ID: 904927866

View in Genome Browser
Species Human (GRCh38)
Location 1:34062633-34062655
Sequence AGGGAGGACAGGATGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 0, 2: 9, 3: 74, 4: 695}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904927857_904927866 -1 Left 904927857 1:34062611-34062633 CCGAGGGTGGGACAGCCAGGCAA 0: 1
1: 0
2: 2
3: 24
4: 212
Right 904927866 1:34062633-34062655 AGGGAGGACAGGATGGCCAGGGG 0: 1
1: 0
2: 9
3: 74
4: 695
904927854_904927866 4 Left 904927854 1:34062606-34062628 CCATCCCGAGGGTGGGACAGCCA 0: 1
1: 0
2: 1
3: 9
4: 122
Right 904927866 1:34062633-34062655 AGGGAGGACAGGATGGCCAGGGG 0: 1
1: 0
2: 9
3: 74
4: 695
904927849_904927866 17 Left 904927849 1:34062593-34062615 CCAAGGTGAGGGTCCATCCCGAG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 904927866 1:34062633-34062655 AGGGAGGACAGGATGGCCAGGGG 0: 1
1: 0
2: 9
3: 74
4: 695
904927848_904927866 18 Left 904927848 1:34062592-34062614 CCCAAGGTGAGGGTCCATCCCGA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 904927866 1:34062633-34062655 AGGGAGGACAGGATGGCCAGGGG 0: 1
1: 0
2: 9
3: 74
4: 695
904927856_904927866 0 Left 904927856 1:34062610-34062632 CCCGAGGGTGGGACAGCCAGGCA 0: 1
1: 2
2: 7
3: 58
4: 421
Right 904927866 1:34062633-34062655 AGGGAGGACAGGATGGCCAGGGG 0: 1
1: 0
2: 9
3: 74
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904927866 Original CRISPR AGGGAGGACAGGATGGCCAG GGG Intronic
900158145 1:1211757-1211779 AGGGCCAGCAGGATGGCCAGGGG + Exonic
900265234 1:1753908-1753930 AGGGGGCACAGGATGGCCCTAGG + Intronic
900269400 1:1779169-1779191 AGGGAGGACCCGGTGGCCTGGGG + Intronic
900290656 1:1922247-1922269 AGGGTGGACAGGAGGGCCCGAGG + Exonic
900399492 1:2467196-2467218 AGGGAGGACAGGATGAACGGTGG + Intronic
900401972 1:2476348-2476370 AGGGTGGATAGGCTGGCCTGGGG + Exonic
900677198 1:3895080-3895102 AGGGAGGAGAGGTGGGGCAGTGG - Intronic
901297308 1:8170421-8170443 AGGCAGGCCAGGAGGCCCAGAGG + Intergenic
901529110 1:9842669-9842691 AGTCAGGGCAGGGTGGCCAGAGG - Intergenic
901736344 1:11314692-11314714 AGGGAGTCCAGGCTGGCCAAAGG - Intergenic
901885198 1:12217919-12217941 GGGGAGGACAGGACAGCCATGGG + Intergenic
901919427 1:12525764-12525786 AGGGAGGAGAGGAGGGGAAGTGG + Intergenic
902151035 1:14443548-14443570 AGAGTGGGCAGGAAGGCCAGGGG - Intergenic
902154963 1:14477777-14477799 CTGGAGGACAGGACGTCCAGAGG + Intergenic
902876011 1:19341309-19341331 CGGGAGGTCAACATGGCCAGCGG + Intronic
902987839 1:20166289-20166311 AGGGAGGGCAGGAAGCTCAGTGG - Intronic
903004908 1:20292168-20292190 AGGGAGGACAGGAGGGGGGGAGG - Intronic
903069720 1:20721174-20721196 AGAGAGGGCAGGAGGGACAGAGG - Intronic
903236963 1:21956508-21956530 GGTGAGCACAGGATGGGCAGAGG - Intergenic
903303697 1:22397311-22397333 ACAGAGGACAGAATGCCCAGAGG + Intergenic
903345810 1:22683634-22683656 AGGGAGAACAGCATGGCAGGGGG - Intergenic
903776757 1:25798866-25798888 AAGAAGAACAGGATGGGCAGTGG + Intergenic
904001074 1:27339116-27339138 AGGGAGCACAGAAGGCCCAGGGG + Intergenic
904127019 1:28248117-28248139 AGGTAGGACAGGATGGTGGGAGG + Intergenic
904335417 1:29794115-29794137 AAGGAGGACAGGAGGGAGAGAGG - Intergenic
904918182 1:33985373-33985395 GGGGAGGACAGGAGGGACTGCGG + Intronic
904927866 1:34062633-34062655 AGGGAGGACAGGATGGCCAGGGG + Intronic
905234764 1:36538331-36538353 AGGAAGGACAGGATGGGGATGGG + Intergenic
906223915 1:44105444-44105466 TTGGCAGACAGGATGGCCAGAGG + Intergenic
906634597 1:47400436-47400458 AGTCAGGACAGGATGGCCTCAGG - Intergenic
907792751 1:57683059-57683081 TGGGATGCCAGGATGGCCTGTGG - Intronic
908252277 1:62274531-62274553 AGGGAGGGCAGGAGGGGCAGGGG + Exonic
908605594 1:65793504-65793526 GGGGAGGAGAGGATGGAGAGAGG + Intronic
908945293 1:69488203-69488225 AGGTAGGACAGGATGGCTAGAGG - Intergenic
909597652 1:77423951-77423973 GGGTGGGACAGGATGGCTAGAGG - Intronic
909677355 1:78252996-78253018 AGAGAGGACAGGATGGAGACAGG - Intergenic
910115611 1:83728408-83728430 AGTGAAGACAGGCTGGCCTGTGG - Intergenic
910427541 1:87132030-87132052 CGGGAGGGCAGGGTGGCGAGAGG - Intronic
911162373 1:94694118-94694140 AAGGAGGAGAGGGAGGCCAGTGG + Intergenic
912560489 1:110548129-110548151 AGTCAGGACAGGCAGGCCAGAGG - Intergenic
913509389 1:119548224-119548246 AGGGGGCACAGCATGGGCAGTGG + Intergenic
913666309 1:121051873-121051895 AGGGAGGAAAGGATGGAGGGAGG + Intergenic
913973550 1:143435608-143435630 CTGGAGGACAGGATCACCAGAGG - Intergenic
914067938 1:144261215-144261237 CTGGAGGACAGGATCACCAGAGG - Intergenic
914111217 1:144705139-144705161 CTGGAGGACAGGATCACCAGAGG + Intergenic
914203555 1:145506852-145506874 AGGTGAGACAGGATGGCTAGAGG + Intergenic
914227837 1:145736218-145736240 AGGTTGGAAAGGATGTCCAGGGG + Intronic
914482677 1:148080006-148080028 AGGTGAGACAGGATGGCTAGAGG + Intergenic
914656608 1:149747518-149747540 AGGGAGGAAAGGATGGAGGGAGG + Intergenic
914711820 1:150221506-150221528 AGGGAGGAAAGGAAGGAGAGTGG + Intronic
915048237 1:153038575-153038597 AGGGAGGGAAGGATGGGGAGAGG - Intergenic
915100471 1:153495499-153495521 GGGGAGGACAGGCTGGCCCCAGG + Intergenic
915130725 1:153693719-153693741 AGGGAGGAGAGCATGGGGAGGGG - Exonic
915563267 1:156699971-156699993 AGGGCGGTGAGCATGGCCAGTGG + Exonic
915899373 1:159835366-159835388 AGGCAGGACAGGATTCCCATGGG - Exonic
916552209 1:165859892-165859914 AGGGTGGACAAGGTGGGCAGGGG - Intronic
917089399 1:171337661-171337683 AGTGAAGACAGGATTGCCACTGG - Intronic
917923755 1:179771831-179771853 TGAGAGCAGAGGATGGCCAGCGG - Intronic
919739949 1:200975355-200975377 AGGGAGAACAGGAGGGCTTGGGG + Intronic
919844694 1:201634486-201634508 AGGGAGGCCAGGAGAGGCAGTGG + Intronic
920795699 1:209134132-209134154 AGGTGAGACAGGAGGGCCAGAGG - Intergenic
920937494 1:210449197-210449219 AGACAGAACAGCATGGCCAGAGG - Intronic
920968256 1:210719917-210719939 AGGGAGGGAAGGAAGCCCAGTGG - Intronic
921428464 1:215033644-215033666 AGATGGGACAGGATGGCTAGAGG + Intronic
921436564 1:215130145-215130167 GGGGAGGGAAGAATGGCCAGAGG + Intronic
921851484 1:219936670-219936692 GGGGAAGACAGGATTACCAGGGG - Intronic
922181703 1:223241054-223241076 AGGTGGTACAGGATGGCTAGAGG + Intronic
922761197 1:228131974-228131996 AGGCAGGTCAGAATGGCCAAGGG - Intergenic
922981305 1:229829279-229829301 AGGGAGAACAGGGTGGCAATTGG - Intergenic
924221591 1:241881323-241881345 AAAGAGGACAGTAAGGCCAGGGG - Intronic
924641324 1:245836345-245836367 ACGGAGGATGGGAAGGCCAGTGG - Intronic
924946540 1:248850551-248850573 AGGGAAGTCATGATGGCCTGAGG - Intronic
1062928432 10:1335535-1335557 AGGGAGGAAATGATGGAGAGAGG + Intronic
1063757683 10:9033161-9033183 TAGGAGGACAGGATGGCTGGAGG - Intergenic
1063867981 10:10388002-10388024 AAGAAGCACATGATGGCCAGGGG - Intergenic
1063948058 10:11196572-11196594 AGGGAGGACAGCATGGGCCCAGG + Intronic
1064420280 10:15184953-15184975 AGGGAGGACGGGACAACCAGAGG + Intergenic
1064940525 10:20730104-20730126 ATGGAGGACAGGATTGTTAGAGG - Intergenic
1065121298 10:22532763-22532785 AGTGAAGGCAGGCTGGCCAGAGG + Intergenic
1066468566 10:35675095-35675117 AGCAGGGACAGGATGGCAAGAGG + Intergenic
1067267427 10:44757596-44757618 AGGGAAGACAGGAAGGTGAGAGG - Intergenic
1067516830 10:46955534-46955556 AAAGAGTACAGTATGGCCAGAGG + Intronic
1067645421 10:48096292-48096314 AAAGAGTACAGTATGGCCAGAGG - Intergenic
1067683374 10:48453796-48453818 CGGGGGGACAGGATGGCAAGAGG + Intronic
1067729945 10:48803417-48803439 AGACAGGGCAGGGTGGCCAGTGG + Intronic
1067805351 10:49388333-49388355 GGGGAGGAGAGGATGCCCTGGGG - Intronic
1067829937 10:49605771-49605793 ACCGAGGACAGGCTGGCCAAGGG + Intergenic
1067916845 10:50408908-50408930 AGGGAGGTCAGGCAGGCTAGGGG - Intronic
1068311465 10:55282196-55282218 AAGGAGGGCAGCATGGCTAGAGG - Intronic
1068520144 10:58068719-58068741 AGGTACCACTGGATGGCCAGGGG + Intergenic
1068679413 10:59803596-59803618 AGGGTGGAGTGGGTGGCCAGTGG - Intronic
1069642615 10:69965492-69965514 AGGCAGGACAGACAGGCCAGCGG + Intergenic
1069647191 10:70009289-70009311 AGGTGGGACAGGATGGCTACAGG - Intergenic
1069729814 10:70603289-70603311 AGGGAGGAGGGAATGGCCACAGG - Intergenic
1069885712 10:71622357-71622379 AGGGAAAACAGGACTGCCAGTGG - Intronic
1069919333 10:71807105-71807127 AGGGAGCAAAGCATGGCCCGCGG - Intronic
1069994780 10:72335568-72335590 GGGGAGGACAGCATCGCTAGAGG + Exonic
1070309995 10:75266140-75266162 AGGGAGGACGGGAAGGAGAGGGG + Intergenic
1070385917 10:75924558-75924580 AGGAAGGACTGGCTGCCCAGAGG + Intronic
1070546562 10:77457399-77457421 GGGGAGGGCAGGATACCCAGAGG - Intronic
1070761791 10:79028557-79028579 AGGGAGGGCAAGAAGGACAGTGG + Intergenic
1070807123 10:79277154-79277176 AGGAAGGACAGGACAGTCAGTGG - Intronic
1071434148 10:85631314-85631336 CATGAGGACAGGATGGTCAGGGG - Intronic
1071531588 10:86393547-86393569 ATGGAGGACACGGAGGCCAGGGG + Intergenic
1071543868 10:86512752-86512774 AGGGAGTAAAGGATGGGAAGTGG + Intronic
1071709948 10:88040397-88040419 AGAGGGGACAGGAAGGCCAAAGG - Intergenic
1072738475 10:97895481-97895503 AGGGAGGACGGGAGGGGGAGAGG + Intronic
1072899702 10:99396091-99396113 AGGAAGGAAAGGAGGGGCAGGGG + Intergenic
1073176290 10:101559581-101559603 AGGGAGAAGGGGGTGGCCAGGGG - Intergenic
1073812599 10:107166573-107166595 ATGGAGGAGAGGAGAGCCAGAGG + Intergenic
1076114254 10:127884498-127884520 AGAGAGGACCAGATGCCCAGAGG + Intronic
1076301830 10:129433973-129433995 AGGGAGGAAGGGAAGGGCAGTGG - Intergenic
1076312489 10:129518467-129518489 AGGGAGGGGAGGAGGGGCAGGGG - Intronic
1076312502 10:129518492-129518514 AGGGAGGGGAGGAGGGGCAGGGG - Intronic
1076312515 10:129518517-129518539 AGGGAGGGGAGGAGGGGCAGGGG - Intronic
1076373917 10:129971382-129971404 AGGGCGGCCCGGATGGCCGGAGG - Intergenic
1076524754 10:131105323-131105345 AGAGAGGACAGCATGGAGAGGGG - Intronic
1076747183 10:132520231-132520253 AGGGAGCCAAGGAAGGCCAGAGG + Intergenic
1076871395 10:133196718-133196740 AGGGAGGACAGGAGTGGCCGGGG + Intronic
1077016002 11:399437-399459 AGGGAGGACAGGAGGAGTAGGGG - Intronic
1077017929 11:405097-405119 AGAGGGGACAGGGTGGACAGCGG + Intergenic
1077297984 11:1834955-1834977 AGGCAGCACGGGGTGGCCAGGGG - Intronic
1077401652 11:2361150-2361172 AGGGACTACAGAATGGGCAGTGG + Intergenic
1077468920 11:2747741-2747763 AGGGAGGACTGGTTGCCCACAGG + Intronic
1077497343 11:2892593-2892615 AGGGAGGGGAGGAGGGGCAGGGG - Intronic
1077618715 11:3699199-3699221 TGGCAGTACAGGATAGCCAGCGG + Exonic
1078093381 11:8281662-8281684 ATGGAGGACAGGATGGCAGGGGG - Intergenic
1078364265 11:10693562-10693584 AGTGAAGAGAGGCTGGCCAGAGG - Exonic
1079079514 11:17404542-17404564 AAGTAGCACACGATGGCCAGGGG + Exonic
1079220886 11:18560014-18560036 TGGAAGGACAGGATGGGCATAGG + Intronic
1079369487 11:19838450-19838472 AGAGAGGAGAGGAGAGCCAGAGG + Intronic
1079444119 11:20544453-20544475 AGGCAAGGCAGGATAGCCAGAGG - Intergenic
1079529477 11:21432996-21433018 AGGGAGGGAAGGATAGGCAGAGG - Intronic
1081555791 11:44159832-44159854 AGGTGGGACAGGATGGCTACAGG + Intronic
1081646843 11:44796015-44796037 AGGGACCACAGGAAGGCCAGAGG - Intronic
1081781677 11:45717322-45717344 TGGGAGGACAGGAAAGACAGGGG + Intergenic
1081911892 11:46705126-46705148 AGGGAGCCCTGGTTGGCCAGGGG - Exonic
1082190735 11:49240492-49240514 AGGGAGCACAGTATGGAAAGAGG + Intergenic
1082679645 11:56152458-56152480 AGGGTGGCCAAGATGGCCACTGG - Intergenic
1082689807 11:56286457-56286479 AGAGAGGACGGGATAGTCAGTGG - Intergenic
1083424674 11:62577090-62577112 AGGGAGGTCAGAATGGGCACCGG - Intronic
1083460414 11:62807288-62807310 GGGGAGGACAGGGTGGCCAGAGG + Exonic
1083667863 11:64285328-64285350 AGGGAGGACCGTAGGGCCCGTGG + Intronic
1084157626 11:67323001-67323023 AGGGAGGAGAGGAGGGAAAGAGG - Intronic
1084215368 11:67644562-67644584 AGGGAAGGCAGCAGGGCCAGGGG + Intronic
1084282789 11:68109531-68109553 AGGTGGGACAGAATGGCCAGAGG - Intronic
1084545013 11:69810859-69810881 AGGAAGGACATGCTGGGCAGAGG - Intronic
1084670600 11:70604429-70604451 AGTGAGTCCAGGAGGGCCAGGGG + Intronic
1085042248 11:73333543-73333565 AGGGTGGTCAGGATGTCCAGGGG - Intronic
1085882971 11:80489512-80489534 AGAAAGGACAGGATGGTCAGAGG + Intergenic
1086199171 11:84179796-84179818 AGGTGAGACAGGATGGCTAGAGG - Intronic
1086675384 11:89600449-89600471 AGGGAGCACAGTATGGAAAGAGG - Intergenic
1087905241 11:103688304-103688326 AGCAAGGACAAGATGGCCTGGGG + Intergenic
1088992250 11:114963748-114963770 AGGCAAGACATGAGGGCCAGGGG + Intergenic
1089646997 11:119886914-119886936 GGGGAGGCCAGGAGGACCAGAGG - Intergenic
1090350168 11:126102918-126102940 AAGGAGGTGAGGCTGGCCAGGGG + Intergenic
1090645620 11:128764794-128764816 AGGGAGGACTGGCAGGCGAGCGG + Intronic
1091049147 11:132352142-132352164 AGTGAGGACAGCATGGCGGGTGG - Intergenic
1091208650 11:133837637-133837659 AGGAAAGACAGGAAGGCTAGAGG - Intergenic
1091593064 12:1856864-1856886 GGGGATGACAGAAAGGCCAGTGG + Intronic
1091652974 12:2323545-2323567 GGGGAGGACAGGGTGGTGAGGGG - Intronic
1091962238 12:4705800-4705822 AGGTGGGACAGGATGACTAGAGG - Intronic
1092192940 12:6533671-6533693 GCGGAGGACAGGATGGCTGGTGG - Intergenic
1092239861 12:6829779-6829801 AGGGTGGGGAGGCTGGCCAGGGG + Intronic
1092455360 12:8637915-8637937 CAGGAGGCCAGGGTGGCCAGGGG + Intronic
1092745571 12:11669342-11669364 AGGGAGGACAGGAGGACGGGAGG - Intronic
1093262582 12:16957415-16957437 AGGGAGGGCAGGCAGGCAAGAGG - Intergenic
1094588319 12:31798197-31798219 AAGGAGGACAGGTAGTCCAGGGG + Intergenic
1094836317 12:34323804-34323826 AGGGACGCCAGGATCCCCAGGGG + Intergenic
1095192911 12:39278639-39278661 AGGCATGACAGGATGGCCAGAGG - Intergenic
1095985625 12:47997645-47997667 AGGGGGGCCAGGATTTCCAGGGG + Exonic
1096181910 12:49555829-49555851 AGGGAGGCCAGGCAGGGCAGGGG + Exonic
1096201112 12:49683883-49683905 AGAGAGGACAGCATGAGCAGAGG - Intronic
1096554133 12:52393089-52393111 AGGGAAGACTGTATGGACAGGGG - Intergenic
1096582136 12:52592531-52592553 AGGGAGGGAGGGATGGGCAGGGG - Intronic
1096678954 12:53242171-53242193 AGGGAGGACAGGCAGGGCAGCGG - Intergenic
1096745433 12:53723885-53723907 AGGGAGAAGAGTATGGCCTGTGG - Intronic
1096885230 12:54711883-54711905 AGGGAGGAGAGGATGGGGAAAGG - Intergenic
1096944675 12:55391939-55391961 AGGATGGAGAGGATGGCCAGAGG - Intergenic
1097170400 12:57109781-57109803 AGGGAGGACTGGGTAACCAGTGG + Intronic
1097226359 12:57478838-57478860 AGGGAAGACAAGAAGGGCAGAGG + Intronic
1098550843 12:71759509-71759531 AAGGAGGAGGGGATGGCCTGTGG - Intronic
1098735359 12:74095269-74095291 AAGTAGGTCAAGATGGCCAGAGG + Intergenic
1099446702 12:82761452-82761474 TGTGAGGACTGGATGGCCACGGG - Intronic
1099794596 12:87383288-87383310 AGTGATGACAGCATGGCCATTGG - Intergenic
1100370810 12:93967058-93967080 AGGGAAGAAAGGATGGCGGGAGG - Intergenic
1100371501 12:93972976-93972998 AAGGAGGACAGTCTGACCAGAGG + Intergenic
1100587139 12:95990781-95990803 AGGGAGGAAAGGAGGGCTGGAGG + Intronic
1101426709 12:104594217-104594239 TGTGGGGACAGAATGGCCAGAGG - Intronic
1101834545 12:108286337-108286359 GGGGAGGACAGGTTGGAGAGGGG - Intergenic
1102347112 12:112167411-112167433 AAGGAGGGCAGGAGGTCCAGGGG + Exonic
1102491070 12:113289894-113289916 AGGTGGGTCAGGCTGGCCAGGGG + Intronic
1102573861 12:113843859-113843881 AGGGAGGACAGCATGGCTGGAGG - Intronic
1102762307 12:115398677-115398699 TGGGAGGGCAGGAAGGCAAGCGG - Intergenic
1102780929 12:115563706-115563728 AGGGAAGAGAGGATGGCAGGAGG + Intergenic
1102857999 12:116311632-116311654 AGGTAGAACAGGAGGGCCAAGGG + Intergenic
1103834783 12:123809943-123809965 AGAGAGGACAAGAAGGTCAGGGG - Intronic
1104003440 12:124875247-124875269 AGGGAGGACAGCAGGTCCACCGG + Intronic
1104161056 12:126181520-126181542 AGGGAGAACAAGATGGAAAGAGG - Intergenic
1104205822 12:126637454-126637476 AGCCAGGAGATGATGGCCAGAGG - Intergenic
1104668841 12:130666944-130666966 AGGGAGGAAAGGAGGGAGAGAGG + Intronic
1105681627 13:22734058-22734080 AGGGAGGAGAGGATGTAGAGAGG + Intergenic
1105780805 13:23703878-23703900 AGGGAGAAGCGGATGCCCAGAGG + Intergenic
1106299412 13:28450522-28450544 AGGGAGGAAAGGAGGGAGAGAGG + Intronic
1106346556 13:28885304-28885326 AGGGAGGAGTGGCTGGGCAGGGG + Intronic
1106578459 13:30997865-30997887 AGTGATGACAGGAGGGCAAGTGG + Intergenic
1107080661 13:36371258-36371280 AGGGAAGAAATGATGGCCTGAGG - Intergenic
1107750653 13:43562010-43562032 AGGGAGGGAAGGATGGAGAGAGG + Intronic
1109202473 13:59446177-59446199 AGGGAAGACAGGAAAGCCTGAGG - Intergenic
1109905331 13:68831913-68831935 AGGCAGGACAGCATGTTCAGGGG - Intergenic
1110325751 13:74213567-74213589 AGGGAGGAAAGGAGGGAAAGAGG - Intergenic
1110554997 13:76849665-76849687 ATGGAGGAGAGGATGGCGAGTGG - Intergenic
1110555003 13:76849699-76849721 CAGGAGGAGAGGATGGCGAGTGG - Intergenic
1110608292 13:77459807-77459829 AGCGTGGACAGGATTTCCAGAGG + Intergenic
1111452597 13:88438677-88438699 AGGGAGGAAGGGAGGGACAGAGG + Intergenic
1112436221 13:99393036-99393058 AAGGAGGAGATGATGGACAGAGG - Intergenic
1112752746 13:102598264-102598286 AAGGAGGATAAGATAGCCAGGGG - Intronic
1113315266 13:109173097-109173119 ATGAAGGGCAGGATGGCAAGAGG + Intronic
1113811090 13:113143144-113143166 AGGGGGGAATGGATGGCAAGGGG - Intronic
1114634215 14:24178255-24178277 AGGGAGGCAGGGATGACCAGGGG + Intronic
1114655384 14:24312458-24312480 AGGGAGGATCAGATGGTCAGGGG - Intronic
1116633756 14:47366206-47366228 AGGGAGGTCAGGAAGGCTATTGG + Intronic
1117260028 14:54022758-54022780 AGGTGGGACAGGATGGCTAAAGG + Intergenic
1117608054 14:57452187-57452209 AGGTGGGACAGGATGGCTATAGG + Intergenic
1118780538 14:69004866-69004888 AGGGAGGAGAAGATGGGGAGAGG - Intergenic
1119326397 14:73762115-73762137 GGGGAGGTGAGGATGGCCACAGG - Intronic
1119408417 14:74412780-74412802 AGGGTGGGCAAGATGGGCAGGGG - Intronic
1119423519 14:74522060-74522082 AGGGAGGTCAGGGGGGCCAGCGG + Intronic
1119806493 14:77485523-77485545 GGTGAGGACACCATGGCCAGTGG - Intronic
1121017107 14:90555534-90555556 TGGGAGGACAGGATGGCATGGGG + Intronic
1121631033 14:95422135-95422157 AGGGAGAAGCTGATGGCCAGAGG - Intronic
1121633355 14:95437387-95437409 AGGGAAGACAGCATGCGCAGTGG - Intronic
1121687658 14:95850048-95850070 AGGGAGTGGAAGATGGCCAGTGG - Intergenic
1121796478 14:96740410-96740432 AGGGAGGTGGGGATGGCCATGGG - Intergenic
1121796958 14:96743166-96743188 AGAGAAGACAGGATGTGCAGTGG + Intergenic
1122380504 14:101301233-101301255 AGGTAAGACAGGAAGACCAGAGG - Intergenic
1122530163 14:102419618-102419640 AGGCAGGTCAGGAGGCCCAGAGG + Intronic
1122806222 14:104260071-104260093 AGGTGGGACAGGATGGCTGGAGG - Intergenic
1122882287 14:104695537-104695559 AGGGAGGACAGGAAGGGCGGAGG - Intronic
1123068156 14:105628413-105628435 AGGGAGGACAGAGTGAGCAGGGG - Intergenic
1123191999 14:106580356-106580378 AAGGAGGACAGCATGGAAAGTGG - Intergenic
1202904668 14_GL000194v1_random:61185-61207 AGGGAGGATTGGAGGGACAGAGG + Intergenic
1123486000 15:20739643-20739665 AGAGAGGAGAGGATGGGAAGGGG + Intergenic
1123542489 15:21308713-21308735 AGAGAGGAGAGGATGGGAAGGGG + Intergenic
1124589638 15:31041534-31041556 AGGTGGGACAGGATGGCTAGAGG - Intronic
1125311593 15:38385129-38385151 AGGGAGTTCTGGGTGGCCAGAGG - Intergenic
1125369384 15:38954333-38954355 AGGGAGGACCGGATAGGGAGAGG + Intergenic
1125539965 15:40464571-40464593 AGGGAGGGCAGGAGAGACAGAGG + Intronic
1126105531 15:45144633-45144655 GAGGAGGGCAGGAAGGCCAGAGG - Intronic
1126413019 15:48391612-48391634 AGGGAGGAAAGGGCGGCCTGTGG - Intergenic
1127258068 15:57307908-57307930 AGGGAGGGCAGGGTGAACAGAGG - Intergenic
1128556918 15:68638096-68638118 AGGGAGACCAGGATGGCCCTGGG + Intronic
1128795248 15:70461934-70461956 AGGGAGGAAAGCATGGGCAAAGG + Intergenic
1129020509 15:72513716-72513738 AGGGAGGGAAGGAGGGACAGGGG - Intronic
1129156874 15:73723570-73723592 AGGGAGGGCAGGGAGTCCAGCGG + Intergenic
1129333191 15:74838212-74838234 GGTGAGGACAGGGTGGCCAGAGG + Intronic
1129465364 15:75721712-75721734 GGGGAGGGCAGGCTGCCCAGAGG + Intergenic
1129724725 15:77895947-77895969 AGAGATGGCAGGATGGCAAGAGG + Intergenic
1130399390 15:83535308-83535330 AGGTTGGACAGGATGGCTTGAGG + Intronic
1130679956 15:85988021-85988043 AGGGAGGAGAGGATTGTGAGTGG + Intergenic
1130893232 15:88150816-88150838 GGTGAGGGCAGGGTGGCCAGAGG - Intronic
1130926236 15:88387935-88387957 AGGGGAGCCAGGATGACCAGGGG + Intergenic
1131815462 15:96217103-96217125 AGGGAGGACATGGTGTCCTGGGG - Intergenic
1131826099 15:96323329-96323351 GGGAAGGCCAGGAGGGCCAGGGG - Intergenic
1132020416 15:98356553-98356575 AGGGAGGAAGGGATGGAGAGAGG + Intergenic
1132022752 15:98377203-98377225 AGGTGGGACAGGATGGGTAGAGG - Intergenic
1202950806 15_KI270727v1_random:35854-35876 AGAGAGGAGAGGATGGGAAGGGG + Intergenic
1132484885 16:185659-185681 ACGGGGGACAGGATGGCCAGGGG + Intergenic
1132568065 16:632182-632204 TGGGAGGACAGGGAGGACAGTGG - Intronic
1132952325 16:2570228-2570250 AGGAAGGAGAGGAAGGCCACAGG + Intronic
1132962026 16:2629942-2629964 AGGAAGGAGAGGAAGGCCACAGG - Intergenic
1133229722 16:4360782-4360804 AGTGAGGAGAGGGGGGCCAGTGG - Intronic
1133346738 16:5076091-5076113 AGGGAGGGAAGAAGGGCCAGTGG + Intronic
1133597504 16:7307196-7307218 AGGGAAGACTCGATGGCCGGTGG - Intronic
1133663002 16:7937122-7937144 AGGGAGGTCAGGAAGGACAAAGG + Intergenic
1134379790 16:13713312-13713334 AAGGAGGCCAGGGTGGCCAGAGG - Intergenic
1135137963 16:19898645-19898667 AGGGAGGGGATGATGACCAGGGG - Intergenic
1135632626 16:24047969-24047991 AGGGAAGGGAGGAGGGCCAGTGG + Intronic
1135940323 16:26816739-26816761 AGGGAACCCAGGATGGACAGAGG - Intergenic
1136336622 16:29614202-29614224 AGGGATGAGAGGATGACCTGAGG + Intergenic
1136375380 16:29862454-29862476 AAGCAGAACAGGATGGCCTGGGG - Intronic
1137724735 16:50649584-50649606 ATGGGAGACAGCATGGCCAGTGG - Intergenic
1137838644 16:51619313-51619335 AGGGAGAAAAGGAAGGCAAGTGG - Intergenic
1138082750 16:54107279-54107301 AGAGAGGACAGGATTGAAAGGGG + Intronic
1138415333 16:56868273-56868295 TGGGAGGACAGGGGGGTCAGAGG - Intronic
1138960345 16:62021923-62021945 AGAGAGGAAGGGATGGACAGAGG - Intronic
1139303083 16:65961902-65961924 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1139303118 16:65962012-65962034 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1139369708 16:66459217-66459239 ATGGAGGACAGAATGGGCAGAGG - Intronic
1139380390 16:66527040-66527062 AGGGAGGACAGGCAGGACAGAGG - Intronic
1139400237 16:66675537-66675559 AGGGAGCCCAGCAGGGCCAGGGG - Intronic
1139518480 16:67465747-67465769 AGGGAGGTGAGGATGGGTAGAGG + Intronic
1139531758 16:67545943-67545965 AGGAAGCACAGGAGGGCCTGTGG - Exonic
1140914619 16:79482961-79482983 AGGGAGGGAAGGAGGGACAGAGG - Intergenic
1141097519 16:81173184-81173206 GGGGACCACAGGATGTCCAGGGG + Intergenic
1141524167 16:84600807-84600829 ATGAAGTACAGGATGGCCAGAGG + Intronic
1142031297 16:87839796-87839818 AGGGAGATGATGATGGCCAGGGG + Exonic
1142037346 16:87869986-87870008 AGGGATGAGAGGATGACCTGAGG + Intergenic
1142112337 16:88339391-88339413 ATGGGGGACAGGATGGCAGGGGG + Intergenic
1142112399 16:88339548-88339570 ATGGGGGACAGGATGGCAGGGGG + Intergenic
1142210549 16:88806480-88806502 AGGGAGGCCAGGAAGGCCTGGGG - Exonic
1142559327 17:800711-800733 TGGGAGCACGGGATGGCCGGGGG - Exonic
1142608039 17:1092794-1092816 GGGAAGGGCAGGGTGGCCAGAGG + Intronic
1142762261 17:2049695-2049717 CGGGAGGACAGGACGGCCTCAGG + Intergenic
1143473918 17:7192397-7192419 AGGGAGGGGAGGACGGACAGAGG + Intronic
1143862801 17:9903332-9903354 CAGGAGGACAGTATGGACAGGGG + Intronic
1143974356 17:10819260-10819282 AGGGAGGACAGAATGCACAGAGG - Intergenic
1144078793 17:11743654-11743676 AGTGAGAACAGGATGTCCACAGG - Intronic
1144247767 17:13384384-13384406 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1145205523 17:20983208-20983230 AGAGAGGACAGCATGAGCAGAGG + Intergenic
1145886260 17:28384471-28384493 ACGGAGGGCAGGATGGGCCGTGG - Exonic
1145962207 17:28893381-28893403 AGGAAGGCCAGGAAGGGCAGGGG - Intronic
1145973350 17:28969861-28969883 AGGAAAGACTGGTTGGCCAGGGG + Exonic
1146466610 17:33091195-33091217 AGGGAGGACTGGATGGAATGAGG + Intronic
1146741404 17:35287054-35287076 AGGGAGGAAAGGGTGGGAAGGGG - Intergenic
1146829656 17:36057687-36057709 AGGGAGGACATGATGGCAGGAGG - Intergenic
1146829664 17:36057723-36057745 AGACAGGAGAGGCTGGCCAGGGG - Intergenic
1147882892 17:43665360-43665382 GGGGAGGTCAGGAGGGCCATGGG + Intergenic
1148096442 17:45055697-45055719 GGGGAGCACAGGCTGTCCAGAGG - Intronic
1148186951 17:45651145-45651167 GGGGAGGGCAGGCTGGGCAGAGG - Intergenic
1148597111 17:48865552-48865574 AGGAAGGCCAGGGTGGGCAGTGG - Intronic
1148795760 17:50195941-50195963 AGGGAAGCCAGGAGGACCAGCGG + Exonic
1149529603 17:57384280-57384302 AGGGGAGACATGATGGCAAGGGG + Intronic
1149971866 17:61226997-61227019 AGGGAGGAGAGGATGGAGACTGG + Intronic
1150178381 17:63087466-63087488 AGGTGGAACAGGATGGCTAGAGG + Intronic
1150462138 17:65361815-65361837 CTGGAGGACAGGGGGGCCAGGGG - Intergenic
1151138685 17:71971515-71971537 AGGGAGCAGAGGATGGGGAGGGG + Intergenic
1151181408 17:72331589-72331611 ATGGTGGACAGGAAGGCCATAGG + Intergenic
1151272324 17:73006463-73006485 AGGGAGAAGAGGATGGGGAGGGG + Intronic
1151354841 17:73552078-73552100 AGGGGGGACAGGCTGGCCGAGGG - Intronic
1151536248 17:74740541-74740563 AATGAGGACAGGAGGGTCAGAGG + Intronic
1151552904 17:74832172-74832194 AGGGAGGAAGGGAGGGACAGAGG - Intronic
1151574186 17:74943369-74943391 GGGGAGGACAGAGAGGCCAGAGG - Intronic
1151655058 17:75491940-75491962 AGGGAGGCCAGGACAGCCTGTGG - Intronic
1151930386 17:77228294-77228316 AGGCTGGACGGGAAGGCCAGAGG + Intergenic
1152295598 17:79465397-79465419 ACGGAGGACTGGAGGGCCACGGG + Intronic
1152564610 17:81094642-81094664 AGGGAGGGCAGCATGGCAGGTGG - Intronic
1152597700 17:81245988-81246010 AGGGTGGACAGCAGGGCCACCGG - Exonic
1153493480 18:5673699-5673721 AGAGCAGTCAGGATGGCCAGAGG - Intergenic
1154164882 18:12007188-12007210 TGGGAGGACAGCACTGCCAGCGG + Intronic
1154283224 18:13027137-13027159 AGGATGGACAGGGTGGCTAGAGG + Intronic
1154484818 18:14865239-14865261 AGGGAAAAGAGGGTGGCCAGTGG - Intergenic
1156298751 18:35817545-35817567 AGAGATGACAGGATGACCTGTGG - Intergenic
1156499250 18:37546611-37546633 AGAGAGGGGAGGATGCCCAGAGG - Intronic
1156844047 18:41643107-41643129 AGAGAAGACTGGATGGACAGGGG - Intergenic
1158081202 18:53592905-53592927 TTGGAAGACAGGATGGCAAGAGG + Intergenic
1158278203 18:55791909-55791931 TGGGAGGGCAGGATGGGGAGGGG - Intergenic
1160599659 18:80002964-80002986 AGGGAGGCCAGGATGTCCTCAGG + Intronic
1160699532 19:499110-499132 AGGGAGGACAGGAAGGGGACAGG - Intronic
1161128869 19:2576418-2576440 AGGGAGGACAGGGCGGGCCGCGG + Intronic
1161141653 19:2651436-2651458 AGGGAGGAAAGGAAGGCAGGAGG - Intronic
1161210608 19:3063291-3063313 GGGGAGGTCAGGAAGGCCGGAGG + Intergenic
1161777027 19:6269216-6269238 AGGGTGGGCAGGCTGGCCTGTGG - Intronic
1161930487 19:7336483-7336505 AGGAAGGGCAGGGTGTCCAGCGG - Intergenic
1162030285 19:7914316-7914338 AGGGCGGACCGGGTGGGCAGGGG + Exonic
1162806026 19:13138531-13138553 GGGTAGGACAGGAGGGGCAGAGG - Exonic
1162821913 19:13228299-13228321 AGGGAGGGGAGGAGGGCTAGGGG + Intronic
1163085281 19:14975150-14975172 CGGGAGGAGAGGATGGGGAGAGG + Intronic
1163155341 19:15437136-15437158 AGAGAGGACAGGACTGCCTGAGG + Intronic
1163491155 19:17617852-17617874 GGGGAGGACAGGGTGGGGAGAGG + Intronic
1163493484 19:17631044-17631066 AGGGAGGGAAGGATGGACGGAGG - Intronic
1163603853 19:18263829-18263851 AGGGAGGGCAGGGTGGCCTCGGG - Intronic
1163632001 19:18422286-18422308 TGGGAGGACAGTATGGGAAGGGG - Intronic
1163815754 19:19463517-19463539 GGGGTGGACAGGGTGGCCGGGGG + Intronic
1164823591 19:31268113-31268135 AGGCAAGACAGCATGGGCAGGGG - Intergenic
1165245192 19:34494609-34494631 AGGGAGGATAGGACGGGCACAGG - Exonic
1165322652 19:35095892-35095914 AGAGAGAACAGGGAGGCCAGCGG + Intergenic
1165487384 19:36103886-36103908 GGGGTGGGCAGGAAGGCCAGGGG - Exonic
1165831218 19:38731300-38731322 AGGGAGGACATGAATGCCACAGG + Exonic
1165883375 19:39059313-39059335 GGGGAGGAGAGGATGGTTAGTGG - Intergenic
1165885725 19:39076775-39076797 AGGAAGGAGAGGATGGGTAGGGG + Intergenic
1166227091 19:41402985-41403007 AGGAAGGGAAAGATGGCCAGGGG - Intronic
1166258733 19:41623631-41623653 AGGTGGGACATGATGGCTAGAGG + Intronic
1166348106 19:42179343-42179365 AGGAAGGAAAGGAAGGCCAAGGG + Intronic
1166747722 19:45149633-45149655 GGGGAAGACAAGATGGCAAGGGG - Intronic
1167305844 19:48708867-48708889 AGGGAGGAGAGAACAGCCAGAGG + Intergenic
1167440634 19:49506772-49506794 AGGGTGGAGAGGAGGGGCAGCGG + Intergenic
1167571887 19:50293516-50293538 TGAAAGGACAGGATGGTCAGAGG - Intronic
1167689535 19:50976306-50976328 AGAGAGGAAAGGATGGAGAGAGG - Intergenic
1167813063 19:51852080-51852102 AGGCAGGACAGCCAGGCCAGTGG - Intergenic
1168078622 19:53993515-53993537 TGGGGGTACAGGATGGCCTGGGG - Intronic
1168153501 19:54461138-54461160 GGGGAGGAGGGGATGGGCAGCGG + Exonic
1168511481 19:56977219-56977241 AGTGAGGACAGCATGGCCAGGGG + Intergenic
1168650717 19:58090337-58090359 AGGGATGACCAGATGCCCAGTGG + Exonic
925083885 2:1092407-1092429 GGTGAGGACAGGATGACCTGGGG - Intronic
925275378 2:2644877-2644899 ATGGTGGACAGGGTGCCCAGAGG - Intergenic
925275393 2:2644922-2644944 ACGGCGGACAGGGTGCCCAGAGG - Intergenic
925275408 2:2644967-2644989 ACGGCGGACAGGGTGCCCAGAGG - Intergenic
925275422 2:2645012-2645034 ATGGCGGACAGGGTGCCCAGAGG - Intergenic
925275436 2:2645057-2645079 ACGGCGGACAGGGTGCCCAGAGG - Intergenic
925275450 2:2645102-2645124 ACGGCGGACAGGGTGCCCAGAGG - Intergenic
925275463 2:2645147-2645169 AGGGTGGACAGGGTGGCCAGAGG - Intergenic
925572704 2:5329006-5329028 GGGGAGGACAGGGAAGCCAGGGG + Intergenic
925625895 2:5841939-5841961 AGGGAGGGGAGGATGGAGAGAGG + Intergenic
926085515 2:10017487-10017509 AGGGAGGAAAGGATGACCAAAGG - Intergenic
927458555 2:23278024-23278046 AGGGAGGGCAGGCAGGCTAGGGG - Intergenic
927620852 2:24656603-24656625 GAGGAGGAGAGGATAGCCAGAGG - Intronic
927691880 2:25214437-25214459 AGAGAGGACAGATTGGCCACTGG + Intergenic
927914408 2:26925653-26925675 GGGGAGGACAGGAAAGCCAGAGG - Intronic
927954771 2:27200733-27200755 AGGGAGCACAGGGTGGGCTGGGG + Intronic
928197751 2:29227585-29227607 GGGGTGTACAGGATGCCCAGTGG + Exonic
928362766 2:30678990-30679012 AGTGAGGACAGTAGGGTCAGCGG + Intergenic
928707341 2:33964560-33964582 AGGGAGGTGAGGATGGCTAATGG - Intergenic
929048576 2:37814982-37815004 AGCAATGACAGGATGGCCAGGGG - Intergenic
929051195 2:37838358-37838380 AGGGAGGAGAGGATAGCTGGGGG + Intergenic
929822457 2:45284316-45284338 AGGGAGGGCAGGAGGGGAAGGGG - Intergenic
929918104 2:46153017-46153039 AGGGAGGAGAGTAAGGGCAGAGG - Intronic
930148374 2:48031446-48031468 AGGGAGAACAGGATGACCCTGGG - Intergenic
930296942 2:49566467-49566489 AGGGAGGGAAGGAGGGACAGTGG - Intergenic
930917847 2:56715700-56715722 GGTGAGGACAGGATTGTCAGAGG - Intergenic
931266073 2:60661525-60661547 AGAGAGGAGAAGATGGTCAGAGG - Intergenic
931660641 2:64559281-64559303 AGGGAGGGAAGGATGGGGAGGGG + Intronic
931949394 2:67345543-67345565 AGGGAGTACAGAAGGGTCAGAGG - Intergenic
933559599 2:83874293-83874315 AGGGTGGCCAAGATGGCCACTGG + Intergenic
933560463 2:83879379-83879401 AGGGTGGCCAAGATGGCCACTGG + Intergenic
933728052 2:85437607-85437629 AGGGAGCACCGGGTGGCCGGCGG + Intergenic
934288541 2:91670866-91670888 CTGGAGGACAGGATCACCAGAGG - Intergenic
934501974 2:94869230-94869252 AGGGAGGATTGGAGGGACAGAGG - Intergenic
934557948 2:95297281-95297303 AGGGAGGAAGGGGTGGGCAGGGG + Intergenic
934562625 2:95320954-95320976 AGGGAGGAGAGGCTGGGGAGGGG - Intronic
934896196 2:98122222-98122244 AGGGAGTCCAGGCTGGCCAAAGG - Intronic
935098530 2:99970297-99970319 AGGGGAGAAAGGATGGTCAGGGG - Intronic
935118752 2:100161255-100161277 AGGTAGGTCCGGAGGGCCAGAGG + Intergenic
935433061 2:102998970-102998992 AGGTGGGACAGGATGGCTAGTGG + Intergenic
935666319 2:105516127-105516149 AGGAAGGAGAGGAAGGCCTGTGG - Intergenic
935971514 2:108534433-108534455 AGGAAGGGGAGGAAGGCCAGGGG - Intronic
936246006 2:110827764-110827786 GGGGAGGAGAGGAGGGCAAGGGG + Intronic
936250696 2:110866253-110866275 AGGCAGGAGAGGAGGGGCAGAGG + Intronic
936290856 2:111222982-111223004 TGGGAAGATAGGAAGGCCAGGGG + Intergenic
937681854 2:124652620-124652642 AAGGAGGACAAGATGGAGAGGGG + Intronic
937790127 2:125951414-125951436 AGGGAGGAAAGGATAGTGAGAGG + Intergenic
938130809 2:128714465-128714487 TGGGAGGAGAGGAAGCCCAGGGG + Intergenic
938574146 2:132588312-132588334 TGGGAGGGAAGGATGGCCAAGGG + Intronic
938909743 2:135875650-135875672 AGAAAGGAAAGGAAGGCCAGAGG + Intronic
938927308 2:136055756-136055778 GGGGAGGGAAGGATGGCCAGAGG + Intergenic
939630917 2:144524757-144524779 AGGGCTGAAAGGAGGGCCAGAGG - Intergenic
939679228 2:145109614-145109636 AAGGAGTACAGGGAGGCCAGTGG - Intergenic
942153641 2:173104757-173104779 AGGGAGATCAGGAGTGCCAGAGG + Intronic
944580070 2:201124704-201124726 AGGGGGAACAGAATGGCTAGGGG + Intronic
945431686 2:209772127-209772149 AGGAAGGTCTGGATGGGCAGGGG - Exonic
945465328 2:210162916-210162938 AGGTAGGATAGAATGGCTAGAGG - Intronic
946397906 2:219452516-219452538 GGGGAGGTGAGGATGGTCAGGGG + Intronic
947167391 2:227276445-227276467 TTGGGGGCCAGGATGGCCAGGGG - Exonic
947710447 2:232310818-232310840 AGGGAGGGCAGCAAGGCCTGGGG + Intronic
947747245 2:232514824-232514846 GGGGAGGGCAGGGAGGCCAGGGG + Intergenic
948197847 2:236108370-236108392 AAGGAGGAGAGGAAGGGCAGAGG - Intronic
948223216 2:236289799-236289821 AGCCAGGTCAGGATGGCAAGCGG - Intergenic
948612984 2:239181280-239181302 AGGGAGGAGAGGAGGGGCTGAGG + Intronic
948676880 2:239602032-239602054 GAGGAGGCCAGGAAGGCCAGAGG - Intergenic
948855258 2:240727348-240727370 AGGGAGGAGAGGAAGGACAGAGG + Intronic
948880105 2:240852330-240852352 AGGAAGGACAGTGTGGCCAGGGG - Intergenic
1168841427 20:912377-912399 AGGGAGGGCATGGTGGACAGAGG + Intronic
1168861505 20:1049030-1049052 ATGGAAGACTTGATGGCCAGGGG - Intergenic
1168931447 20:1627530-1627552 TGGTGGGACAGGATGGCCAGAGG - Intergenic
1169017956 20:2307017-2307039 AGGGAGGACAGAAAGGACAGAGG - Intronic
1169043067 20:2511718-2511740 AGGGAGGAAAGCAGGGCGAGGGG - Intronic
1169075491 20:2757455-2757477 AGGGAGGGCGGGAGGGCAAGGGG + Intronic
1169331937 20:4723009-4723031 AGGGAAGACAGGAGGGCCTGGGG - Intronic
1169811550 20:9613735-9613757 AGCTAGGACAGGGTGGCTAGGGG - Intronic
1170022877 20:11855065-11855087 AGCTGGGACAGGATGGCTAGAGG - Intergenic
1170643059 20:18172977-18172999 AGCTGGGACAGGATGGCTAGAGG + Intronic
1170914596 20:20610532-20610554 AGGGAGGACAAGATGGTCTTGGG - Intronic
1171446482 20:25207818-25207840 AGGTGGGCCAAGATGGCCAGGGG + Intronic
1171946792 20:31386031-31386053 GGGCAGGAGAGGATGGCGAGAGG + Intronic
1172445193 20:34989740-34989762 AGGATGGACAGGATGCCCAGTGG - Exonic
1172484230 20:35288722-35288744 AGGGAGGGCAGGGGAGCCAGTGG - Intronic
1172487467 20:35306987-35307009 AGGGAGAACAGGGGGTCCAGAGG + Intronic
1172917354 20:38452969-38452991 AGGGTGGACAGGCAGGCCACAGG - Intergenic
1173096285 20:40031787-40031809 AGGGAGAACAAGATGGTCTGGGG - Intergenic
1173331275 20:42078089-42078111 AGGGAGGCCAGCAGGCCCAGTGG + Exonic
1173643973 20:44622229-44622251 AGAGAGAACATGCTGGCCAGAGG + Intronic
1173950061 20:46985218-46985240 AGGGAGGAAAGAAGGGGCAGAGG - Intronic
1174201359 20:48808770-48808792 ACGGAGGCCGGAATGGCCAGGGG - Intronic
1174774466 20:53331429-53331451 AGGGAGCACAGCCGGGCCAGGGG + Intronic
1174815807 20:53686090-53686112 AGGGAGGAGAGTGTGGCCTGTGG + Intergenic
1174952328 20:55055895-55055917 AGGGAGGAAAGGAGGGAAAGAGG - Intergenic
1175483597 20:59328887-59328909 AGGGAGGACAGGACAGGGAGGGG - Intergenic
1176076223 20:63249541-63249563 AGCAAGGACAGTATGGCCAGGGG + Intronic
1176093387 20:63328817-63328839 AAGGAGGACAGGAGGGCGGGAGG - Intronic
1176242795 20:64082877-64082899 AGGATGGAAAGGAAGGCCAGAGG + Intronic
1176254371 20:64143276-64143298 AGGGAGGCGAGGATCCCCAGGGG - Intergenic
1176264045 20:64199352-64199374 AGGGAGGTAAGTCTGGCCAGGGG - Intronic
1176309380 21:5141711-5141733 AGGCAGGACAGGAGGGGCAGGGG + Intronic
1176624039 21:9075952-9075974 AGGGAGGATTGGAGGGACAGAGG + Intergenic
1176796509 21:13374236-13374258 AGGGAAAAGAGGGTGGCCAGTGG + Intergenic
1177638573 21:23817178-23817200 AGGGAGGAGAGGATGGGAGGAGG - Intergenic
1179450603 21:41465947-41465969 AGGGAGAGCAGGCTGGGCAGGGG + Exonic
1179471434 21:41613227-41613249 CGGGAGGCCAGGATGGCCACAGG + Intergenic
1179480444 21:41673351-41673373 CGGGAGGACAGCAGGGCCGGCGG + Intergenic
1179609961 21:42543834-42543856 AGGGAGGACAGGAGGACGGGAGG - Intronic
1179847681 21:44120322-44120344 AGGCAGGACAGGAGGGGCGGGGG - Intronic
1180051159 21:45331630-45331652 AGGGAGGCCAGGCTGGCTAAGGG + Intergenic
1180190279 21:46159604-46159626 AGAGGGGAGAGCATGGCCAGAGG - Intergenic
1181339386 22:22166000-22166022 AGGGAGGACAAAGTGGACAGAGG + Intergenic
1182146702 22:28001160-28001182 AGGCAGCAAAGAATGGCCAGGGG + Intronic
1182420131 22:30244967-30244989 AGGCAGGAAAGGGTGGCCTGGGG + Intronic
1182504546 22:30772438-30772460 AGGGAAGCCAGGCTGGCCCGTGG + Intronic
1182953690 22:34401003-34401025 AGGGAGAACAGGCTAGCCAGAGG - Intergenic
1184103375 22:42353416-42353438 AGGGAGGACAGGAAGGAGGGTGG + Intergenic
1184104021 22:42357113-42357135 AGGGATGACAGCCTGGACAGAGG + Intergenic
1184146808 22:42616503-42616525 GAGGAGGACAGGCTGGCCAGTGG + Intergenic
1184649871 22:45914866-45914888 AGGGGGGACAGGCTGGCCAATGG - Intergenic
1184661731 22:45968597-45968619 AGGGAGGACAGGAGGTCCTGGGG - Intronic
1184684640 22:46090599-46090621 AGACAGGGCAGGATGGGCAGAGG - Intronic
1185241555 22:49750046-49750068 AGGCAGGACAGGCAGGGCAGGGG + Intergenic
949439693 3:4067097-4067119 AAGGAGCTCAGAATGGCCAGAGG + Intronic
949453034 3:4208235-4208257 AGGTGGGACAGGATGGCTAGAGG - Intronic
949481514 3:4498415-4498437 AGGAAGGAGAAGAAGGCCAGGGG + Intronic
949639844 3:6023810-6023832 AGGGAGGCCAGGACAGCCCGTGG + Intergenic
949914707 3:8950453-8950475 AGATGGGACAGGATGGCTAGAGG - Intronic
949984031 3:9525015-9525037 AGGTGGGACAGCATGGCTAGAGG + Intronic
950310089 3:11949557-11949579 AGGGGGGACAGGGTACCCAGTGG + Intergenic
950448977 3:13055051-13055073 AGCCAGGACAGGAAGGCCGGCGG - Intronic
951264722 3:20552493-20552515 AGGAAGGCCAGGAGGGCCTGAGG - Intergenic
951595718 3:24316355-24316377 AGGAAGGAAAGGATGGAAAGAGG - Intronic
952269349 3:31817031-31817053 AGCAGGGAGAGGATGGCCAGAGG - Intronic
953670600 3:44959013-44959035 TTGGAGGATAGGAGGGCCAGGGG - Intronic
953729847 3:45437998-45438020 GGGGAGAGCAGGAGGGCCAGGGG + Intronic
954009468 3:47622677-47622699 AGGGAGGAAAGGATAGTGAGGGG - Intronic
954368639 3:50158870-50158892 AGGGAAGCTAGGATGGCCAGTGG - Intronic
954579674 3:51696490-51696512 AGGGAAGACAGGGTGACCATGGG - Intronic
955758251 3:62249298-62249320 AGGGCAGACAGGAGGGGCAGGGG + Intronic
955946919 3:64204236-64204258 TGGGAGGTCAGGATGGGGAGGGG + Intronic
956961750 3:74411015-74411037 AGGGAGGAAAGGATAGAGAGGGG - Intronic
960969457 3:123129343-123129365 TGGGAGGCCATGGTGGCCAGTGG + Intronic
961489745 3:127246597-127246619 TGGGAGGAAAAGATGGCTAGTGG + Intergenic
961629107 3:128283272-128283294 AGGGAGGACACTGTGTCCAGAGG + Intronic
961752820 3:129107364-129107386 AGGCAGGACTTGTTGGCCAGAGG - Intronic
961809496 3:129513778-129513800 AGGAAGGGCAGGAGGGCCTGGGG + Intronic
961830266 3:129619621-129619643 AGGGGGTACAGGAGGCCCAGGGG + Intergenic
961831069 3:129623315-129623337 AAGGAGAACAGGACGGCCACAGG + Intergenic
961918927 3:130405623-130405645 AGGGATTGCAGGATGTCCAGGGG + Exonic
962180205 3:133198551-133198573 AAGGAGGGCAGTTTGGCCAGGGG + Intronic
964273324 3:154982078-154982100 AGGAAGGACAGCATGCTCAGAGG + Intergenic
964427926 3:156572805-156572827 AGGGAGGAGAGCATGTGCAGGGG + Intergenic
965793094 3:172410936-172410958 AGGGAGGACTTGAAGGCTAGGGG - Intergenic
967076154 3:186004410-186004432 AGAGAGCACAGGATGACAAGTGG + Intergenic
968315161 3:197717887-197717909 AGGGAGGAGATGAAGGCCACTGG - Intronic
968616280 4:1579169-1579191 AGGGAGGGCAGGGGGGGCAGGGG - Intergenic
969255398 4:5998287-5998309 AGGAAGTACAAAATGGCCAGTGG - Intergenic
969469527 4:7379295-7379317 AGGGAGGGCAGGATCACCACTGG + Intronic
969682768 4:8652403-8652425 GGGGTGGCCAGCATGGCCAGTGG + Intergenic
969694002 4:8724758-8724780 AGGGAGGAGGGGCGGGCCAGCGG - Intergenic
969831000 4:9796822-9796844 CTGGAGGACAGGATCACCAGAGG + Intronic
969980585 4:11150125-11150147 AGGCAAGATAGGATGGCTAGAGG + Intergenic
971374662 4:26047289-26047311 AAGGAGGCCAGTGTGGCCAGAGG + Intergenic
972351942 4:38244228-38244250 AGGGAGGGCAGGAGGGCAGGAGG - Intergenic
972924166 4:43983625-43983647 AGGGAGGAAGGGAGGGACAGAGG + Intergenic
972933855 4:44106986-44107008 AGGTGGGAGAGGATGGCTAGTGG + Intergenic
973812281 4:54583204-54583226 AGGAAGTACAGGAAGGCAAGTGG + Intergenic
974062406 4:57047261-57047283 AGGCAGGACAGCATGTGCAGGGG - Intronic
975733494 4:77359632-77359654 AGGAAGGACAGGATGGCTGTGGG - Intronic
976011499 4:80494569-80494591 AAGGAGGCTAGGGTGGCCAGAGG - Intronic
976555261 4:86443473-86443495 AGGTGGGACAGGATAGCTAGAGG - Intronic
977389951 4:96395576-96395598 AGGGAGGAGAGGATTGGGAGAGG - Intergenic
977878512 4:102177483-102177505 AGTGAGGACAGGAAGGTGAGGGG - Intergenic
978018275 4:103776120-103776142 TGGGAGAACTGGATGGCTAGAGG + Intergenic
978153831 4:105467377-105467399 AAGGAGGCCAGGATGGCAGGAGG + Intronic
978728565 4:111999029-111999051 AAGGAGGAAAGGATGGTGAGAGG + Intergenic
979014748 4:115419121-115419143 TGGTAGGAGGGGATGGCCAGCGG - Intergenic
979038988 4:115762866-115762888 AGGTGCAACAGGATGGCCAGAGG - Intergenic
980482507 4:133405204-133405226 ATGGAGCTCTGGATGGCCAGGGG + Intergenic
981488261 4:145311469-145311491 AGGTGGAACAGGATGGCTAGAGG + Intergenic
982161310 4:152572705-152572727 AGGGAAGACAGGATGGCTAATGG + Intergenic
982702568 4:158672466-158672488 AGGCAGGACAGCTTGGCTAGCGG - Exonic
982834080 4:160101008-160101030 ATGGAGAACAGGATTGCCAGTGG - Intergenic
983256199 4:165403743-165403765 CAGGAGGCCAGGGTGGCCAGGGG - Intronic
983352159 4:166603450-166603472 AGGAAGGACAGAATGGCTAGAGG - Intergenic
984184703 4:176529743-176529765 AGGGAGGAGAGGATGAAGAGAGG - Intergenic
984432393 4:179665372-179665394 AGGTAGGGGAGGATGGCAAGCGG - Intergenic
985485653 5:146733-146755 AGGGAGGACTGTAGGGCCAGGGG - Intronic
985846937 5:2356831-2356853 ATGGAGGTGAGGATGGGCAGTGG + Intergenic
986010178 5:3706955-3706977 AGGGAGGACAGGAGGGTGAGAGG - Intergenic
986094917 5:4545027-4545049 AAGGAAGACAGGGTGGGCAGAGG - Intergenic
986642668 5:9887931-9887953 AGGCAGGACAGCAGGGCCACAGG + Intergenic
986709645 5:10479516-10479538 AGTGAGAACAGGGTGGGCAGAGG + Intergenic
988124158 5:27007323-27007345 AGGGAGGGGAGGATGGCAATGGG + Intronic
988443612 5:31259871-31259893 GGGGAGCACAGGAAGGACAGTGG + Intronic
988558588 5:32260163-32260185 AGGGAGGTCAGTATGGCCAGAGG + Intronic
988586509 5:32511937-32511959 AGGGGAGACAGGAAGGCCACAGG - Intergenic
989182712 5:38594543-38594565 GGGGTGGACAGGGTGGGCAGGGG + Intronic
991129842 5:63109949-63109971 CTGGAGAACAGGAAGGCCAGTGG - Intergenic
991542530 5:67745735-67745757 AGGTAAGACAGGGTGGCCAGAGG - Intergenic
991622275 5:68557124-68557146 AGGGAGGAAAGGAGGGCAAAAGG + Intergenic
992033385 5:72746761-72746783 AGGTGGGACAGGATGGCTAGAGG - Intergenic
992811110 5:80389623-80389645 AGGGACGACAGGACGGCCAGGGG + Intergenic
994593828 5:101806640-101806662 AGTGGGGACAGGCTGGGCAGAGG - Intergenic
994601216 5:101907831-101907853 ATGGAGTTCTGGATGGCCAGGGG - Intergenic
994761904 5:103864957-103864979 AGTGAGGGAAGGATGTCCAGTGG - Intergenic
995502481 5:112822964-112822986 AGGAAGGAAAGCATGGCCAGAGG - Intronic
996627697 5:125589425-125589447 AGGCAAGACAGGATGTGCAGGGG + Intergenic
997295679 5:132766869-132766891 TGGGAGGGAAGGATGGCCAGAGG - Intronic
997873175 5:137523105-137523127 ATGTAGGACAGGATGGTTAGAGG - Intronic
999053897 5:148553236-148553258 AAGGAGGACTGGATGGCCTGTGG + Intronic
1000462268 5:161537470-161537492 AGGGAAGACAGGAAGGGGAGTGG - Intronic
1000615568 5:163422133-163422155 AGAGATGGCAGGATGGCAAGAGG + Intergenic
1000641851 5:163712268-163712290 AGGGAGGCCAGTGTGGCTAGAGG + Intergenic
1000677905 5:164144882-164144904 AGGCTGGAAAGGATGGGCAGCGG + Intergenic
1001279834 5:170378798-170378820 AGGGAGAAGAGGAGGGCCTGGGG + Exonic
1001408704 5:171495287-171495309 AGGAAGGAAAGGAGGGACAGAGG + Intergenic
1001969161 5:175939706-175939728 AGGGAGTACCAGAAGGCCAGTGG - Intronic
1001971605 5:175959698-175959720 AGAGAAGACAGGAGGTCCAGAGG + Exonic
1002201758 5:177532710-177532732 AGGGCGGTCAGGATGGCAGGTGG - Intronic
1002245836 5:177884079-177884101 AGAGAAGACAGGAGGTCCAGAGG - Intergenic
1002248279 5:177904037-177904059 AGGGAGTACCAGAAGGCCAGTGG + Intergenic
1002641533 5:180632900-180632922 AGGGAGGGCTGCATGGCCAGAGG + Intronic
1002879553 6:1238761-1238783 AGGGAGGAGATGGTGCCCAGGGG - Intergenic
1003005604 6:2378193-2378215 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1003038320 6:2664327-2664349 AGGGATGACAGGACGGCCAGGGG + Exonic
1003169618 6:3710818-3710840 AGAGAGCACAGGATGCCCACGGG + Intergenic
1003369358 6:5509627-5509649 ATGGAGAAAAGGATGTCCAGAGG + Intronic
1003513113 6:6797834-6797856 AGGGAGAGCAGGAAGGCCAGGGG - Intergenic
1004691846 6:17998948-17998970 AGGGAGAAAAGGATGGGCAGTGG - Intergenic
1004896865 6:20156431-20156453 AGGGAATCCTGGATGGCCAGCGG + Intronic
1005727857 6:28667356-28667378 ATGCAGGACAAGATGGCCTGAGG + Intergenic
1005943324 6:30577718-30577740 AGGGTGGAGTGGAGGGCCAGTGG + Intronic
1006108790 6:31732180-31732202 CGGGAGGAGAGGATGACCACTGG - Intronic
1006113602 6:31763437-31763459 AGAGAGAACAGGATGCCCTGTGG + Exonic
1006225885 6:32535658-32535680 GGGGAGGAATGGATGGCCATGGG - Intergenic
1006349693 6:33512212-33512234 TGGGAGGACAGGATGGAATGAGG + Intergenic
1006443742 6:34067569-34067591 AGGGAGGAAAGGAGGGAGAGAGG - Intronic
1007440925 6:41859343-41859365 AGGAAGGAATGGATAGCCAGGGG - Intronic
1007557142 6:42775622-42775644 GGGTAAGACAGGAAGGCCAGTGG + Intronic
1007625500 6:43243982-43244004 AGGGATGACAGGAGAGCCAGGGG - Intronic
1008270774 6:49486844-49486866 AGGTGTGACAGGATGGCCATGGG + Intronic
1008814296 6:55544880-55544902 AGGGATGAGAGGAAGGCCTGGGG + Intronic
1010144462 6:72650895-72650917 ATGGAGGAGAGGATGGTCAGAGG + Intronic
1010497120 6:76548200-76548222 AAGTGGGACAGGATGGCTAGAGG + Intergenic
1011654604 6:89539759-89539781 AGGGAGGTGAGGATGGCTAATGG - Intronic
1011656278 6:89555010-89555032 AGGGAGGAGAGGATAGAGAGAGG - Intronic
1011814581 6:91173493-91173515 AGGGAGGACAGAATAACCAGGGG + Intergenic
1012174427 6:96062620-96062642 AGGGAGGATAGGATGGAGAGAGG + Intronic
1012267531 6:97164157-97164179 AAGGAGGACAGGATTGCCAAAGG + Intronic
1012300726 6:97584733-97584755 AGGGAGGACAAGATGGAGGGAGG - Intergenic
1014190806 6:118494564-118494586 AGGCGGGACAGGATGGCAGGAGG - Intronic
1014561862 6:122900923-122900945 AGGGAGGAAAGGAAGGAGAGAGG - Intergenic
1014802457 6:125791340-125791362 GGGGAGGACAGGTTGGCATGGGG + Intronic
1015328483 6:131950997-131951019 AGGGAGGACAGGGCGGTCAGCGG + Intronic
1015933845 6:138388599-138388621 AGGTGGGACAGGATGTCGAGAGG - Intergenic
1018039769 6:159911529-159911551 AAGGGGGACAGGGTGACCAGCGG - Exonic
1018388811 6:163327766-163327788 GGGGTGGACAGGGTGGGCAGAGG + Intergenic
1018452204 6:163919508-163919530 AGGGAGGGGAGGAGGGGCAGCGG + Intergenic
1018726750 6:166618514-166618536 AGGGAGGTCAGCGTGGGCAGGGG + Intronic
1018904428 6:168066878-168066900 TGGGAAGACAGGACAGCCAGCGG - Intronic
1019629969 7:2043782-2043804 TGGGAGGAGAGAATGGGCAGAGG - Intronic
1019739122 7:2664092-2664114 TGGGAGGACAGGGTGGCCCTGGG + Exonic
1020587978 7:10095592-10095614 AGATGGGACAGGATGGCTAGAGG + Intergenic
1020761281 7:12270211-12270233 AGAGATGACAGGACGACCAGCGG + Intergenic
1022522168 7:31015372-31015394 CAGGAGCACAGGATGGCCAAGGG + Intergenic
1023259474 7:38344395-38344417 AGGGAGGAAAGGATGGATGGAGG + Intergenic
1023259932 7:38348720-38348742 AGGGAGGAAAGGATGGATGGAGG + Intergenic
1023260915 7:38357879-38357901 AGGGAGGAAAGGATGGATGGAGG + Intergenic
1023548486 7:41343972-41343994 AGGGAGGATAGCATGAGCAGAGG + Intergenic
1024281387 7:47722330-47722352 AGTGAGGACAGCATGGCCGGAGG - Intronic
1025777107 7:64569453-64569475 AGGGCGGAGAGGAGGGCCAGGGG + Intergenic
1026961497 7:74410951-74410973 AGGGAGGAAAGGAAGGAGAGAGG + Intergenic
1027812808 7:82926889-82926911 AGGGAGGGAAGGATGGAAAGAGG - Intronic
1027815079 7:82958373-82958395 AGGGAGGGAAGGATGGGGAGAGG - Intronic
1027913896 7:84289219-84289241 CGGGAGGACAGGATAGGGAGTGG + Intronic
1028364839 7:90015876-90015898 AGGAAGGGCAGGAGGGCCGGGGG + Intergenic
1029187249 7:98748122-98748144 AGGGAGGAAAGGAAGGAGAGAGG + Intergenic
1029195532 7:98802740-98802762 ATGGAGGCCAGGAAGGCAAGAGG + Intergenic
1029300584 7:99579920-99579942 GAGGAGGACAGGCTGGCCTGTGG + Intronic
1029487919 7:100854418-100854440 TGGGAGGACATGATGGGGAGGGG + Intronic
1029547092 7:101216334-101216356 AGGAAGGGGAGGATGGGCAGGGG + Intronic
1029568795 7:101357704-101357726 AGGGAGGGAAGGAGGGCGAGAGG + Intergenic
1030387313 7:108880058-108880080 AGGGGGGAGTGGATGGTCAGTGG - Intergenic
1031831654 7:126634649-126634671 AAGGAAGGCAGGAAGGCCAGGGG - Intronic
1032089991 7:128906695-128906717 AGGGAGAATAGGCAGGCCAGGGG + Intronic
1032833030 7:135648002-135648024 AGGGAGGACAGGAGGGTAGGTGG - Intronic
1033286976 7:140049648-140049670 AGGAAGGACATGGGGGCCAGGGG + Intronic
1033359276 7:140626627-140626649 GAGGAGGACAGGAAGGCAAGAGG - Intronic
1033503658 7:141978452-141978474 AGGGAGATCAGGATCACCAGGGG + Intronic
1034225432 7:149477504-149477526 AGGGATCACAGGAGGGACAGGGG - Intronic
1034278995 7:149838634-149838656 AGGTAGGACTGGAAGGCCCGGGG + Exonic
1034438667 7:151075810-151075832 AAGTAGACCAGGATGGCCAGAGG - Intronic
1034442696 7:151094846-151094868 AGGGAGGAAGGGAGGGACAGAGG - Intronic
1034904211 7:154929689-154929711 AGGGAGGGCTGGTGGGCCAGAGG - Intronic
1035022426 7:155807465-155807487 AGGGGAGACAGGAAGGCCTGAGG + Intronic
1035626023 8:1071162-1071184 GGGGAGGAGAGGATGGTGAGTGG + Intergenic
1036765632 8:11547831-11547853 ACGGAGGACAGGATGGGCTCTGG + Intronic
1037017404 8:13925625-13925647 AGGTAAGACAGGATGGCTAGAGG + Intergenic
1037287987 8:17321248-17321270 AGAGAGGAATGGATGGCCACAGG + Intronic
1037553992 8:20004479-20004501 AGGGAGGGCCTGAAGGCCAGGGG - Intergenic
1037573618 8:20179928-20179950 AGGAAGGGCAGGGTGGTCAGAGG + Intronic
1037776245 8:21837818-21837840 AGGCAGGATAGGGTGGGCAGAGG - Intergenic
1037836862 8:22219788-22219810 CGGGGGGACATGAGGGCCAGGGG + Exonic
1038279402 8:26150099-26150121 AGGAGGAACAGGATGGCTAGAGG + Intergenic
1038581628 8:28753311-28753333 AGCCAGGACAAGGTGGCCAGGGG - Exonic
1038775509 8:30527295-30527317 AGGGACGAGAGGAAGGCCTGGGG - Intronic
1039527788 8:38231820-38231842 AGGGAGGGCAGGAGAGCCTGAGG + Exonic
1040500846 8:48003802-48003824 AGGGAGGACAGGATGTTGAAAGG + Intergenic
1041381607 8:57258872-57258894 AGGGAGGACCGCAGGGCCAGAGG + Intergenic
1041820290 8:62024391-62024413 AGGGATGACAAGATGGCGAAAGG - Intergenic
1041853930 8:62427074-62427096 AGGGAGCTCAAGATGGCCAATGG + Intronic
1042061216 8:64820106-64820128 AGGCAGGACAGGTTTGCCATCGG - Intergenic
1042379806 8:68100620-68100642 AAGAAGGCCAGGGTGGCCAGAGG + Intronic
1042700445 8:71606711-71606733 AGAGAAGACAGGCTGGCAAGTGG - Intergenic
1042959006 8:74282665-74282687 AGGGAGATGAGGATAGCCAGAGG + Intronic
1043379121 8:79684012-79684034 AGGGAGGGCAGCATGAGCAGAGG - Intergenic
1044250773 8:90001770-90001792 AGCGAGGACAGGGTGTCCCGGGG + Intronic
1045990945 8:108307103-108307125 GGGGAGGATAGGATGGAGAGAGG - Intronic
1046113177 8:109751569-109751591 AGAGAGGAAAGGATGGGAAGAGG - Intergenic
1047416830 8:124671379-124671401 AGGGAGGACAGTCTAGCAAGAGG - Intronic
1047502764 8:125454670-125454692 AGGGGGAAGAGCATGGCCAGAGG + Intergenic
1047749698 8:127870993-127871015 AGGGAGGGCAGGAAGTTCAGAGG + Intergenic
1049285149 8:141770736-141770758 AGGGAGGGCAGGCTGGACGGAGG - Intergenic
1049291868 8:141807610-141807632 ATGGAGAACAGTATGGCCTGGGG - Intergenic
1049388666 8:142357135-142357157 AAGAAGGACAGGAGGGCCAGGGG + Intronic
1049392870 8:142381159-142381181 AGGGTGGGCAGGATTCCCAGGGG - Intronic
1049425859 8:142537603-142537625 GGTGAAGGCAGGATGGCCAGGGG - Intronic
1049813581 8:144587528-144587550 ACGGAGCACAGGATAGTCAGAGG + Intronic
1050308173 9:4327257-4327279 AGGGAGGTGGGCATGGCCAGAGG + Intronic
1050843060 9:10177535-10177557 AGGCGGGACAGGAAGACCAGAGG + Intronic
1051438942 9:17062407-17062429 TGGGAGGTTGGGATGGCCAGGGG + Intergenic
1052670144 9:31546683-31546705 AGGCTGGAAAGGATGGGCAGGGG - Intergenic
1052982938 9:34461983-34462005 AGGTAGGACTGGGTTGCCAGGGG + Intronic
1052998831 9:34566135-34566157 TGGGAGGAGGGGGTGGCCAGTGG - Intronic
1053435482 9:38070861-38070883 AGGGCAGACAGCAAGGCCAGGGG + Intergenic
1053556086 9:39138387-39138409 CTTGGGGACAGGATGGCCAGAGG + Intronic
1053820205 9:41958640-41958662 ACATGGGACAGGATGGCCAGAGG + Intronic
1054110479 9:61102339-61102361 ACATGGGACAGGATGGCCAGAGG + Intergenic
1054610378 9:67228786-67228808 ACATGGGACAGGATGGCCAGAGG - Intergenic
1055449171 9:76415411-76415433 AGGTGGGACAGGATGGCTAGTGG + Intergenic
1055631767 9:78231934-78231956 AGAGCGGACAGCATGGACAGTGG + Intergenic
1056006865 9:82281701-82281723 AGGTAGGACAGGTTGGGCTGGGG + Intergenic
1056325953 9:85479282-85479304 AGGGAGGGGAGGATGGGCACAGG - Intergenic
1056753527 9:89368293-89368315 ATGGAAGACATGATGGCCAGCGG - Intronic
1057759224 9:97859320-97859342 AGAGAGGGCAGGGTGGCAAGGGG + Intergenic
1059434084 9:114266079-114266101 AGAGAGGACAGAATCTCCAGGGG + Intronic
1059506081 9:114801065-114801087 GGGAAGGACAGGTTGGGCAGTGG + Intronic
1060221373 9:121765780-121765802 TGGCAGGCCAGGATGCCCAGTGG + Intronic
1060431203 9:123552607-123552629 AGGGAGCACAGGTGAGCCAGAGG + Intronic
1060478219 9:124000420-124000442 AGGGAGGACCTGGTGGCAAGTGG + Intergenic
1060806910 9:126583488-126583510 AGGGAGATCTGGCTGGCCAGAGG - Intergenic
1060915499 9:127387117-127387139 AGTGATGGCAGGAGGGCCAGTGG + Intronic
1060946240 9:127570736-127570758 AGTGGGGACAGCATGGGCAGGGG + Intronic
1060975272 9:127761590-127761612 AGGTAGGAGGGGCTGGCCAGGGG - Exonic
1061133940 9:128722890-128722912 AGGGAGGAAGGAATGGACAGGGG + Intronic
1061194866 9:129102228-129102250 AGGGAGGCCAGGAGGGGCCGTGG - Intronic
1061200653 9:129136656-129136678 AGGGAGCGCAGGAGGGGCAGGGG - Intronic
1061368074 9:130182816-130182838 GGGCAGGGCAGGATGGCCAGGGG - Intronic
1061509258 9:131050395-131050417 AAGGTGGACATGCTGGCCAGAGG - Intronic
1061868112 9:133505887-133505909 AGGTAGGAGAGGAGGGGCAGAGG - Intergenic
1061896725 9:133652164-133652186 AGGGAGGACACAGTGGCCGGGGG + Intronic
1061941596 9:133887016-133887038 AGGGAGAGCAGGAGGGCCCGGGG - Intronic
1062247376 9:135576143-135576165 GGGGAGGAGAGTGTGGCCAGAGG - Intergenic
1062607087 9:137353244-137353266 TTGGAGGCCAGGAGGGCCAGTGG - Intronic
1062647614 9:137556940-137556962 AGGGAGGAAACGTTGGCCTGTGG - Intronic
1062710633 9:137973335-137973357 AGGTAGGACAGGCTTGCCAGAGG + Intronic
1203562882 Un_KI270744v1:73100-73122 AGGGAGGATTGGAGGGACAGAGG - Intergenic
1185478462 X:429057-429079 AGGGAGGAAAGGAGGGACGGAGG - Intergenic
1186145773 X:6622074-6622096 AGGGAGGGAAGGATGGAAAGAGG + Intergenic
1186514186 X:10153973-10153995 AGGGTGGAGGGGATGGTCAGAGG + Intergenic
1186767724 X:12788909-12788931 ATGGAGGAGAGAAGGGCCAGGGG + Intergenic
1188062903 X:25622610-25622632 CAGGAGGAAAGGATGGCCAATGG - Intergenic
1188572847 X:31610070-31610092 AGGGAGAACAGGAAGGACAGAGG - Intronic
1188966986 X:36566374-36566396 AGAGAGGACAAGAAGGCAAGAGG + Intergenic
1189116805 X:38351368-38351390 AGGAAGGAGAGGAGGGGCAGGGG - Intronic
1190739540 X:53280176-53280198 AGGGAGGACGGGAGGGGAAGGGG + Intronic
1190935235 X:54993814-54993836 AGGTAGGAGTGGATGGCAAGGGG + Intronic
1191095678 X:56670913-56670935 AGAGAAGACAGGATGGCAGGAGG + Intergenic
1192269707 X:69567151-69567173 AGGGTGGACGGGATGGCCCAAGG + Intergenic
1192508313 X:71704806-71704828 AGGGAAGACAGCATGTGCAGGGG - Intergenic
1192518383 X:71776747-71776769 AGGGAAGACAGCATGTGCAGGGG + Intergenic
1194108281 X:89798790-89798812 AGGATGTACAGGATAGCCAGAGG + Intergenic
1196173860 X:112618904-112618926 AGGGAGGCAAGGAAGGTCAGAGG - Intergenic
1196797733 X:119515657-119515679 AGGGAAGAGGGGATGGCCATCGG + Intergenic
1196812069 X:119636764-119636786 AGGGAAGGGAGGATGCCCAGAGG - Intronic
1197145275 X:123165584-123165606 AGTGGGGACAAGATGGCTAGAGG + Intergenic
1198749697 X:139926490-139926512 AGGAGGTAAAGGATGGCCAGTGG - Intronic
1199396171 X:147341204-147341226 AGGGAGGAAAGGAAGGAGAGAGG - Intergenic
1199665955 X:150096635-150096657 AGGGAGAACAGGATGGTGAAGGG - Intergenic
1199778576 X:151037560-151037582 GGGAAGGACAGGAAGCCCAGTGG + Intergenic
1200278679 X:154758186-154758208 AGGGGTGACAGGATGGCTGGAGG - Intergenic
1200460944 Y:3453526-3453548 AGGATGTACAGGATAGCCAGAGG + Intergenic
1201160543 Y:11161375-11161397 AGGGAGGATTGGAGGGACAGAGG + Intergenic
1201741210 Y:17326069-17326091 AGGGAGGAAAGGAAGGAGAGAGG + Intergenic
1202016694 Y:20414946-20414968 AGGGAAGAGTGGATGGCTAGTGG - Intergenic