ID: 904927412

View in Genome Browser
Species Human (GRCh38)
Location 1:34059834-34059856
Sequence GATTCAGCCCAGAGGGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904927412_904927418 0 Left 904927412 1:34059834-34059856 CCCAGATCCCTCTGGGCTGAATC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 904927418 1:34059857-34059879 CCTGTCAACCACCACTCCCTTGG 0: 1
1: 0
2: 2
3: 14
4: 156
904927412_904927421 12 Left 904927412 1:34059834-34059856 CCCAGATCCCTCTGGGCTGAATC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 904927421 1:34059869-34059891 CACTCCCTTGGACTCTTGCCTGG 0: 1
1: 0
2: 0
3: 54
4: 1849
904927412_904927423 16 Left 904927412 1:34059834-34059856 CCCAGATCCCTCTGGGCTGAATC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 904927423 1:34059873-34059895 CCCTTGGACTCTTGCCTGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904927412 Original CRISPR GATTCAGCCCAGAGGGATCT GGG (reversed) Intronic
900085690 1:894807-894829 GTTTCACCCCAGGGGGATCCTGG - Intergenic
900958820 1:5906402-5906424 GTTTCAGCCCAGAGGAAACCAGG + Intronic
901678457 1:10900136-10900158 GAGGCAGCCCAGCTGGATCTCGG + Intergenic
902894497 1:19469571-19469593 GAGTCAGCTCAGAGGGCTCTGGG + Intronic
903096540 1:20980972-20980994 GATTCACATCAGAGGGAGCTGGG - Intronic
903660169 1:24972270-24972292 GAGTGAGCTCAGAGGGCTCTGGG - Intergenic
904927412 1:34059834-34059856 GATTCAGCCCAGAGGGATCTGGG - Intronic
905210959 1:36373961-36373983 GACTCAGCCCAGTGGGAAGTGGG + Intronic
905301963 1:36991686-36991708 GCTACAGCCCTCAGGGATCTTGG - Intronic
910446113 1:87300271-87300293 GATCCAGCCAAGATGCATCTCGG - Intergenic
912074063 1:105850317-105850339 GCTTCAGCTCAAAGGGGTCTAGG + Intergenic
914805071 1:150985647-150985669 GATTGAGCCCAGAAGGGTCAAGG - Intronic
918470910 1:184872096-184872118 AATACAACCCACAGGGATCTTGG + Intronic
920690639 1:208144012-208144034 GATTCAGCCCTAAGGAGTCTAGG - Intronic
1067187341 10:44042386-44042408 GATGCTGCCCTGTGGGATCTGGG - Intergenic
1068865107 10:61886760-61886782 GATCGAGCCCTGAGGGAACTCGG - Intergenic
1070895944 10:79982999-79983021 GAAGCAGCCCAGAAGGGTCTTGG + Intergenic
1071492862 10:86147905-86147927 GAGTAAGCCCAGTGGGCTCTGGG - Intronic
1073139262 10:101236866-101236888 GAAGCAGCCCGGAGGGATCCCGG - Intergenic
1075239567 10:120765548-120765570 GATTCAACCCACAGGGGTTTTGG + Intergenic
1076525265 10:131108720-131108742 ATCTCAGCCCAGTGGGATCTGGG - Intronic
1076841531 10:133048338-133048360 GATTCAGCTCAGAGGCAGCAGGG + Intergenic
1079522516 11:21345110-21345132 GATTGAGCCCAGAAGTAGCTTGG + Intronic
1081269459 11:41065681-41065703 GCTTCATCCCAGAGGGATACTGG - Intronic
1081614654 11:44583498-44583520 GAGTCAGGCCTCAGGGATCTGGG + Intronic
1083404513 11:62447329-62447351 CCTTCTGCCCAGTGGGATCTAGG + Intronic
1084550749 11:69840413-69840435 GAGTCAGCCTGGAGGGGTCTGGG - Intergenic
1084981254 11:72829961-72829983 GAGGCAGCCCAGAGGGGTCCCGG + Intronic
1084992286 11:72938414-72938436 GATTGAGACCAGAAGGGTCTAGG + Intronic
1089007581 11:115105389-115105411 GATTCAGCCCAGGGGGCTCAAGG + Intergenic
1089190007 11:116646835-116646857 GATTCTGCCCTTAGGGATATGGG - Intergenic
1090616212 11:128517758-128517780 GATGGAGCCCAGAGAGACCTGGG + Intronic
1091213863 11:133887526-133887548 TATTCAGCCCAAAGGAGTCTGGG - Intergenic
1097218914 12:57435354-57435376 GAGTGACCCCAGAGGGATGTGGG - Intronic
1099203163 12:79699066-79699088 GTTTTAGCCCAGTGGGATCCAGG - Intergenic
1101695459 12:107121657-107121679 GATTCCGACCAGAGACATCTTGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1115300149 14:31876199-31876221 GATTCAGCTCTGAGGGAACAAGG + Intergenic
1115467487 14:33731545-33731567 GTTTCAGCCCAGTGAGAACTAGG + Intronic
1117054392 14:51897138-51897160 TCTTCAGCCCTGAGGGCTCTTGG - Intronic
1119574087 14:75702712-75702734 GATTCAGCCCAGGGAGAGGTGGG - Intronic
1119720304 14:76885492-76885514 CACCCAGCCCAGAGGGCTCTGGG - Intergenic
1121542951 14:94742083-94742105 GAGTCATCCCAGAGAGTTCTTGG - Intergenic
1124108863 15:26767813-26767835 GATTCAGGCTAGAGTGAGCTAGG - Intronic
1128310625 15:66629935-66629957 CAGTCAGCCCAGAGGGATGTGGG + Intronic
1129006326 15:72376336-72376358 GATTCACCCTAGAGCCATCTGGG - Exonic
1129653760 15:77509335-77509357 GCTTGAGCCCAGAGAGATCGAGG - Intergenic
1129867291 15:78918820-78918842 CATTCATCGCAGAGAGATCTGGG + Intergenic
1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG + Intronic
1132909355 16:2300466-2300488 GCTCCAGTCCAGAGGGATGTTGG + Intronic
1133103374 16:3492500-3492522 CATCCTGCCCAGAGGGACCTGGG + Intergenic
1134880656 16:17742909-17742931 GTTTCAGTCCAGAGGCTTCTAGG + Intergenic
1139989425 16:70927680-70927702 GGCTTAGCCCAGAGGGTTCTTGG - Intronic
1141100007 16:81190679-81190701 CATTCATCCCAGATGGTTCTTGG + Intergenic
1141765346 16:86054631-86054653 CAGTCAGCCCAGTGGTATCTAGG + Intergenic
1144101965 17:11949406-11949428 GATTCAGGCCAGAGGAGTTTAGG + Intronic
1147182260 17:38693806-38693828 GAAGCAGAGCAGAGGGATCTGGG + Intergenic
1147560843 17:41507948-41507970 GCTTCCTCCCAGAGGGCTCTGGG - Intergenic
1147811228 17:43171215-43171237 GATTCACCCCACAGGGATAGCGG + Intronic
1147883554 17:43669524-43669546 GATTCAGCCTATAGGCACCTTGG + Intergenic
1148482462 17:47969134-47969156 GATTCTGCCCAGTGAGGTCTTGG - Intronic
1151891947 17:76956287-76956309 GATTCAGCCTAGTGGGCCCTGGG - Intergenic
1152353209 17:79794779-79794801 GATTCTGGCCACAGGGATCCTGG + Exonic
1155441635 18:25868448-25868470 AATTCAGGCCAGAGGCACCTGGG + Intergenic
1155870071 18:31016359-31016381 GGCTCAGCCCAGAGGGTTCCTGG - Intronic
1159053071 18:63439609-63439631 AATTCAACCCAGAGGGCTGTGGG - Intergenic
1160307889 18:77758102-77758124 GATTCAATCCAGGTGGATCTGGG - Intergenic
1160310537 18:77786065-77786087 CATTCAGCCCAGGGGCAGCTGGG - Intergenic
1162376523 19:10308533-10308555 CATGCAGGCCAGAGGGACCTGGG + Exonic
927320995 2:21745567-21745589 GATTCTTCCCAGTGGGCTCTTGG + Intergenic
928790603 2:34947781-34947803 GATGCAGACCAGAGGGCTGTGGG + Intergenic
930787182 2:55282256-55282278 GGAACTGCCCAGAGGGATCTCGG - Intergenic
932086683 2:68768890-68768912 GACACAGCCCTGATGGATCTGGG - Intronic
934726081 2:96619919-96619941 GATTGAGACCAGAAGAATCTAGG - Intronic
936948624 2:117954350-117954372 GACTTACCCCAGATGGATCTTGG + Intronic
938708266 2:133952857-133952879 GATTCAGGCCCAAGTGATCTTGG - Intergenic
943738333 2:191382869-191382891 GATTCAGAACAGAAGAATCTAGG + Intronic
944464648 2:199988493-199988515 AAATCAGCCTAGAAGGATCTTGG - Intronic
945990106 2:216388899-216388921 GAGTCAGCCCAGAGAGTTCCTGG + Intergenic
946603372 2:221375078-221375100 GATGCGGACCAGAGTGATCTTGG + Intergenic
946647073 2:221849260-221849282 GATTTAACCCTGTGGGATCTTGG + Intergenic
1168808643 20:688539-688561 AACCCAGCCCAGAGGGATCAGGG + Intergenic
1168963874 20:1887189-1887211 GATACAGTCCAAAGGGCTCTGGG + Intergenic
1171027277 20:21642139-21642161 AAGTCAACCCAGAGGTATCTTGG - Intergenic
1174262976 20:49310720-49310742 GATTCAGTTCTGAGGGTTCTTGG + Intergenic
1175678738 20:60968985-60969007 GATTCAGCACAGAAGGAAGTGGG - Intergenic
1183074832 22:35420219-35420241 AATTCAGACAAGAGGGGTCTAGG - Intronic
1184087667 22:42274861-42274883 GATACAGCCCAGAGGAATCCAGG + Intronic
950255806 3:11504567-11504589 GATCCAGGCCAGAGGGCTCTAGG + Intronic
951834601 3:26968327-26968349 GATCCAGCACAGAAGGACCTTGG + Intergenic
954247777 3:49345303-49345325 GATTCAGCTCAGAGACATCTTGG + Intergenic
956519791 3:70091323-70091345 GGTTGAGCCAAGAGAGATCTGGG - Intergenic
957606834 3:82410591-82410613 GACTCATCCCAGAGAGACCTGGG + Intergenic
961761933 3:129176732-129176754 GATTCTGCCCAGATGAATTTAGG + Intronic
965653062 3:170953592-170953614 GACGGAGCCCAGAAGGATCTCGG - Intergenic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
978065688 4:104397399-104397421 GCCTCAGCCCAGTGGGAGCTTGG - Intergenic
984196238 4:176660961-176660983 GATTGAGCCCAGTGGGGTCATGG - Intergenic
985158182 4:187014962-187014984 GATGCAGCAGAGAGGGAGCTTGG + Intergenic
993905460 5:93618675-93618697 GTAGCAGCCCAGAGGGAGCTAGG - Exonic
1001556322 5:172639994-172640016 GACCCATCCCAGAGGGTTCTAGG - Intergenic
1001764462 5:174234500-174234522 GACCCAGCCCAGAGGCAGCTGGG - Intronic
1002027820 5:176407288-176407310 GATCCAGCTCAGAGTGTTCTAGG + Intronic
1004850056 6:19690220-19690242 AATACAGCCCAGTGGGATCTCGG - Intergenic
1007557868 6:42782294-42782316 GTTTCAGCCCAGAGAGCTATTGG + Intronic
1016508493 6:144813092-144813114 AAATCAGTCCAGAGGCATCTGGG + Intronic
1016520046 6:144936838-144936860 CATTCACCCCAGAAGGATCATGG + Intergenic
1022360240 7:29650103-29650125 GAAGCAGCCCAGAAGGGTCTTGG - Intergenic
1025829282 7:65035927-65035949 GATTGAGCCCAGAGGGCTTGGGG - Intergenic
1030241703 7:107333220-107333242 GATTCAAAGCAGAGGGATCCTGG + Intronic
1033367164 7:140680496-140680518 GAATCAGCCAATAGGGGTCTGGG - Intronic
1034192878 7:149224798-149224820 CATTCAGACCAGACAGATCTGGG - Exonic
1038528165 8:28295091-28295113 GATTCTGCTCAGAGAAATCTTGG + Intergenic
1039369308 8:36968658-36968680 GTTTCAGCCAAGAGGGAACTGGG + Intergenic
1041301029 8:56411565-56411587 GATGGAGCCAAGAGGGCTCTGGG - Intergenic
1042745729 8:72103600-72103622 GATTCTTCCCAGAGGGCTCCTGG + Intronic
1045847804 8:106658110-106658132 GAGCCAGCCCAGGGGGACCTCGG + Intronic
1049296138 8:141840483-141840505 GATGGTGCCCAGAAGGATCTGGG - Intergenic
1049757363 8:144316692-144316714 GAACCAGGCCAGTGGGATCTAGG + Exonic
1052311563 9:27074482-27074504 GCTCCACCCCAGAGGGATATAGG + Intergenic
1053164143 9:35832881-35832903 GATGCAGCCGAGAGGGATAAAGG - Intronic
1053461044 9:38271814-38271836 GACTCAGCACAGAGGGATACAGG + Intergenic
1057042074 9:91855362-91855384 GACTCAGCCCAGAGAGATCAGGG + Intronic
1057179393 9:93021651-93021673 GATTCAGGCCTGCGGGGTCTGGG - Intronic
1057228620 9:93305465-93305487 GATCCAGACCAGTGGGCTCTGGG - Intronic
1060241337 9:121906380-121906402 GATTCTGCCTGGAGGGATCAGGG - Intronic
1060473941 9:123971161-123971183 GACTGAGCCGAGAGGGCTCTGGG - Intergenic
1187247498 X:17566060-17566082 GCTTCAGCCCAGAGTGGTCGAGG - Intronic
1187283950 X:17884859-17884881 TATTCAACCCATAGGGAGCTGGG - Intergenic
1192554288 X:72077716-72077738 CCTCCAGCCCAGAGGGATCCGGG + Intergenic
1194834439 X:98664043-98664065 ATTTCAGCCCAGAGGAAGCTCGG - Intergenic
1194865549 X:99061578-99061600 GATCCAGCCCACAGACATCTTGG + Intergenic
1199619604 X:149687318-149687340 AGTTCAGCCCAGTGGGATCAGGG + Intergenic
1200182278 X:154158030-154158052 GCTTCACCCCAAAGAGATCTGGG - Intronic
1200187932 X:154195144-154195166 GCTTCACCCCAAAGAGATCTGGG - Intergenic
1200193582 X:154232284-154232306 GCTTCACCCCAAAGAGATCTGGG - Intronic
1200199337 X:154270088-154270110 GCTTCACCCCAAAGAGATCTGGG - Intronic