ID: 904931044

View in Genome Browser
Species Human (GRCh38)
Location 1:34087759-34087781
Sequence CAAAGCCACCGCCTTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904931044_904931046 8 Left 904931044 1:34087759-34087781 CCTCCATGAAGGCGGTGGCTTTG 0: 1
1: 0
2: 0
3: 19
4: 210
Right 904931046 1:34087790-34087812 ACTGCTATTCCCCAGCATCTAGG 0: 1
1: 0
2: 0
3: 14
4: 203
904931044_904931050 29 Left 904931044 1:34087759-34087781 CCTCCATGAAGGCGGTGGCTTTG 0: 1
1: 0
2: 0
3: 19
4: 210
Right 904931050 1:34087811-34087833 GGCCAGTGTCAAGACATAATAGG 0: 1
1: 0
2: 1
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904931044 Original CRISPR CAAAGCCACCGCCTTCATGG AGG (reversed) Intronic
901754565 1:11433706-11433728 CAAAGTCCCTGCCTGCATGGAGG - Intergenic
902725925 1:18335893-18335915 CAATGCCACCTCCTGCATTGTGG - Intronic
904592713 1:31623984-31624006 CAAAGTCCCTGCCTTCATGGAGG + Intronic
904931044 1:34087759-34087781 CAAAGCCACCGCCTTCATGGAGG - Intronic
905755560 1:40506300-40506322 CAAAGTCACCTCTTACATGGTGG - Intergenic
907296030 1:53455170-53455192 GACAGCCACAGCCATCATGGAGG + Intergenic
907474329 1:54695466-54695488 CACGGCCACCGCCTTCTTCGTGG + Exonic
910763449 1:90757739-90757761 CAAAGGCACCCCTTACATGGCGG - Intergenic
911236488 1:95417881-95417903 CAAAGGCACCTCTTACATGGTGG + Intergenic
911680115 1:100705361-100705383 AAAAGACTCCCCCTTCATGGTGG - Intergenic
911991558 1:104704638-104704660 CAAAGTCACCTCTTACATGGCGG + Intergenic
912265647 1:108154546-108154568 CCACGCCCCTGCCTTCATGGAGG + Intronic
913967435 1:143388705-143388727 TAAAAACACCGCCTTCATGTGGG - Intergenic
914061810 1:144214299-144214321 TAAAAACACCGCCTTCATGTGGG - Intergenic
914117340 1:144752055-144752077 TAAAAACACCGCCTTCATGTGGG + Intergenic
915128897 1:153683749-153683771 CAAAGCCAGCACCTCCAGGGTGG - Exonic
915131299 1:153697423-153697445 CAGCTCCACCGCCCTCATGGGGG + Intergenic
915536521 1:156539468-156539490 CAAAACCACCAAGTTCATGGAGG - Exonic
916744611 1:167675337-167675359 CAAAGACACGGCCTACATGGCGG + Intronic
924640630 1:245830317-245830339 CAAAGGCACGTCCTACATGGCGG + Intronic
1067458411 10:46439947-46439969 CAAAGTCACATCCTACATGGTGG + Intergenic
1067628785 10:47944687-47944709 CAAAGTCACATCCTACATGGTGG - Intergenic
1071642373 10:87324555-87324577 AAAAGCCACTGCCTTGATGTTGG + Intergenic
1073880679 10:107976078-107976100 AAAAGGCACTTCCTTCATGGTGG + Intergenic
1074576575 10:114675449-114675471 CAAAGTCACCTCTTACATGGAGG - Intronic
1075394264 10:122115238-122115260 CACAGCCCCCACCTTCAAGGAGG + Intronic
1077748726 11:4938980-4939002 TAAAGCCATCTACTTCATGGTGG + Intronic
1077751716 11:4978102-4978124 CAAAGGCACATCCTACATGGTGG - Intronic
1077917760 11:6622312-6622334 CACTGCCACAGCCTTCCTGGGGG - Exonic
1078548048 11:12260547-12260569 CAAAGCCACTGCCTGCAAAGTGG + Intronic
1079538753 11:21546614-21546636 CAAAGGCACCTCTTACATGGCGG - Intronic
1080848389 11:36046260-36046282 CAAAGCCACGTCTTGCATGGCGG - Intronic
1082638640 11:55627693-55627715 CAAAGCCACGTCTTACATGGTGG - Intergenic
1086730767 11:90246340-90246362 CAAAGTCACCGCTTACATGATGG + Intergenic
1087591725 11:100197623-100197645 CAGAGCCACAGTCTTAATGGAGG + Intronic
1087714503 11:101592949-101592971 CAAAGCCACATCTTGCATGGAGG - Intronic
1089864989 11:121623980-121624002 CAAAGCCACATCTTACATGGCGG + Intronic
1091106737 11:132927370-132927392 AAAATCCACCGCCTTCTGGGAGG - Intronic
1098648655 12:72938453-72938475 CAAAGTCACCCCTTACATGGAGG + Intergenic
1099073990 12:78082137-78082159 CAAAGCCACATCTTACATGGTGG - Intronic
1099441093 12:82700906-82700928 CAAAGGCACGGCTTACATGGAGG + Intronic
1101735673 12:107461075-107461097 CAAAGGCACGTCCTACATGGTGG + Intronic
1103472273 12:121191399-121191421 CAAAGCCACATCTTACATGGTGG - Intergenic
1104438834 12:128778601-128778623 CAAAGGCACATCTTTCATGGTGG + Intergenic
1104566994 12:129894190-129894212 CAAAGGCACAGCCTGCATGGTGG + Intronic
1104772195 12:131370302-131370324 GAAAGTCACCTCCTTCGTGGGGG - Intergenic
1109286971 13:60421274-60421296 CAAAGGCACATCCTACATGGTGG + Intronic
1112963391 13:105156936-105156958 CAAAGCCACGTCTTACATGGCGG + Intergenic
1113333250 13:109352540-109352562 CAAAGCCACATCTTACATGGGGG - Intergenic
1113432093 13:110260221-110260243 CAAAGCCACATCTTACATGGCGG + Intronic
1113569698 13:111345151-111345173 CAAGGCCACGTCCTTCCTGGAGG - Intergenic
1114568087 14:23647084-23647106 CACAGACACTGCCTTCAGGGAGG - Intergenic
1115009223 14:28523475-28523497 CAAAGGCACATCTTTCATGGTGG - Intergenic
1115398035 14:32932255-32932277 GAAAGGCACCGCCTGCATTGGGG + Intergenic
1121285809 14:92734962-92734984 CAAAGCCTGTGTCTTCATGGAGG + Intronic
1121814764 14:96920702-96920724 CAGATCCACCGCCTCCAGGGAGG - Intronic
1124433359 15:29626427-29626449 CAAAGTCACATCCTACATGGAGG - Intergenic
1124478432 15:30057490-30057512 CAAAGCCACTATCGTCATGGTGG + Intergenic
1127827546 15:62718313-62718335 CAAAGCCACTGCCCACATGTGGG + Intronic
1128496123 15:68199610-68199632 AAAAGCCACCGACCTCATGGTGG - Exonic
1129469252 15:75741346-75741368 CAAAGCCACACCCTCCCTGGGGG + Intergenic
1131685621 15:94764421-94764443 CAAAGCCACGTCTTACATGGTGG - Intergenic
1132368498 15:101276503-101276525 CAAAACCACCGCTTTCATTTCGG + Intronic
1132945501 16:2529688-2529710 CCCAGCCACCGCCTCCAGGGCGG - Intronic
1133659693 16:7904247-7904269 CAAAGCCATGCCCTACATGGTGG - Intergenic
1133968259 16:10547328-10547350 CAAAGCCACATCTTACATGGTGG - Intronic
1134233813 16:12450090-12450112 CAAAGCCACCTCTTACATGGTGG - Intronic
1134372212 16:13636117-13636139 CAAAGTCACGTCTTTCATGGTGG - Intergenic
1135396153 16:22133028-22133050 CACAGCCGCCGCCTACAAGGAGG + Exonic
1136054106 16:27675210-27675232 CAAAGTCACAGCTTACATGGTGG + Intronic
1139225300 16:65228775-65228797 CAAAGCAACCTCATTCATAGTGG + Intergenic
1140602380 16:76492734-76492756 CAAAGCCACATCTTACATGGTGG - Intronic
1141785692 16:86198966-86198988 CAGGGCCACCGGCTTCATGGTGG + Intergenic
1142405120 16:89884258-89884280 CAAGGCCCCCGTCTTCAGGGTGG + Intronic
1145407833 17:22622842-22622864 AAAAGCCACTGCCTTGATGTTGG + Intergenic
1151339888 17:73464365-73464387 CAAAGCCACATCTTACATGGTGG - Intronic
1151519938 17:74620730-74620752 CAAAGCCACCTCCAAAATGGAGG + Intronic
1154018089 18:10637964-10637986 CACAGCCACCACCTGCATCGAGG - Intergenic
1154087531 18:11322100-11322122 CAAAGTCACCTCTTACATGGTGG + Intergenic
1154186780 18:12191618-12191640 CACAGCCACCACCTGCATCGAGG + Intergenic
1156117327 18:33801854-33801876 CAAAGGCACGTCTTTCATGGTGG + Intergenic
1156189564 18:34702541-34702563 CAAAGCAAACGCCTTCCTGTGGG - Intronic
1156892492 18:42205771-42205793 AAAAGCCACCTCTTACATGGTGG - Intergenic
1157578822 18:48761491-48761513 CAAGCTCACCACCTTCATGGAGG + Exonic
1160694110 19:474336-474358 CAAAGCCACAGCGATCATGCGGG - Intronic
1161273347 19:3402527-3402549 CAAAGCCTCTGCCCTCAAGGAGG + Intronic
1162340143 19:10086978-10087000 CAGAGCCCCCGCCTTCTTGGAGG - Exonic
1163677049 19:18660484-18660506 CAGGGCCACCGCCTTCCTGGGGG + Intronic
1166197147 19:41214596-41214618 CAAAGCAACCTCCTCCATTGGGG + Intergenic
1166534135 19:43561419-43561441 CAAAGCCCCTGCCCTCAGGGAGG - Intronic
1166778087 19:45324365-45324387 CAAAACCCCCGCCGTCCTGGAGG + Intergenic
1166817258 19:45553777-45553799 CGAAGCCACCATCTTCATCGTGG - Intronic
1167617444 19:50543204-50543226 CAAAGTCCCTGCCTTCATGCAGG + Intronic
1202701221 1_KI270712v1_random:166173-166195 TAAAAACACCGCCTTCATGTGGG - Intergenic
924965919 2:76480-76502 CAAAGGCACCTCTTACATGGTGG + Intergenic
925117874 2:1395852-1395874 CAAAGGCACCTCTTACATGGCGG - Intronic
925261464 2:2531968-2531990 CAAAGGCACCTCTTACATGGTGG - Intergenic
925333101 2:3074110-3074132 CAATGCCACCTCCTTCAAGGAGG - Intergenic
925333114 2:3074190-3074212 CAACGCCACTTCCTTCAAGGAGG - Intergenic
925458996 2:4043742-4043764 CAAAGGCACCTCTTACATGGTGG - Intergenic
925689779 2:6509944-6509966 CAAAGGCACCTCTTACATGGTGG - Intergenic
926080058 2:9977958-9977980 GAAAGCCACGTCCTCCATGGCGG + Intronic
928327526 2:30331714-30331736 CAAAGACACCTCTTACATGGCGG - Intergenic
929054848 2:37867682-37867704 CAAAGTCATCCCCTTCATTGAGG - Intergenic
930174514 2:48288176-48288198 GAAAGCCACTTCCTGCATGGTGG + Intergenic
930318962 2:49830479-49830501 CAAAGACACTGCCTTCACTGTGG - Intergenic
931048149 2:58380481-58380503 CAATGCCACCGCTTCCATTGAGG + Intergenic
931567466 2:63629563-63629585 GAAAGCCACCTCCCTCCTGGTGG + Intronic
932623808 2:73283231-73283253 CAGAGCCCCAGCCTTCTTGGGGG - Intronic
932825398 2:74934419-74934441 CAAAGCCTCCTCCTTCATCTGGG + Intergenic
933125319 2:78597386-78597408 CAAAGCCACATCTTACATGGTGG - Intergenic
933781556 2:85805836-85805858 CAAAGCCACTTCCTACATGGTGG + Intergenic
934282450 2:91623962-91623984 TAAAAACACCGCCTTCATGTGGG - Intergenic
934637944 2:96008218-96008240 CCAACCCACCGCCTTCCTGAGGG - Intergenic
935724195 2:106008664-106008686 CAAAGGCACATCTTTCATGGTGG - Intergenic
936874067 2:117167292-117167314 CAAAGGCACCTCTTACATGGTGG - Intergenic
945139152 2:206665684-206665706 CAATGGCACTGCCTTCATGGAGG + Intronic
946732369 2:222721768-222721790 CAAAGTCACAGCTTACATGGCGG + Intergenic
946852207 2:223918750-223918772 CACAGCCACCGCCTTCCTCTCGG - Intronic
948385641 2:237578853-237578875 CAAAGCCCCTGCCTTCCTGGGGG - Intronic
948899353 2:240948295-240948317 CACCGCCACCCCCTTCATCGGGG - Intronic
948908105 2:240989420-240989442 CTAAGCCACAGCCTCCAGGGTGG - Intronic
1168856618 20:1013451-1013473 CTCAGCCACCTCCTTCCTGGAGG + Intergenic
1169068791 20:2709316-2709338 CAAAGGCACCTCGTTCCTGGAGG - Intronic
1169190031 20:3652865-3652887 CAAAGCCACCAGCTTGAGGGAGG + Intergenic
1171145052 20:22774355-22774377 CCGAGCCACTGCCTTCCTGGGGG + Intergenic
1172013434 20:31859734-31859756 TACAGCCTCCGCCTCCATGGAGG + Intronic
1175046965 20:56116132-56116154 CAGAGACTCTGCCTTCATGGAGG + Intergenic
1180143315 21:45906202-45906224 CAAAGCCACGTGCTTCATGGTGG - Intronic
1181275132 22:21683326-21683348 TAAAGCCCCCGCTTTCCTGGAGG + Intronic
1181282271 22:21728337-21728359 AAAGGCCACCGCCATCACGGAGG + Intronic
1183836912 22:40461824-40461846 CAAATCCACCTCCTCCATGTGGG + Intronic
949210910 3:1499897-1499919 TAAGGCCTCCGCCTTCATGAAGG - Intergenic
950430695 3:12949335-12949357 CAAAGCCACCCTCTTCAGAGGGG + Intronic
955113624 3:55974707-55974729 CGAAGCCACTGCCTCCATGAAGG + Intronic
955226318 3:57063292-57063314 CAAAGCCAAAGCCTTTAGGGTGG - Intronic
956051734 3:65255459-65255481 CAAAGACACATCCTACATGGTGG - Intergenic
956322848 3:68017914-68017936 CAAAATCACCTCCTTCATGAGGG - Intronic
957383921 3:79470750-79470772 CAAAGTCACATCTTTCATGGTGG - Intronic
965377118 3:167939057-167939079 TAAAACCCCTGCCTTCATGGAGG + Intergenic
966679072 3:182621034-182621056 CAATAGCACCTCCTTCATGGAGG - Intergenic
967921124 3:194615316-194615338 CCAAGCCCCGGCCCTCATGGAGG + Intronic
968907295 4:3460406-3460428 CAAAGGCACCTCTTACATGGCGG + Intergenic
969027607 4:4186252-4186274 AAAAACCACCCCCTTCATGTGGG + Intergenic
970925921 4:21452289-21452311 CAAAGACCCTGCCTTCATGGAGG + Intronic
971487127 4:27171695-27171717 CAAAGGCACACCCTACATGGTGG - Intergenic
971498476 4:27293113-27293135 CAAAGTCACCTCTTACATGGAGG - Intergenic
971499608 4:27304364-27304386 CAAAGTCACACCTTTCATGGTGG + Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
976881494 4:89931657-89931679 CAAAGCCACGTCTTACATGGTGG + Intronic
978558959 4:110011205-110011227 CAATGCAACCAACTTCATGGAGG + Exonic
979743709 4:124182219-124182241 CAAAGCCACGACTTACATGGTGG - Intergenic
981582635 4:146265454-146265476 GAAAGCCACCTTCATCATGGAGG - Intronic
981586000 4:146303050-146303072 CAAGGTCACAGCCCTCATGGAGG + Intronic
981723649 4:147825907-147825929 AAAAGTCTCTGCCTTCATGGAGG + Intronic
983348516 4:166558244-166558266 CAAAGTCACCTCTTACATGGTGG - Intergenic
983348779 4:166560212-166560234 CAAAGTCACCTCTTACATGGTGG - Intergenic
984346666 4:178537148-178537170 CAAAGTCACATCCTACATGGTGG + Intergenic
985651717 5:1110850-1110872 CCAGGCCACTGCCTTCACGGTGG + Intronic
986805392 5:11304013-11304035 GAAAGCCACCTCTTACATGGCGG - Intronic
986820472 5:11461140-11461162 CAAAGTCCCTGCCTTCATGAGGG - Intronic
986909059 5:12532242-12532264 CAGAACCCCAGCCTTCATGGAGG + Intergenic
987552695 5:19404528-19404550 CACAGTCACCTCATTCATGGAGG - Intergenic
987677120 5:21089147-21089169 CAAAGGCACATCCTACATGGTGG + Intergenic
990701182 5:58476421-58476443 CAAAGTCATCTCCTACATGGTGG + Intergenic
992001262 5:72438570-72438592 CAAAGCCTCAGCCAGCATGGTGG - Intergenic
992458819 5:76941447-76941469 CAAAGGCACCTCTTACATGGCGG - Intergenic
993567026 5:89489035-89489057 CAAAGGCACAGCTTACATGGCGG + Intergenic
999660660 5:153859621-153859643 CAAAGTCATTGCCCTCATGGAGG + Intergenic
999672989 5:153973947-153973969 CCAAGCCACAGCTTTCCTGGAGG - Intergenic
1000944311 5:167401595-167401617 CAAAGCCACTGCCCTCTTTGAGG + Intronic
1006212808 6:32411817-32411839 GAAAGCCAAGGCCTTCATGGAGG + Intergenic
1007095411 6:39209772-39209794 CAAGGCCTCAGCCTTCCTGGTGG + Intronic
1007246911 6:40469694-40469716 CAAACCCACCTGCTTCATAGAGG + Intronic
1008298209 6:49804019-49804041 CAAAGTCACCTCTTGCATGGTGG - Intergenic
1008317901 6:50069483-50069505 CAAAGCCACATCTTACATGGCGG - Intergenic
1010367443 6:75067684-75067706 CAAAGCCACATCTTACATGGTGG - Intergenic
1011870329 6:91885281-91885303 CAAAGTCACATCTTTCATGGTGG - Intergenic
1014080793 6:117283683-117283705 CAAAGTCTCTGCCTTGATGGAGG - Intergenic
1014539426 6:122655623-122655645 TGAAGACACTGCCTTCATGGAGG + Intronic
1014564051 6:122926926-122926948 TAAAGCCAACGCGATCATGGTGG + Intergenic
1014626729 6:123735283-123735305 CAAAGCCACATCTTACATGGCGG - Intergenic
1016712718 6:147192007-147192029 CAAAGCCACGTCTTTTATGGTGG + Intergenic
1019471503 7:1223886-1223908 CCAACCCACCGCCCTCACGGAGG - Intergenic
1021770958 7:24000704-24000726 AAAGGCCACTGCCTTGATGGTGG - Intergenic
1022037679 7:26549734-26549756 CAAAGCCAGTGGCTTCATTGTGG + Intergenic
1022436873 7:30395609-30395631 CAAAGTCACCTCTTACATGGTGG - Intronic
1022922730 7:35032901-35032923 CACAGCCACCGCCTTCATCTAGG + Intronic
1024676329 7:51641073-51641095 CAAGGCCACCGCGTGCATGGAGG + Intergenic
1024992275 7:55244681-55244703 CCAAGCGTCAGCCTTCATGGGGG - Intronic
1026341724 7:69440066-69440088 CAAAGCCACATCTTACATGGTGG + Intergenic
1026540597 7:71276599-71276621 CAAAGCCACGTCTTACATGGTGG - Intronic
1026631502 7:72041870-72041892 CAAAGCCACGTCTTACATGGTGG - Intronic
1028425143 7:90678105-90678127 CAAAGCCACAGCCTTTGTTGAGG + Intronic
1028747898 7:94348258-94348280 CAAAGCAACAGCCTAAATGGAGG - Intergenic
1030157313 7:106468231-106468253 CAAAGCCACGTCTTACATGGAGG + Intergenic
1032488892 7:132309184-132309206 GAAAGCCAACGACTTTATGGAGG + Intronic
1032594250 7:133223668-133223690 CAAAGGCACCTCTTACATGGTGG + Intergenic
1032721592 7:134554612-134554634 CCAGGCCACCGCCTCCAGGGAGG + Intronic
1035064273 7:156093992-156094014 CAAAGGCACCTCTTCCATGGCGG - Intergenic
1036798725 8:11774024-11774046 CAAAGGCACATCCTACATGGTGG + Intronic
1037235985 8:16720000-16720022 CAAAGCCACCTCTTACATGGTGG - Intergenic
1038652431 8:29417814-29417836 CAAAGCCACGTCTTACATGGCGG + Intergenic
1039457341 8:37716206-37716228 CAAAGCCTGTGCCCTCATGGTGG - Intergenic
1042334381 8:67614766-67614788 CAAAGGCACCATCTTCCTGGAGG - Intronic
1044858865 8:96502173-96502195 CAAAGGCACGTCCTACATGGTGG + Intronic
1048115856 8:131521011-131521033 CAAAGCCACATCCCACATGGTGG - Intergenic
1056250855 9:84746588-84746610 GAAAGCCACACTCTTCATGGTGG + Intronic
1057583024 9:96304516-96304538 CAAAACCACCTCCTCTATGGAGG - Intergenic
1058980023 9:110160443-110160465 CAAAGCGACTGCCTCCAAGGTGG + Intronic
1059013584 9:110489417-110489439 CAAAGCCACGTCTTACATGGTGG + Intronic
1059494811 9:114700562-114700584 ACAAGCCACCCCCTTCATGAGGG + Intergenic
1059537109 9:115091012-115091034 CAAACCCACCTCCACCATGGGGG - Exonic
1060009068 9:120027419-120027441 CAGAGCTACCTCCTTGATGGGGG - Intergenic
1185673546 X:1830713-1830735 CAAAGCCACACCTTACATGGCGG + Intergenic
1185971340 X:4668292-4668314 CAAAGGCACCTCTTACATGGTGG + Intergenic
1186270464 X:7881133-7881155 CAAAGGCACATCTTTCATGGTGG - Intergenic
1187214819 X:17265722-17265744 CAAAGCCACATCTTACATGGTGG - Intergenic
1189798040 X:44664658-44664680 CAAAGGCACATCCTACATGGCGG + Intergenic
1192930631 X:75801979-75802001 CAAGGTCACAGCCTTGATGGTGG - Intergenic
1194082780 X:89489264-89489286 CAAAGGCACATCATTCATGGTGG + Intergenic
1194219963 X:91177567-91177589 CAAAGACACATCTTTCATGGTGG - Intergenic
1194372096 X:93086889-93086911 CAAAGCCACATCTTACATGGTGG + Intergenic
1197507632 X:127327463-127327485 CAAAGGCACGTCTTTCATGGTGG + Intergenic
1198619458 X:138490219-138490241 CAAAGCCTCAGCCTCCATGGAGG - Intergenic
1199606360 X:149582705-149582727 CAAAGCCTCCGAGTTCATGCAGG - Exonic
1199632762 X:149786663-149786685 CAAAGCCTCCGAGTTCATGCAGG + Exonic
1200435431 Y:3145145-3145167 CAAAGGCACATCATTCATGGTGG + Intergenic
1200556469 Y:4641328-4641350 CAAAGACACATCTTTCATGGTGG - Intergenic
1200680148 Y:6200931-6200953 CAAAGCCACATCTTACATGGTGG + Intergenic