Intronic
904925964 1:34048496-34048518 CAGCTGTCCGAGGGGGTAGGTGG - Intronic
905228091 1:36492986-36493008 CAGCTGCCCGATGGGAAAGGGGG - Intergenic
907091267 1:51728565-51728587 CAGCTTTTAGAGTGGGTAGGGGG + Intronic
911725375 1:101236815-101236837 CAGCTGACAGAGGGCGTGGGGGG + Intergenic
919925327 1:202189031-202189053 CAGCTGTGGGAAGGGGTGGGAGG + Intergenic
922531249 1:226347017-226347039 CAGCTGTCAGCTGGGGTAGGGGG + Intergenic
1062824154 10:556304-556326 CGGCTGTGGGAGGGGGTGGGTGG - Intronic
1068283879 10:54910067-54910089 CATCTGTGCGAGGGTGGAGGTGG + Intronic
1069847450 10:71382477-71382499 CAGCTGGGCAAGGGGGTAGTTGG - Intergenic
1070599236 10:77854179-77854201 CAGCTGTCTGTGGGTGTTGGAGG + Intronic
1072298203 10:94033156-94033178 TTGGTGTTCGAGGGGGTAGGGGG + Intronic
1074289306 10:112126547-112126569 CAGCTCTCCAGGGAGGTAGGGGG - Intergenic
1075760083 10:124849050-124849072 CAGCTGTAAGAGGAGGCAGGAGG - Intergenic
1076368129 10:129935347-129935369 CAGCTCTCCGGTGGGGAAGGTGG + Intronic
1076771324 10:132666981-132667003 CAGGTGGCAGAGGGGGTTGGGGG - Intronic
1076984923 11:229022-229044 CAGCTATCCCAGTGGGTGGGAGG - Intronic
1077015952 11:399312-399334 CAGGTGGCAGAGGGGGCAGGTGG - Intronic
1081542632 11:44047241-44047263 CAGCTGTCACAGTGAGTAGGTGG + Intergenic
1084789239 11:71463025-71463047 CACCTGTCCCAGGTGGTGGGTGG + Intronic
1085640208 11:78188618-78188640 CAGCTTTGCGAGGGGGGCGGAGG + Exonic
1091752764 12:3032966-3032988 CAGCTGATGGAGGGGGAAGGCGG - Intronic
1092167677 12:6352941-6352963 CAGCTGTCCCACAGGGTGGGCGG - Intronic
1092181769 12:6451311-6451333 CAGCTGCCCCAGGGAGGAGGAGG + Exonic
1095932122 12:47637444-47637466 CAGCTGTGGGAGGCGGCAGGGGG - Intergenic
1096541262 12:52308567-52308589 CAGCTGTAAGAGGTGCTAGGAGG + Exonic
1096675210 12:53222447-53222469 CAGATTTCTGAGGGGGAAGGGGG - Intronic
1099505470 12:83470901-83470923 CAGATGTCTGAGTGGGCAGGAGG - Intergenic
1102627536 12:114247420-114247442 CAGCTGTCCATGGGGGGAGAAGG + Intergenic
1103342676 12:120229400-120229422 CATCTCTCTGAGGGGGTGGGAGG + Intronic
1103954330 12:124567862-124567884 CAGCTCCCCGAGGAGGAAGGAGG + Intergenic
1105004839 12:132715133-132715155 AAGCTGACCAAGGGGGTCGGCGG - Intronic
1108075914 13:46679716-46679738 CAGCTGTCTGATGGGGGAGGTGG - Intronic
1114754445 14:25243974-25243996 AAGCTGTTGGAGGGTGTAGGAGG - Intergenic
1119266031 14:73263795-73263817 CACCTGTCAGAGGAGGTGGGGGG - Intronic
1119266063 14:73263922-73263944 CACCTGTCAGAGGGGGTAGGGGG - Intronic
1119266074 14:73263956-73263978 CACCTGTCAGAGGAGGTCGGGGG - Intronic
1122399739 14:101459388-101459410 CCGGGGTCCGAGGGGGTGGGCGG - Intergenic
1122649288 14:103216831-103216853 CTGCTGTCGGAGAGGGGAGGGGG - Intergenic
1123099170 14:105784102-105784124 CAGGTGTCCGAGGTGTTAGTGGG + Intergenic
1123677322 15:22723526-22723548 CAGCTGTACTGGGGGGCAGGGGG - Intergenic
1129332187 15:74833387-74833409 GAGCTGTCCGGGTGGGTAGAAGG - Intergenic
1132219337 15:100093612-100093634 CAGCTGATAGTGGGGGTAGGGGG - Intronic
1132861343 16:2073258-2073280 CTGCTGTCCCAAGGGGGAGGTGG + Intronic
1133116710 16:3581707-3581729 CAGCTGTCCCAGGGGGCAGTGGG - Exonic
1133835494 16:9363815-9363837 CTGCTGCCCTAGGAGGTAGGAGG + Intergenic
1133929277 16:10218892-10218914 CAGCTGTCAGAGAGAGTAAGAGG + Intergenic
1135990537 16:27216224-27216246 CAGCTGTCGGAGCGGGTGGCTGG + Intronic
1137350863 16:47712858-47712880 CAGGTGTCCCAGGGAGTGGGTGG - Intergenic
1137496730 16:48975202-48975224 CAAATGTCCCAGGGGGTGGGTGG - Intergenic
1137582487 16:49641828-49641850 CAGCTGTCCGAGGCTGGAGATGG + Intronic
1139727698 16:68914762-68914784 CTGCTGTCCAAATGGGTAGGGGG + Intronic
1139930622 16:70523467-70523489 CAGCCGTCTGAGGGGGTGGGAGG - Exonic
1142129788 16:88427419-88427441 CAGCTGTCCGAGGGGGGCCCTGG - Intergenic
1144831051 17:18131426-18131448 CAGCTCTCAGTGAGGGTAGGAGG - Intronic
1145282903 17:21480713-21480735 CAGCTGTCTAAGGGGTTTGGGGG - Intergenic
1145394574 17:22485077-22485099 CAGCTGTCTAAGGGGTTTGGGGG + Intergenic
1145755031 17:27384237-27384259 CAGCTGTCCGAGGTGATGTGTGG + Intergenic
1146623608 17:34419388-34419410 CCTCTGTCTGAGAGGGTAGGAGG + Intergenic
1146725585 17:35153040-35153062 CATCATTCCGAGGGGGAAGGGGG + Intronic
1147375359 17:40019693-40019715 GTGCTGTCCCAGGGGGAAGGAGG + Intronic
1147935069 17:44006456-44006478 GAGAGGTCCGTGGGGGTAGGGGG + Intronic
1147948809 17:44095692-44095714 CAGCTGTGCCTGGGGGGAGGGGG + Intronic
1148465967 17:47865509-47865531 CAGGTGCCTGAGGGGGGAGGTGG - Intergenic
1150021265 17:61615792-61615814 CAACTGTCAGAGAGGGGAGGAGG + Intergenic
1150131871 17:62673910-62673932 CAGCTGTGCAATGGGGAAGGCGG - Intronic
1150520784 17:65865521-65865543 CAGCTGTGCAAGGGTGTGGGTGG - Intronic
1151215930 17:72576349-72576371 CAGCCCTTCGAGGGGGGAGGGGG - Intergenic
1152225391 17:79090400-79090422 CAGCTGTGCCAGGGGGCCGGCGG - Intronic
1152277347 17:79365832-79365854 CTGCTGCCCGAGAGGGAAGGGGG + Intronic
1157231430 18:45920119-45920141 CAGGTGTCTGAGTGGGTAAGGGG - Intronic
1158836133 18:61333658-61333680 CTTCTGACAGAGGGGGTAGGGGG + Exonic
1160567704 18:79797749-79797771 CAGCTGCCCTTGGGGGCAGGAGG - Intergenic
1160912697 19:1482173-1482195 GAGCTGTCCCAGGATGTAGGCGG + Exonic
1161844778 19:6706603-6706625 CCGCTGTCTGAGAGGGTAGGAGG - Intronic
1161844808 19:6706697-6706719 CCCCTGTCTGAGGGGGTAGGAGG - Intronic
1161844823 19:6706743-6706765 TACCTGTCTGAGGGGGGAGGAGG - Intronic
1161844882 19:6706922-6706944 CCCCTGTCTGAGGGGGCAGGAGG - Intronic
1161844889 19:6706945-6706967 CCGCTGTCTGAGGGGGGAGGAGG - Intronic
1162026059 19:7894857-7894879 CGGATGTCCGAGGAGGAAGGAGG - Intronic
1162901089 19:13795799-13795821 CAGGTGACCGCGGGGGAAGGGGG + Exonic
1163127477 19:15251994-15252016 CAGCTGTCCTGGCGGGAAGGAGG - Intronic
1165445740 19:35856130-35856152 CAGCTGGCCGAGCAGGTGGGAGG - Intronic
1167701254 19:51047871-51047893 CAGCTGTGCGCGGGGGGCGGGGG - Intergenic
925170025 2:1744541-1744563 CAGCTGTGCGCGGGGGGCGGGGG + Intronic
927201714 2:20582406-20582428 GAGCTGTCCTAGGGGGAGGGTGG + Intronic
929656499 2:43737545-43737567 AAGCTGTCAGCGGGGGTAGCAGG + Intronic
930749876 2:54924282-54924304 CAGCTGTCCAGGGGAGTAGATGG + Intronic
932373291 2:71211131-71211153 CAGCTATTCGGGGAGGTAGGGGG + Intronic
933979836 2:87540551-87540573 CAGCTGCCAGAGGGGGTGGGGGG + Intergenic
935215163 2:100970204-100970226 CAGCCTTCCCTGGGGGTAGGGGG - Intronic
935539994 2:104337662-104337684 CTGTTGTCGGTGGGGGTAGGGGG + Intergenic
936313984 2:111410240-111410262 CAGCTGCCAGAGGGGGTGGGGGG - Intergenic
940911588 2:159214559-159214581 CAGCTCTCCAAGGAGGTAGCTGG - Intronic
942890430 2:180980866-180980888 CAGCTGTGGGGGGGGGAAGGGGG - Exonic
945429171 2:209744677-209744699 GACCTGTCAGAGGGGGTAGGGGG + Intergenic
946230277 2:218286985-218287007 CAGCTGTGCCCTGGGGTAGGAGG - Intronic
948416134 2:237805849-237805871 CAGCTACTCAAGGGGGTAGGTGG + Intronic
1171278628 20:23878946-23878968 CAGCTGTCCTGGGCTGTAGGGGG + Intronic
1172015537 20:31870568-31870590 CACATGACCGAAGGGGTAGGAGG - Exonic
1173616119 20:44403934-44403956 CAGCTCTCCCCGGGGGTCGGGGG + Intronic
1173710019 20:45146863-45146885 TAGCTGTGCCAGGGGGTATGGGG - Intergenic
1173880170 20:46406232-46406254 CAGCGGTCGGAGGGAGAAGGAGG - Intronic
1175199130 20:57266175-57266197 CAGGTGGCAGAGGGGGCAGGCGG + Exonic
1175219338 20:57407989-57408011 CCGCTGTCCCAGGGCGCAGGCGG - Exonic
1176188640 20:63795780-63795802 CAGCTGACCCAGGGAGGAGGAGG - Intronic
1179477914 21:41659746-41659768 CAGCTGGGTGAGTGGGTAGGTGG - Intergenic
1179828991 21:43984213-43984235 CAGCTGCCCGAGTGGGCGGGTGG - Exonic
1181442106 22:22941967-22941989 CAGCTGCCCCAGGAGGCAGGGGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182552340 22:31107126-31107148 CCGCTGTCGGACCGGGTAGGGGG + Intronic
1183112543 22:35661043-35661065 AGGCTGTGGGAGGGGGTAGGGGG + Exonic
1183197719 22:36364932-36364954 TAGCTGTCCATGGGGGTAGCTGG - Intronic
1183350340 22:37331255-37331277 CAGCTGGCAGTGGGGGAAGGAGG - Intergenic
1183696707 22:39427850-39427872 GAGCTGTCCCAAGGGGCAGGGGG + Intronic
1184100593 22:42340001-42340023 CAGCTGGGTCAGGGGGTAGGGGG + Intronic
1184488403 22:44795474-44795496 CAGCTGGCCCAGAGGGTAGAGGG - Intronic
1184963391 22:47948344-47948366 CAGCTGCCTGAGGGGGTAGCAGG - Intergenic
1185127528 22:49019863-49019885 CTGCTGTCCGAGGGGGTGGGTGG - Intergenic
950207422 3:11091795-11091817 CAGCTGTGTGAGGGTGCAGGTGG - Intergenic
950220891 3:11195355-11195377 CAGCTGTGCCTGGGGCTAGGTGG + Intronic
950446993 3:13044216-13044238 CAGATGTCCCTGGGGGTGGGGGG - Intronic
953374990 3:42421043-42421065 CAGCTGTGTGAGGGGTGAGGAGG - Intergenic
955379465 3:58425327-58425349 GAGCTGTCTGATGGGGTAGAAGG - Intronic
960047309 3:113211002-113211024 CAACCGACCGAGGGGGTCGGGGG + Intronic
960054212 3:113265072-113265094 CAGCTGTCAGAGGGTGCAGCAGG + Intronic
961795340 3:129404756-129404778 GAGCTGTCCCAGGAGGCAGGAGG + Intronic
965366453 3:167806313-167806335 GTCCTGTCTGAGGGGGTAGGGGG + Intronic
967946369 3:194807318-194807340 CAGCTGTTGGAGGGGGTTGTCGG + Intergenic
968970633 4:3791732-3791754 CAGCTGTCGGAGGGGCTTGTTGG - Intergenic
976005095 4:80420165-80420187 CAGCTGTCAGAGGGAATAGATGG + Intronic
976969999 4:91092785-91092807 CAGGTGTTTGAGGGAGTAGGGGG + Intronic
977772054 4:100871211-100871233 CAGCTGTCCCAGGCAATAGGTGG + Intronic
980071259 4:128244683-128244705 CAGGTGTCCAATGGGGAAGGAGG - Intergenic
984839740 4:184057163-184057185 CAGCAGCCCCAGGGGGTGGGAGG + Intergenic
986008089 5:3684788-3684810 CAGCAGGCCGAGGAGGAAGGAGG - Intergenic
986020318 5:3795549-3795571 CAGGTGTCCACGGGGGTTGGGGG + Intergenic
986256321 5:6103873-6103895 CAGCGGTTCTAGGGGTTAGGAGG - Intergenic
991628500 5:68629890-68629912 CAGCTCTCAGAGAGGATAGGTGG - Intergenic
992391243 5:76332748-76332770 CAACTGTCTTAGGGGTTAGGAGG - Intronic
995348667 5:111149989-111150011 CAGCTGTCAGAGGAGGAAGTTGG - Intergenic
996588248 5:125115850-125115872 CAGATGGGCGAGGGGATAGGAGG + Intergenic
1001965788 5:175908918-175908940 CACCTGCCCGAGGGTGGAGGAGG - Intergenic
1017042355 6:150317602-150317624 CAGTTGCCCCAGGGGGTGGGGGG + Intergenic
1017939136 6:159036105-159036127 CAGGTGGAAGAGGGGGTAGGAGG + Exonic
1018900743 6:168050579-168050601 CAGCGGTCGGAGGAGGCAGGAGG + Intergenic
1019291612 7:253233-253255 CAGCTGTCCAAGGTGGCAGATGG + Intronic
1019423644 7:963157-963179 CAGGTGTCAGCGGGGGCAGGTGG + Intronic
1019448994 7:1086733-1086755 CAGCTCTCCTGGGGGGGAGGGGG + Intronic
1023817348 7:43961338-43961360 CAGAGGTCCCAGTGGGTAGGGGG + Intergenic
1023852714 7:44159118-44159140 CATCTCTCCGAGGGGCTAAGAGG + Exonic
1023944791 7:44795239-44795261 CAGCCTCCCGAGGGGGTAGCTGG + Intergenic
1024293989 7:47828351-47828373 CAGCTGTACGAGGGGAGAAGAGG + Intronic
1029741974 7:102496212-102496234 CAGAGGTCCCAGTGGGTAGGGGG + Intronic
1029759963 7:102595377-102595399 CAGAGGTCCCAGTGGGTAGGGGG + Intronic
1029839626 7:103348108-103348130 CGGCTGTCACAGGGGGAAGGAGG - Intronic
1030040825 7:105448414-105448436 CAGCTCTCAGAGGGTGCAGGTGG + Intronic
1032396381 7:131592960-131592982 CAGTTGCCCCTGGGGGTAGGAGG + Intergenic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1034266980 7:149785798-149785820 CAGCTGTGCAAGGTGGGAGGGGG + Intergenic
1035924199 8:3709954-3709976 CAGCTGTGTGTGGGGGTTGGGGG - Intronic
1036659969 8:10701577-10701599 CAGCTGCCTTAGGGGGTTGGGGG + Intronic
1036679603 8:10861499-10861521 CAGATGTCCAAGGGGGGAGAGGG + Intergenic
1038703355 8:29871978-29872000 CAGCTGTTGGAGGGTGTAGGGGG - Intergenic
1045268655 8:100643248-100643270 GAGCTGTACGAAGGGGTAGTTGG - Intronic
1046145082 8:110147968-110147990 AAGCTGTCCGAGGGTGAATGGGG - Intergenic
1048531618 8:135255176-135255198 CAGTTGTTCTAGGAGGTAGGTGG - Intergenic
1048987673 8:139743731-139743753 CAGCTGTCCTGTGGGGTGGGGGG + Intronic
1048988417 8:139747767-139747789 CAGGTGTCAGAGCAGGTAGGGGG + Intronic
1048988448 8:139747885-139747907 CAGGTGTCAGAGCAGGTAGGGGG + Intronic
1048988542 8:139748240-139748262 CAGGTGTCAGAGCAGGTAGGGGG + Intronic
1048988600 8:139748477-139748499 CAGGTGTCAGAGCAGGTAGGGGG + Intronic
1049405495 8:142450268-142450290 CAGGGGGCTGAGGGGGTAGGGGG - Intronic
1049407051 8:142456251-142456273 CAGGTGTGCGAGGGGCAAGGCGG - Intronic
1050664644 9:7921754-7921776 CAGCTGTTTGAAGGGGTAAGTGG + Intergenic
1054356832 9:64070607-64070629 CAGCTGTGTGTGCGGGTAGGGGG - Intergenic
1055945490 9:81688557-81688579 CAGCTGCCCGGGCGGGGAGGCGG + Exonic
1062262635 9:135670536-135670558 CAGCTCTCCGGGGGAGGAGGGGG + Intergenic
1062496090 9:136832451-136832473 CAGCTTTCTCAGGGGTTAGGAGG - Intronic
1062559889 9:137136789-137136811 CAGCTGTCAGAGTGGGCAAGGGG + Intergenic
1187716129 X:22104354-22104376 TTGCAGTCCAAGGGGGTAGGTGG + Intronic
1189332146 X:40151001-40151023 CAGCTGGCCAAGGGGAAAGGAGG + Intronic
1190123563 X:47683654-47683676 TAGCTGTCCGTTGGGGGAGGTGG + Intergenic
1191036006 X:56027220-56027242 CAGGTGTTTGAGGGAGTAGGGGG + Intergenic
1192734898 X:73841413-73841435 CAGCTGTCCGAGGAGCTAGTAGG + Intergenic
1197752481 X:129974976-129974998 AAGCTGTGGGAGGGGGCAGGTGG + Intergenic
1198970101 X:142270160-142270182 CAGGTGTTTGAGGGAGTAGGGGG - Intergenic