ID: 904937328

View in Genome Browser
Species Human (GRCh38)
Location 1:34140935-34140957
Sequence CTGCAGGAAGTGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 0, 2: 6, 3: 79, 4: 645}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904937328_904937336 2 Left 904937328 1:34140935-34140957 CCCTCCAGCCTCACTTCCTGCAG 0: 1
1: 0
2: 6
3: 79
4: 645
Right 904937336 1:34140960-34140982 CCAGCCACCACACACACACAAGG 0: 1
1: 0
2: 10
3: 58
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904937328 Original CRISPR CTGCAGGAAGTGAGGCTGGA GGG (reversed) Intronic
900033127 1:385619-385641 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
900053966 1:615509-615531 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
900415519 1:2532750-2532772 CTGCCGGAGGTGAGGGTGGTGGG + Intergenic
900491699 1:2952508-2952530 CTGCAGGAAATGAGCCAGGCTGG + Intergenic
900747045 1:4367578-4367600 CTCCAGGAAGAAAGGCTGCAGGG + Intergenic
900932793 1:5747511-5747533 CAGCAGGAAGGGAGGAAGGAGGG + Intergenic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901217338 1:7562119-7562141 GTGCGGGTAGTGAGGCTGGCAGG - Intronic
901744667 1:11364311-11364333 CACCAGGGAGTGAGGCAGGAGGG - Intergenic
901874796 1:12161376-12161398 CTGCAGGAAAGGATGCAGGATGG - Intergenic
902693271 1:18123802-18123824 AGGTAAGAAGTGAGGCTGGAGGG + Intronic
903130968 1:21279333-21279355 CTGCAGGGAAGGAGGCAGGAGGG + Intronic
903259465 1:22123464-22123486 CTGAAGGAAGAGATTCTGGAAGG + Intronic
903279900 1:22244471-22244493 CGGAAGGAAGGGAGGCTTGAAGG + Intergenic
903334542 1:22616254-22616276 CAGAAGGAAGGGGGGCTGGAAGG - Intergenic
903670328 1:25031477-25031499 CTGGAGGGATGGAGGCTGGAGGG + Intergenic
903773923 1:25781082-25781104 CTACAGGGAGTGGGGCTGGGAGG + Exonic
903997766 1:27318502-27318524 CTGTGAGAAATGAGGCTGGAAGG + Intergenic
904434587 1:30485960-30485982 CTGCAGGAGGTCCGGCTGCAGGG + Intergenic
904896091 1:33819583-33819605 GTGCAGGGAGTGAGGGGGGAGGG + Intronic
904937328 1:34140935-34140957 CTGCAGGAAGTGAGGCTGGAGGG - Intronic
905414678 1:37795597-37795619 CTGCAGGAAGTGAACCTGGCAGG + Intronic
905648470 1:39640446-39640468 CCCCAGGAAGAGAGGCTGGAAGG - Intergenic
905852010 1:41281587-41281609 GGGCAGGAAGTGAGGTTGGTGGG + Intergenic
906243454 1:44256904-44256926 CTGCAGGGACTGAGGCAGCATGG - Intronic
906263366 1:44409283-44409305 TGGCAGGCAGTGAGGTTGGACGG - Intronic
907126452 1:52055225-52055247 CTGAAGGAAGTGATGTTAGACGG + Exonic
907247045 1:53115119-53115141 GAGCAGAAAGAGAGGCTGGAAGG - Intronic
907325606 1:53637001-53637023 CTGCAGGACGTGAGGGTGACTGG + Intronic
908174540 1:61541423-61541445 ATAGAGGAAGGGAGGCTGGAAGG + Intergenic
909046987 1:70722378-70722400 CTGTTGGGAGTGAGGGTGGAGGG - Intergenic
909697519 1:78484165-78484187 CTGGAGCCAGTGAGGCTGGATGG + Intronic
909942822 1:81631150-81631172 CTGGAGGTAGTGAGGGTGGTGGG - Intronic
911063623 1:93768722-93768744 TCGCAGGAAGTGGGGCTGGAGGG + Intronic
911508543 1:98784122-98784144 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
913547609 1:119885047-119885069 CTGGCAGAAGTGAGACTGGAAGG + Intergenic
913682734 1:121202324-121202346 CTGGAGGAAGTGAGGAGGGGAGG - Intronic
914034576 1:143989950-143989972 CTGGAGGAAGTGAGGAGGGGAGG - Intergenic
914154876 1:145078018-145078040 CTGGAGGAAGTGAGGAGGGGAGG + Intronic
915915158 1:159936551-159936573 GTGCAGGATCTGAGGCTGGCAGG - Intronic
916031594 1:160881872-160881894 CTGCAGGAGGGATGGCTGGAAGG - Intronic
916039619 1:160950958-160950980 CTGCAGGAGGGAGGGCTGGAAGG - Intronic
916512358 1:165483554-165483576 GTACAGGAAGTGTGGCTGGGAGG + Intergenic
916561217 1:165935337-165935359 AAGCAGGAGGTGAGGCTGGCTGG - Intergenic
917024881 1:170631187-170631209 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
917059130 1:171017710-171017732 CTGGAGCCAGTGAGACTGGATGG + Intronic
917060574 1:171033108-171033130 CTGGAGCCAGGGAGGCTGGATGG - Intronic
918044426 1:180933215-180933237 ATCCAGGAAATGAGGCAGGAGGG + Intronic
918802266 1:188986820-188986842 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920431494 1:205921833-205921855 CTGCAGGGAGACAGTCTGGAAGG + Exonic
920440697 1:205978745-205978767 GGGCAGGCAGTGGGGCTGGAGGG + Exonic
920470046 1:206220838-206220860 CTGGAGGAAGTGAGGAGGGGAGG - Intronic
920559298 1:206927797-206927819 CTGCAGTTAGTGGGGCTGGAGGG + Intergenic
921273060 1:213489929-213489951 CTGCAGGCAGAGGGGCTGGTGGG + Intergenic
922322610 1:224501952-224501974 CTGGAGGAAGGTAGGGTGGAGGG + Intronic
922343245 1:224674475-224674497 CTGCTGGTGTTGAGGCTGGATGG + Intronic
922578435 1:226679111-226679133 CTGCAGGAAGAGATACTGGGAGG - Intronic
922770070 1:228176871-228176893 CTGCAGCGGGTGAGGCTGGACGG - Exonic
922999263 1:229992871-229992893 CTGCAAGAAGACAGGCTAGAAGG + Intergenic
923087663 1:230713716-230713738 GTGCAGGAATTGGGGCTGGAGGG - Intronic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
923397797 1:233584200-233584222 CAGCAGGAAGAGGAGCTGGAAGG - Intergenic
924336690 1:242992639-242992661 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
1063078132 10:2736769-2736791 CTGGAGGAAGAGGGGCTCGAGGG + Intergenic
1063143577 10:3276489-3276511 CTGCAGGACGTGAGGCTTGCTGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064086484 10:12349549-12349571 TAGCAGAAAGTGAGGCTGGCAGG + Exonic
1064629036 10:17290653-17290675 CTGCAAGAAGTGAAGGTGAATGG - Intergenic
1064840981 10:19591792-19591814 CTTCAAGAAGTGTGGCCGGATGG - Intronic
1066410009 10:35158531-35158553 CTGCTGGAAGTAGGTCTGGAGGG - Intronic
1066432805 10:35368864-35368886 CCAGAGGAAGTGAGGCTGGGAGG + Intronic
1067313057 10:45133416-45133438 CAGCTGGATGTGAGGCAGGAGGG + Intergenic
1068027675 10:51668186-51668208 CTGCAGGAAGTATGTCAGGAAGG + Intronic
1068509377 10:57944807-57944829 CAGCAGGCAGTAAGGCGGGAAGG + Intergenic
1068519936 10:58067018-58067040 CTGAGGGAAATGGGGCTGGAAGG - Intergenic
1068813504 10:61283326-61283348 CGGGAGGAAGTGATGGTGGAGGG + Intergenic
1068931525 10:62595346-62595368 GTGGAGGATGTGTGGCTGGAAGG - Intronic
1069246949 10:66218436-66218458 CTGAAGGAAGTCATGTTGGAAGG + Intronic
1069737589 10:70667296-70667318 CTGCAAGGAGCTAGGCTGGAGGG + Intergenic
1070395970 10:76011498-76011520 ATGGAGGAACTGAGGATGGAGGG - Intronic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1071059052 10:81548429-81548451 CTGGAGCCAGAGAGGCTGGATGG + Intergenic
1071701841 10:87947001-87947023 CTGTAGGAAAGGGGGCTGGAAGG + Intronic
1072758326 10:98035860-98035882 CAGCAGGAGGTGAGAATGGATGG - Intergenic
1074223305 10:111459625-111459647 CTGTGGGAAGAGAGGCTGCAAGG - Intergenic
1074264879 10:111891663-111891685 CTGAAGTCAGTGAGGATGGATGG - Intergenic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1074764167 10:116688246-116688268 CTGCAGGAAAAAAGGCTGGCTGG - Intronic
1074909295 10:117892990-117893012 TGGCAGGAAGTCAGGCTGGCTGG - Intergenic
1075067635 10:119300235-119300257 GTGCAGGAAGTGAGCCAGCAAGG + Intronic
1075155286 10:119971193-119971215 CTGCAGAGTGTGGGGCTGGAGGG - Intergenic
1075207838 10:120462247-120462269 TGGCAGGAAGGGAGCCTGGAAGG + Intronic
1076185114 10:128440674-128440696 CTGGAGGGAGGGAGGCTGGAAGG + Intergenic
1076519677 10:131073762-131073784 CTAGGGGGAGTGAGGCTGGAGGG - Intergenic
1077236996 11:1486636-1486658 GGCCAGGGAGTGAGGCTGGAGGG - Exonic
1077366352 11:2162850-2162872 GTGTAGGGAGGGAGGCTGGATGG + Intergenic
1077406156 11:2383400-2383422 CTGCAGGGACCCAGGCTGGAGGG + Intronic
1078152749 11:8773252-8773274 CTGCAGGCAGGCAGGCTGGCTGG - Intronic
1079630306 11:22666793-22666815 CTGCAGGACCTGTGCCTGGAGGG + Exonic
1079935267 11:26608780-26608802 CTGGAGCCAGGGAGGCTGGACGG - Intronic
1081642328 11:44764729-44764751 GTGCAGGAAGTGAGTGTTGATGG + Intronic
1081701379 11:45154991-45155013 CTGCAGGGAGTGTGGCTGGAAGG + Intronic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1082772543 11:57219616-57219638 TGACAGGAGGTGAGGCTGGAGGG - Intergenic
1082967094 11:58977310-58977332 CTGCAGGAAGTGATACAGCATGG + Intronic
1083290035 11:61684723-61684745 CTGTGGGAAGTGAGGGCGGAGGG + Intronic
1083489833 11:63008169-63008191 CAGCAAGAAGTGAGGCTAGGTGG + Intronic
1083539645 11:63503655-63503677 AGGAAGGAAGTGAGGCTGGATGG + Intergenic
1083571328 11:63763586-63763608 CTGCAGGATGTGGCGCTTGATGG + Exonic
1083727912 11:64637905-64637927 GGGCAGGCAGTGAGGCAGGAGGG + Intronic
1083868329 11:65470945-65470967 CTGCAGGAACTGAAGAGGGAGGG - Intergenic
1083902208 11:65649167-65649189 CTCCTGGAAGTGAGCCTGGCGGG + Intronic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1084163633 11:67364889-67364911 CTACAGGAAGTCATGCTCGAGGG - Exonic
1084427541 11:69093911-69093933 CTGAAGACAGTGAGGATGGACGG + Intergenic
1084954099 11:72682313-72682335 CTGGAGGAGGTGAGTCTGAAAGG - Intergenic
1085045264 11:73349036-73349058 CTGCAGGAAGGAAGGCTGCTGGG + Intronic
1085326473 11:75610481-75610503 CTGCAGGCAGTGTGGGTGGCTGG + Intronic
1085329203 11:75633694-75633716 CTGGAGGAAGTGAGCCTTGTGGG + Intronic
1086100448 11:83093912-83093934 ATGCAGAACGTGAGGCTAGATGG - Intergenic
1088659921 11:112035245-112035267 CTGCTGGAAGTAAGGCAGGGAGG - Intronic
1088697711 11:112382693-112382715 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
1088993834 11:114978510-114978532 GTGGAGGATGTGTGGCTGGATGG + Intergenic
1089004908 11:115083391-115083413 CTGCATGGAGGGAGGCAGGAAGG - Intergenic
1089057154 11:115594983-115595005 GTGCAAGGAGTGAGGGTGGATGG + Intergenic
1089127070 11:116184058-116184080 ATGGAGAAAGTGAGGCTGAAGGG - Intergenic
1089255248 11:117190573-117190595 AGGGAGGAAGTGAGGCAGGAAGG - Intronic
1090027615 11:123181148-123181170 CTGCTGGAAGATAGACTGGAAGG - Intronic
1090080106 11:123606624-123606646 CTGGAGGAAGAGGCGCTGGAGGG + Exonic
1090187778 11:124749533-124749555 CTGCAGAAAGACAGGCAGGAGGG + Intronic
1090574776 11:128088958-128088980 CTGCAGTCAGTGAAGCTGTAGGG - Intergenic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1091135681 11:133186849-133186871 GTGAGGGAACTGAGGCTGGAGGG + Intronic
1091358893 11:134958610-134958632 CTGTGGGAACTGTGGCTGGAGGG + Intergenic
1091563767 12:1633123-1633145 CTGCCCCAAGTGAGGCTGGAAGG - Intronic
1091685328 12:2557454-2557476 GTGCAGGAAGTGAGGCTGGGAGG - Intronic
1092628605 12:10354793-10354815 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1092655563 12:10680835-10680857 CTGAAGGAAGTGATGGTGGTGGG - Intergenic
1092791788 12:12076658-12076680 CTGATGGAAGTGAGCCTGGGAGG - Intronic
1093522489 12:20067063-20067085 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
1093808445 12:23464550-23464572 CTGGAGGCAGGGAGGCTGGATGG + Intergenic
1094054551 12:26256009-26256031 CTGGAGCCAGGGAGGCTGGATGG + Intronic
1094410666 12:30165142-30165164 CTGCAGGGAGAGGGCCTGGAGGG - Intergenic
1096642559 12:53006146-53006168 CTGCCGGAAGAGTGGCGGGAAGG - Exonic
1096657896 12:53103183-53103205 CTGCTGGGAGAGAGACTGGAAGG + Intergenic
1096700456 12:53379934-53379956 ATGCAGGAAGTGAAGATGGGCGG - Intergenic
1097357743 12:58621041-58621063 CTAGAGGAACAGAGGCTGGAAGG - Intronic
1098139189 12:67434352-67434374 ATGCAGGAAATGAGGCTGAAGGG - Intergenic
1098360955 12:69654067-69654089 CCACTGGAAGTGAGACTGGAAGG + Exonic
1098762960 12:74447934-74447956 TTGTAGGAAGTGGGGATGGAGGG - Intergenic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1101066532 12:101027521-101027543 CTGGAGCCAGGGAGGCTGGATGG + Intronic
1101502791 12:105319789-105319811 GTCCAGGAAGTCTGGCTGGAAGG + Intronic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1102487448 12:113267893-113267915 CTGCATGAAGTTACGCTGGCTGG + Exonic
1102869844 12:116405341-116405363 CCAGAGGAAGTGAGGCTGGCAGG + Intergenic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1103966948 12:124646095-124646117 GTGCAGGATGTGGGGCTGGGGGG + Intergenic
1104009830 12:124922206-124922228 CTGCAGGTAGTGAAGGTGGGGGG - Intergenic
1104876525 12:132038781-132038803 CTCCAGGACGTGGGGCTGCAGGG - Intronic
1105304698 13:19160354-19160376 ATGCAGGAAGTGAGGCTCCTGGG - Intergenic
1105930231 13:25045711-25045733 CTTCAGGTAGTGAGGTTGTAGGG + Intergenic
1107404708 13:40101723-40101745 CTGGAGGCAGTGAGGCTCTAGGG - Intergenic
1107822674 13:44300515-44300537 CTCCAGGTATGGAGGCTGGACGG - Intergenic
1108688898 13:52845734-52845756 CTGGGGGAAGGGAGACTGGAGGG - Intronic
1108815656 13:54287148-54287170 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1108957777 13:56182698-56182720 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
1109564079 13:64087768-64087790 AGGCAGGAAGTCAGGCAGGAAGG + Intergenic
1109693771 13:65927270-65927292 CAGCAGGAAGTGGAGCTGAAAGG + Intergenic
1110615813 13:77540724-77540746 TTGGGGGAAATGAGGCTGGAGGG + Intronic
1110782399 13:79481368-79481390 CTGCAGGAACGGAGGCGGAAGGG + Exonic
1110790507 13:79582018-79582040 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1112636976 13:101226601-101226623 CTCCTGGAACGGAGGCTGGAGGG - Intronic
1113203203 13:107889145-107889167 CTGCAGGAAGCATGGCTGGGAGG + Intergenic
1113252477 13:108469459-108469481 CTGTTGGAAGTGGGGCTGGGTGG - Intergenic
1113409080 13:110068287-110068309 CAGGAGGAAAGGAGGCTGGAAGG - Intergenic
1113767760 13:112891628-112891650 CCGCAGGAGCTGAGGCTGCAGGG - Intergenic
1113796051 13:113059219-113059241 CTGCAGCCAGCGTGGCTGGAGGG + Intronic
1113800427 13:113083537-113083559 CTGGAGGAAGTCCGGCTGGAGGG - Intronic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1113976400 13:114231071-114231093 CTGCTGGAGGTGGGGCTGGTGGG + Intergenic
1113976434 13:114231185-114231207 CTGCTGGAGGTGGGGCTGGTGGG + Intergenic
1113976468 13:114231299-114231321 CTGCTGGAGGTGGGGCTGGTGGG + Intergenic
1113976486 13:114231356-114231378 CTGCTGGAGGTGGGGCTGGTGGG + Intergenic
1113976520 13:114231470-114231492 CTGCTGGAGGTGGGGCTGGTGGG + Intergenic
1114487575 14:23072060-23072082 CTGCAGGTAGGGAGGTGGGATGG + Intronic
1114490087 14:23095081-23095103 CTGGAGGAGGTGACTCTGGACGG - Exonic
1116019980 14:39448532-39448554 CTGGAGGAAGTGAGGCTGTTTGG + Intergenic
1117379526 14:55146636-55146658 CTACAGGAAGTGCTGCTGGCAGG - Intergenic
1117537374 14:56714925-56714947 CTGCAGGAAGTGTGCCAGTATGG - Intronic
1118006424 14:61568118-61568140 CTGCAGGAAGGCAGGGTGGCCGG - Intronic
1119585737 14:75833116-75833138 ACGCAGGAAGTGAGGCTGAGAGG - Intronic
1119708990 14:76807698-76807720 ATGCAGGAAGGGAGGCTTGAGGG - Intronic
1119768498 14:77205717-77205739 CTGGGGGAGGTGAGACTGGAGGG + Intronic
1119815511 14:77563343-77563365 CTGCAGGACATGAGCATGGATGG - Intronic
1120346479 14:83296692-83296714 AGGAAGGAAGTCAGGCTGGAAGG + Intergenic
1120765908 14:88326294-88326316 CTGCATGGAGTGGGGATGGAGGG + Intronic
1121326809 14:93024916-93024938 GTGCAGGGATTGAGGCTGGGGGG + Intronic
1121395356 14:93617246-93617268 CTGCCGGATGTGAGGCTTTAGGG - Exonic
1121406963 14:93725068-93725090 AAGCAGGAAGTGAGCCTGGCAGG + Intronic
1121843619 14:97154860-97154882 TGGCAGGAGGTGGGGCTGGAAGG + Intergenic
1121902808 14:97709226-97709248 GGGCAGGAAGAGAGGCTGGAAGG + Intergenic
1121905706 14:97741100-97741122 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1122121344 14:99555117-99555139 TTGCTGGAAGTGAGGCGGGCGGG + Intronic
1122694496 14:103546175-103546197 CACCAAGAAGCGAGGCTGGAGGG + Intergenic
1122802017 14:104235865-104235887 CTGCAGGAGGTGGTGCTGCAAGG + Intergenic
1122878322 14:104678887-104678909 CTGCAGAAACTGAGGCTCAAAGG + Intergenic
1123875515 15:24620294-24620316 CTGCAGGAAGTGGGGGTGAGGGG - Intergenic
1124376853 15:29133978-29134000 GTGCAGGGAGTGGGGCTGGAAGG - Intronic
1125520689 15:40346350-40346372 CTGCATGAGGTGGGGCTGGAGGG + Intergenic
1125537734 15:40452218-40452240 CCGCAGCAAGTGAGGCTGTATGG + Intronic
1125676733 15:41506006-41506028 CTGCAGGAAGACACGTTGGAAGG + Intronic
1125911796 15:43446591-43446613 CTGAAAGAAGTGAGGCAGGGAGG + Intronic
1126096687 15:45095324-45095346 CTCCAGGAACTGAGTCTGAAGGG - Intronic
1127732057 15:61810765-61810787 TTACAGGAAGTGGGGCTGGAAGG - Intergenic
1128666197 15:69539958-69539980 CTGAAGGAAGTGAGGCTGAGCGG - Intergenic
1128691674 15:69729173-69729195 CTGGAGGAAAGGGGGCTGGAGGG - Intergenic
1129183980 15:73894553-73894575 TTGCAGGAAGTCAGTCTGCAGGG + Intergenic
1129689877 15:77707126-77707148 CTGCAGGCAGGGATGCTGGAGGG + Intronic
1130219961 15:82011171-82011193 CTTCAGGAGGTGAGGCAGGGAGG - Intergenic
1130555849 15:84922143-84922165 CTGCAGGGAGGGAGTGTGGATGG - Intronic
1130704430 15:86219178-86219200 TTGCAGGCAGTGAGCCTGCAGGG - Intronic
1132215159 15:100057056-100057078 CTGCAGTGTGTGAGGCAGGACGG + Intronic
1132344361 15:101099422-101099444 CTGCAGGAGGTGCCGGTGGAAGG - Intergenic
1132481212 16:167043-167065 CAGCAGGAAGTGGGGATGGAGGG - Intergenic
1132530941 16:449117-449139 CAGCTGGAAGTGAGGTTGGAGGG - Intronic
1132786414 16:1659234-1659256 CTGCAGGAAGAGGTGCCGGATGG - Intronic
1132908849 16:2298283-2298305 CTGGAGGAAGGGAGCCAGGAGGG - Intronic
1133002001 16:2856491-2856513 CAGCAGAGAGTGAGGATGGAGGG - Intronic
1133839458 16:9394616-9394638 AAGGAGGAAGTGAGGGTGGAAGG - Intergenic
1134054326 16:11159954-11159976 CTGTAGGGAATGAGGCTGCAGGG + Intronic
1134251855 16:12579784-12579806 GTACAGGAAGCGTGGCTGGAAGG - Intergenic
1134846680 16:17446652-17446674 CTGCAGGTGATCAGGCTGGAAGG + Intronic
1134860233 16:17554299-17554321 TTGCTGGGAGAGAGGCTGGAGGG + Intergenic
1135134007 16:19874463-19874485 ATGGAGGAAGTGAGGATGGGAGG - Intronic
1136065403 16:27755081-27755103 GAGCAGGAAGTGAGGCTGCCAGG - Intronic
1136179225 16:28539338-28539360 ATGCAGGACGTGAGGAAGGAGGG + Intergenic
1136223641 16:28844647-28844669 CTGCAGAGGGTGGGGCTGGATGG - Intronic
1136233796 16:28902770-28902792 CTGCATGAAGTGAGTCTGCAGGG - Exonic
1136580745 16:31149551-31149573 GAGCAGGAAGTGGGGCTGGGCGG - Intronic
1137366314 16:47862670-47862692 CTGCAGGAGGTGATGGTGGCTGG + Intergenic
1137721590 16:50630609-50630631 TGGAAGGAGGTGAGGCTGGAGGG + Intronic
1138047854 16:53744635-53744657 TGGCAGGAAGTGAGTCAGGAAGG - Intronic
1138345496 16:56317698-56317720 GTGCAGGATGTGTGGCTGGCTGG + Intronic
1138503802 16:57466086-57466108 CTTCTGGGGGTGAGGCTGGAAGG - Intronic
1139285772 16:65812613-65812635 CTGCAGGAACTCGGACTGGATGG - Intergenic
1139435549 16:66934694-66934716 CTCCTGGAAGTCAGGCTGGCCGG + Exonic
1139462326 16:67132595-67132617 CTCCAGGAAGTGGGGTGGGATGG - Intronic
1139572886 16:67824341-67824363 CTGCAGGACTTAAGGCTGTAGGG + Intronic
1140188722 16:72796522-72796544 CTGCCGGAAGTGGGGGTGGAGGG + Exonic
1140190514 16:72811891-72811913 CCGGAGCAGGTGAGGCTGGAAGG - Exonic
1140685032 16:77425310-77425332 CATCAGGAATTGAGGCTGGAGGG + Intronic
1140746722 16:77987069-77987091 TTATAGGAAGTGATGCTGGATGG + Intergenic
1141490509 16:84369180-84369202 CTGTAGGAAGTGAGGCTGGGAGG - Intronic
1141710657 16:85697105-85697127 CTCCAGGAAGGGAGGTTGGGAGG - Intronic
1141921899 16:87141042-87141064 CAGCAGGAAGTGAGGCTGAGGGG - Intronic
1142009633 16:87707302-87707324 CGACAGGAAGGGAGGCTGGAGGG - Intronic
1142031643 16:87841433-87841455 CTACAGGAGGTCAGGATGGAGGG + Intronic
1142364521 16:89643063-89643085 CTCCAGGAGGTAAGGCAGGAGGG - Intergenic
1142434202 16:90046875-90046897 GGCCAGGCAGTGAGGCTGGAGGG - Intergenic
1142472153 17:170500-170522 CTGCAGGTTGGGAGGCTGGGTGG + Intronic
1142540598 17:655717-655739 TTGCAGAAAGTGGGGCAGGATGG + Intronic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143135658 17:4710932-4710954 CTGCAGAAAGCGAGGCCTGAGGG + Intronic
1143231049 17:5355475-5355497 GAGCAGTAAGTGAGGCTGGAAGG - Intronic
1143255280 17:5553181-5553203 CTTCATGAAGTGAGGTTTGAGGG - Intronic
1143363940 17:6393301-6393323 CGGCCGGAAGTCAGGCTGGTGGG + Intergenic
1143524549 17:7464459-7464481 CTGAAGGAACTGGGGCTGGAGGG + Intronic
1143864040 17:9911186-9911208 CTGCTGCAGGTGATGCTGGAAGG + Intronic
1144083034 17:11781896-11781918 CTGAAGGCACTGAGGCTGGAAGG - Intronic
1144479546 17:15617526-15617548 ATGCTGGAAGTGAGGTTTGATGG + Intronic
1144828927 17:18121214-18121236 GGGCAGGAAGGGCGGCTGGAAGG - Exonic
1144918755 17:18746213-18746235 GTGCTGGAAGTAAGGCTTGATGG - Intronic
1145752358 17:27364341-27364363 CTGCAGGACGGGAGGCAGAATGG - Intergenic
1145785097 17:27588452-27588474 CTGCAGGGAAAGAGGCCGGATGG - Intronic
1146032297 17:29376707-29376729 GGGCAGGAATTCAGGCTGGAAGG - Intergenic
1146555137 17:33816719-33816741 CTGCAGGAGGGAGGGCTGGAGGG - Intronic
1146761848 17:35486284-35486306 GTGCAGGAAGTTGGGCTGGGAGG - Intronic
1147023703 17:37561311-37561333 CTCCAGGAAGTGAGGCAGATTGG + Intronic
1147568974 17:41555729-41555751 CAGCTGCAAGGGAGGCTGGAAGG - Intergenic
1148476965 17:47935075-47935097 AGGCAGGAAGTGAGCCTGCAAGG + Intergenic
1149374668 17:56031985-56032007 GTGCAGGAGGTGAGGATGGTGGG + Intergenic
1149995849 17:61405604-61405626 GTGCAGGAAGAGCGGCTGGCCGG - Exonic
1150003267 17:61455067-61455089 CTGCAGGGAGTGAGACTCGCTGG - Intronic
1150136280 17:62697044-62697066 CCGGAGGAAGGCAGGCTGGAGGG + Intergenic
1150339817 17:64357383-64357405 CTGCAGGGAGTGAGGCTGGCTGG - Intronic
1150426132 17:65078498-65078520 AAGCAGGATGTCAGGCTGGATGG + Intergenic
1151284346 17:73099174-73099196 CTGCAGGACAAGAGGGTGGATGG + Intergenic
1151943102 17:77305071-77305093 CTCCAGGAAGCAAGGATGGAAGG - Intronic
1152044932 17:77929567-77929589 CTGCAGGTATTGAGGCCAGAAGG + Intergenic
1152130619 17:78474105-78474127 CTGCAGGCAGAGACCCTGGAGGG - Intronic
1152145686 17:78567351-78567373 CTGCAGAAAGAGGGGATGGAAGG + Intronic
1152227449 17:79098959-79098981 CTGGAGGCAGTGAGGACGGAGGG + Intronic
1152576477 17:81143499-81143521 CTGGGGGAAGTGAGGCTGCGTGG - Intronic
1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG + Intronic
1152703040 17:81828927-81828949 GGGCAGGAAGTGTGGCTGGCAGG + Intronic
1152704639 17:81836641-81836663 CTGCAGCACTTGAAGCTGGATGG + Intergenic
1153444534 18:5156427-5156449 CTGGAGGAAGTGAGTATAGAGGG + Intronic
1154496077 18:14962632-14962654 CTGTGGGAACTGTGGCTGGAGGG - Intergenic
1155294268 18:24370995-24371017 TTGAAGGAAGTGAAGATGGAGGG - Intronic
1155320647 18:24615648-24615670 GAGTAGGTAGTGAGGCTGGAAGG - Intergenic
1155383989 18:25257034-25257056 TAGCAGGAAATGAGGCTAGATGG + Intronic
1158323958 18:56294397-56294419 CAGCAGGAGGTCAGACTGGAGGG - Intergenic
1158464983 18:57681974-57681996 CTGCGGTATGTCAGGCTGGAGGG + Intronic
1159088978 18:63825017-63825039 CAGAAGGAAGAGAGGGTGGAGGG + Intergenic
1159864276 18:73686441-73686463 TTGCTGGAGGAGAGGCTGGAAGG - Intergenic
1160607148 18:80059681-80059703 CTGCAGGAAGAGGGGGCGGAGGG + Intronic
1160895114 19:1398865-1398887 CTCCAGGAAGTGACCTTGGATGG - Exonic
1160954499 19:1684271-1684293 CTGCAGGGAGTGGGGCTTGGAGG + Intergenic
1161103085 19:2430953-2430975 CTGCAGGAAGGAAGGAAGGAAGG + Intronic
1161397768 19:4053884-4053906 GTGCAGGGAGAGAGGCGGGAGGG + Intronic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1161664720 19:5568238-5568260 CTCCAGGGAGGGAGGCTGGGAGG + Intergenic
1162291951 19:9786601-9786623 CTAGAGGAATTGAGGCCGGAGGG - Intronic
1163273289 19:16266971-16266993 CTGGAGGAAGGGATGCTGGAAGG + Intergenic
1163282227 19:16324990-16325012 CTGCAGGAGGTGAGGGCGGCGGG + Exonic
1163369894 19:16896233-16896255 CAGCAGGACGTGAAGCTGAATGG - Exonic
1163649684 19:18509968-18509990 CTGCAGGTACTGAGGCTTCAGGG - Intronic
1164050794 19:21584790-21584812 GTGCAGGAAGTGAGACTAGGAGG + Intergenic
1164073780 19:21793987-21794009 CTGCAGCTGGTGTGGCTGGAGGG - Intergenic
1164695124 19:30237959-30237981 TTGCAAGTGGTGAGGCTGGATGG - Intronic
1165339931 19:35204179-35204201 CTGCATGTAGGGAGGCTGGACGG - Intergenic
1165403621 19:35617309-35617331 CTGCAGGAACTGGGCCCGGAGGG - Exonic
1165470844 19:36003622-36003644 CTCCAGGATGTGAGGCTGGAGGG - Exonic
1166250769 19:41569551-41569573 CTGCAGGGAGAGGGGCTGCAGGG + Intronic
1166301228 19:41913139-41913161 CTGCGGGAGGAGAGGCTGGGAGG - Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167769915 19:51508659-51508681 CTGGAGCATCTGAGGCTGGAAGG - Intergenic
1168061052 19:53892486-53892508 CTGCAGGAAGGTGGGGTGGATGG - Intronic
1168507999 19:56952493-56952515 CAGCAGGACGTGAGGGTGGGTGG - Intergenic
927149899 2:20189563-20189585 CAGTGAGAAGTGAGGCTGGAGGG - Intergenic
928735205 2:34280259-34280281 TTGAAGGAATTCAGGCTGGAAGG - Intergenic
928757585 2:34545503-34545525 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
929298608 2:40275818-40275840 CTGCTGGAGGTCAGGCTGGATGG + Intronic
929670762 2:43875237-43875259 CAGCAGGAAGTGCAGCAGGAAGG - Exonic
931177827 2:59871068-59871090 ATGCTGGAAGTGCTGCTGGAAGG + Intergenic
931241698 2:60460313-60460335 CTACAGGGAGTGGGGCTGGAGGG + Exonic
931431134 2:62209790-62209812 CTGCAGGCTGTGATGTTGGAGGG + Intronic
932447688 2:71790868-71790890 CTGCAGGCAGAGAGGCTGCCAGG - Intergenic
932826726 2:74948017-74948039 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
932838364 2:75058754-75058776 CTGCAGGATTTGAGGCTACATGG - Intronic
932874196 2:75433343-75433365 CTGGAGCCAGGGAGGCTGGAAGG + Intergenic
932908919 2:75784907-75784929 CTACAGGAAATGAGGATGGCAGG + Intergenic
933689863 2:85171683-85171705 AGCCAGGAAGTGAGGCTGGTTGG + Intronic
934895242 2:98113320-98113342 CTGCAGGAACTGAGTATGCATGG - Intronic
935520311 2:104096418-104096440 CTGCAAGAAGAGAGGATGGGGGG + Intergenic
935904055 2:107824347-107824369 CTGAACAAAATGAGGCTGGAAGG - Intergenic
936458508 2:112693707-112693729 GACCCGGAAGTGAGGCTGGAGGG + Intergenic
936500168 2:113060575-113060597 CTGCTGGAAGAGAAGCTGCACGG - Intronic
936711801 2:115140348-115140370 AGGCAGCAAGTGAGGCTGCAGGG + Intronic
937931498 2:127208665-127208687 CTGGAGCCAGGGAGGCTGGATGG + Intronic
938293497 2:130162639-130162661 ATGCAGGAAGTGAGGCTCCTGGG - Intronic
938463056 2:131510322-131510344 ATGCAGGAAGTGAGGCTCCTGGG + Intergenic
941088564 2:161147161-161147183 CTGGAGCCAGGGAGGCTGGATGG - Intronic
941694382 2:168535049-168535071 CTGGAGCCAGGGAGGCTGGACGG - Intronic
942189441 2:173456078-173456100 GTGCTGGAAGTGAGGCCTGATGG - Intergenic
943646458 2:190411470-190411492 CTTCAGGAAGTGAGACAAGATGG + Intronic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
945120426 2:206451751-206451773 TGGCAGGAAGTGAAGGTGGAAGG + Intronic
946212703 2:218160288-218160310 CTGCAGGGATTGGAGCTGGAAGG + Intergenic
946640975 2:221783207-221783229 CCGCAGGAAGTTAAGGTGGAAGG + Intergenic
947480103 2:230491499-230491521 CTGGAGCCAGGGAGGCTGGATGG - Intronic
948068416 2:235100265-235100287 CTGGAGTAAGTGAGAATGGAGGG - Intergenic
948619219 2:239223529-239223551 GTTCAGGAACTGAGGCTGGGAGG - Intronic
948759767 2:240183352-240183374 CTGCAGGATGGGAGCCTGGGAGG + Intergenic
948995475 2:241576158-241576180 CTGCAGGGAAGGAGGGTGGAGGG - Intergenic
1168803862 20:661834-661856 CAGCGGGAAGGGAGGCTGCAGGG - Exonic
1168859747 20:1037380-1037402 ATGCAGGTAGTGAGGCTGGTTGG + Intergenic
1168888169 20:1274931-1274953 CTTCTGAAAGGGAGGCTGGAAGG - Intronic
1168892734 20:1305507-1305529 CTGCACGAAGTCTGTCTGGATGG - Exonic
1168919452 20:1518883-1518905 CTTCAGGAAGTGTGGGAGGAAGG - Intergenic
1169014468 20:2280352-2280374 GTGGGGGAAGTGAAGCTGGAAGG - Intergenic
1169253089 20:4075127-4075149 CTGGAGGAGATGAGGATGGAGGG - Exonic
1169513951 20:6296404-6296426 TGGCAGGGAGTGAGGCTGGGAGG - Intergenic
1170517711 20:17149054-17149076 ATGCAGGAAGTCAGCCTGAAGGG + Intergenic
1170840187 20:19918998-19919020 CTGAAGGCTGGGAGGCTGGAAGG + Intronic
1171308107 20:24123289-24123311 CTCTAGGAAGTGGGGATGGAGGG + Intergenic
1171347701 20:24478433-24478455 TGGCAGACAGTGAGGCTGGACGG - Intronic
1172846982 20:37935443-37935465 AGGCAAGAGGTGAGGCTGGAGGG - Intronic
1173082007 20:39877411-39877433 CTGCAGGGAGCGGGCCTGGAAGG + Intergenic
1173305026 20:41839935-41839957 CTGGAGGAATTGAGTCTTGAGGG + Intergenic
1173388426 20:42609677-42609699 CTAGAGGAAGAGAAGCTGGAAGG - Intronic
1173411752 20:42817683-42817705 CTGGAGCCAGGGAGGCTGGAGGG + Intronic
1173563016 20:44019824-44019846 GTGAAGAAAGTGAGGCCGGAAGG - Intronic
1174246916 20:49188357-49188379 CGGCAGGAAGTGACGGGGGAGGG + Exonic
1174257748 20:49270877-49270899 CTGCAGGAAAAGAGGCGAGAGGG - Exonic
1174869739 20:54171954-54171976 TTGCAGGGAGTGGGGCTGGGAGG + Intronic
1175391143 20:58628211-58628233 CATCAGGACATGAGGCTGGAAGG - Intergenic
1175529212 20:59662679-59662701 CTGGAGGAAAAGGGGCTGGAGGG + Intronic
1175625947 20:60488349-60488371 TTAAAGGCAGTGAGGCTGGAAGG + Intergenic
1175801979 20:61806093-61806115 CTGCAGGATGTCATTCTGGAAGG + Intronic
1176047547 20:63100684-63100706 ATGCAGGAGGGGAGGCTGCAGGG - Intergenic
1176049903 20:63113227-63113249 CTTCAGGAAGCAAGGCTGGCAGG - Intergenic
1176194940 20:63832412-63832434 CCGCAGGGAGGCAGGCTGGACGG - Intergenic
1176974048 21:15298435-15298457 TTTCAGGAATTGAGGGTGGAAGG - Intergenic
1177511386 21:22091872-22091894 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1177878943 21:26669420-26669442 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1177956596 21:27606231-27606253 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1178524910 21:33319443-33319465 CTGCAGGAGGTGGGGTGGGAGGG + Intergenic
1179339082 21:40487455-40487477 TTGCATGAGGTGAGGCTGGAGGG + Intronic
1179547574 21:42123005-42123027 CTGCAGGAAGCGCTTCTGGATGG - Exonic
1179643631 21:42762372-42762394 CTGGAGGAGGTGAGGAAGGAGGG - Intronic
1181044985 22:20210233-20210255 CTGCAGGGAGCGTGGCAGGACGG - Intergenic
1181112863 22:20612071-20612093 ATGCAGGAAGTGAGGCTCCCAGG - Intergenic
1181171955 22:21014925-21014947 CCCCAGGAAGTGAGGCCAGAGGG + Intronic
1181177347 22:21045269-21045291 CCGGAGGAAGTGAGGCCAGAGGG - Intergenic
1181410106 22:22712581-22712603 CTGCAGGGTGGGAGGCTGGTGGG + Intergenic
1181567133 22:23745902-23745924 CTGGAGGGAGTGCGACTGGAGGG - Intronic
1181963261 22:26638327-26638349 CTGCAGGAAGGAAGGAAGGAAGG + Intergenic
1182473736 22:30564504-30564526 CTGCAGGCACTCAGGATGGACGG + Intronic
1182784687 22:32897497-32897519 CTGCAGGATGGGAGGCCGGCGGG - Intronic
1183203053 22:36399395-36399417 CTGCATGCACTCAGGCTGGAAGG - Intergenic
1184228233 22:43143023-43143045 CTGCTGGAACTGAGCCTGCACGG - Exonic
1184371168 22:44082992-44083014 CCCCAGGAGGTGAGGCTGGGGGG + Intronic
1184735914 22:46397832-46397854 ATGCAGGGAGTGAGGATGGGGGG - Exonic
1185169735 22:49285787-49285809 CTGCTGGCAGTGAGGCTGCGTGG - Intergenic
949119952 3:373454-373476 CTGGAGCCAGGGAGGCTGGATGG - Intronic
949379770 3:3431656-3431678 CTGCAGGAGGTGATGCTAGTGGG - Intergenic
949469531 3:4380079-4380101 CAGCAGGAAGAGCGGCTGCAGGG + Intronic
949944652 3:9180365-9180387 CCACAGGAAGTGAGGCTAGGAGG + Intronic
949948444 3:9208700-9208722 CTTCAGGAAGGGAGGATGGAGGG + Intronic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950223459 3:11214195-11214217 CTGGAAGAAGAGAGGCTGGTCGG + Intronic
950494326 3:13324554-13324576 CATCCAGAAGTGAGGCTGGAGGG - Intronic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
952061418 3:29515534-29515556 ATGCAGGAAGACAGGCTGGAAGG + Intronic
952080489 3:29752139-29752161 CAGCAGGAAGGGGAGCTGGAAGG + Intronic
952186397 3:30974031-30974053 CTGCAGGAAGCATGGCTGGGAGG + Intergenic
952582173 3:34847329-34847351 CTACCAGAAGTGAGGATGGATGG - Intergenic
952739898 3:36724944-36724966 CTCCAAGACTTGAGGCTGGATGG + Intronic
953417999 3:42734025-42734047 CTGCAGCCAGAGAGGCTGGCAGG + Intronic
953880941 3:46691000-46691022 CTGCAGAGAGAGAGGCAGGAAGG + Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
954837091 3:53479421-53479443 CAGCAGGGAGGGATGCTGGAAGG + Intergenic
954847020 3:53568394-53568416 CGGCCGAGAGTGAGGCTGGAAGG - Intronic
954923203 3:54209482-54209504 CTGTACGGAGTGAGGCTGAAAGG + Intronic
955393429 3:58537359-58537381 ATGCAGGAAGAGAGGGAGGAAGG - Intergenic
955417313 3:58704707-58704729 CTGCAGGAATGGATGCTGGTGGG - Intergenic
955949413 3:64227002-64227024 CTTCAGGAACTGCAGCTGGAAGG - Intronic
956299047 3:67749493-67749515 TTGAAGGAAGTGAGGCTCAAAGG - Intergenic
956784953 3:72634875-72634897 CTGCTGGATATGATGCTGGATGG - Intergenic
957476858 3:80736769-80736791 GTGCAGGGAGTGAGGTTGGAAGG - Intergenic
959031100 3:101300234-101300256 CTGGAGCCAGGGAGGCTGGACGG - Intronic
959323442 3:104906904-104906926 CAGCAGGATGTGGGGGTGGAGGG + Intergenic
960129744 3:114043309-114043331 CAGCAGGAGATGAGGTTGGAGGG + Intronic
960233436 3:115254934-115254956 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
960565323 3:119126184-119126206 CTGGAGCCAGGGAGGCTGGACGG + Intronic
960844387 3:121993310-121993332 CTCCAGGAACTGAGGCCGGAGGG + Exonic
961292656 3:125860054-125860076 CTGCAGGGAGTGGGGCTGGGAGG - Intergenic
961332334 3:126149895-126149917 TTCCAGGAAGTGAGCATGGATGG + Intronic
961542741 3:127611129-127611151 CTGCAGGTGGTGAGGGTAGAAGG - Intronic
961688276 3:128650480-128650502 CGCCAGGAAGGGAGGCGGGAAGG + Intronic
962364407 3:134768256-134768278 CTAAAGGCAGTGAGCCTGGAGGG + Intronic
962367734 3:134796985-134797007 CTTCTGGAAGTGAAGCTGGAGGG + Intronic
963461254 3:145617318-145617340 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
964743107 3:159988132-159988154 TTGCAGGGTGTGAGGCTGGAGGG - Intergenic
964831208 3:160886017-160886039 CTGGAGCCAGTGAGGCTGGATGG + Intronic
965263326 3:166510762-166510784 CTGGAGTCAGGGAGGCTGGATGG + Intergenic
965387323 3:168060325-168060347 CTGCAGTAATTGAGGCATGAGGG + Intronic
965699062 3:171440709-171440731 CTGCAGGAAGAGGGTGTGGAGGG + Intronic
966400058 3:179538685-179538707 ATGCTGGAAGTGAGGCCTGATGG - Intergenic
966539640 3:181075193-181075215 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
967138245 3:186530596-186530618 CAGCAGGAAGTGAGGGGGCAGGG + Intergenic
967315640 3:188149921-188149943 CTGGAAGAAATGAGGCTGAAGGG + Intergenic
967546153 3:190731262-190731284 CTGAAGGAGGTGAGGCTGTAGGG + Intergenic
967925169 3:194640152-194640174 CTGCAGGAGGGGAGGCGAGACGG + Intergenic
967977891 3:195045634-195045656 CCGCATGGAGTGAGGGTGGAGGG - Intergenic
968376717 4:50078-50100 CTGCAGGAGGAGAGCCTGCAGGG - Intergenic
968607454 4:1542255-1542277 CTGGGGGGAGTGTGGCTGGACGG - Intergenic
969128890 4:4975900-4975922 CTGCAGGAAGAATGGCTGGGAGG - Intergenic
969172677 4:5376645-5376667 ATGATGGAAATGAGGCTGGAGGG + Intronic
969433411 4:7169329-7169351 CTGCAGGAAGTGGTGGTGGTGGG + Intergenic
969462695 4:7337149-7337171 TTGCAGAAGGTGGGGCTGGAAGG + Intronic
969748244 4:9090736-9090758 CTGCGGGGAGTGGGGCTGGGAGG - Intergenic
969809273 4:9635296-9635318 CTGCGGGAAGTGGGGCTGGGAGG - Intergenic
969871166 4:10106088-10106110 CTGCTGGGGGTGAGGGTGGAAGG + Intronic
969917989 4:10509333-10509355 TGTCAGGAAGTGAGGCTGCAGGG - Intronic
970502305 4:16690456-16690478 CTGCAGGAAGGAAGGAAGGAAGG + Intronic
970903081 4:21182620-21182642 TGGAAGGATGTGAGGCTGGAAGG - Intronic
971236310 4:24845280-24845302 CTGAAGGAAGTGTGGTGGGAAGG - Intronic
972228336 4:37041134-37041156 CTGAATTATGTGAGGCTGGATGG - Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
972935665 4:44131846-44131868 CTGGAGGAAGGGAGAGTGGAGGG + Intergenic
973100007 4:46254839-46254861 CAGCAGGAAGTGAGAGTGGATGG - Intronic
974181223 4:58386720-58386742 CTGGAGTCAGGGAGGCTGGATGG - Intergenic
974942252 4:68483368-68483390 TTGCTGGAAGTGAGGCTGGTGGG - Intronic
975625478 4:76342280-76342302 TTGTAGGGACTGAGGCTGGAGGG - Intronic
975765912 4:77667401-77667423 CTGCAGGAGTGGAGACTGGAAGG - Intergenic
975811611 4:78175746-78175768 CAGTAGGAAGGGAGGCAGGAAGG + Intronic
976440240 4:85064980-85065002 CTGGATGAAGTGTGCCTGGAGGG + Intergenic
977299859 4:95255461-95255483 CAGCTGAAAGTGAGGCTAGAAGG - Intronic
978518469 4:109594730-109594752 CAGCCTGAAGTGAGGATGGAAGG + Intronic
979240439 4:118442670-118442692 CTGCAGAAAGTCTGGCTGGAAGG + Intergenic
979307331 4:119162278-119162300 AAGCAGGCGGTGAGGCTGGACGG + Intronic
979444504 4:120795196-120795218 CTGATGGAAGTGAGTATGGAGGG - Intronic
979775428 4:124583373-124583395 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
980184644 4:129446401-129446423 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
980969889 4:139557833-139557855 CTGGAGGAATTCAGGCTGGCTGG - Intronic
981077772 4:140607946-140607968 CTGCAGTTAGTGAGGAGGGAGGG + Intergenic
981809155 4:148753823-148753845 CTGCAGCAGATGAGGCTGTATGG + Intergenic
982692067 4:158560096-158560118 CTGCAGGTAATGAAGCTGGCAGG + Intronic
983296213 4:165872599-165872621 GCGCAGGAAGGGAAGCTGGATGG - Intergenic
983886908 4:172989741-172989763 GTACAGGAAGTATGGCTGGAAGG - Intronic
984335001 4:178379265-178379287 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
985543603 5:498362-498384 AGGCAGGAAGTGGGGCTGGCGGG - Intronic
986583230 5:9287107-9287129 CTGGAGGAAGTGCAGGTGGACGG - Intronic
988077196 5:26367857-26367879 CTGCAGCATGTGAAACTGGATGG - Intergenic
988359105 5:30212442-30212464 CTGCAGGAAGTGAGCCCTTATGG + Intergenic
988501062 5:31784145-31784167 CTGCAGGAGGTGAGGACGGGAGG - Intronic
988780517 5:34516934-34516956 CTGAAGGAAATGAGGCAGCAAGG - Intergenic
988993035 5:36690111-36690133 CTGGAGGAAGCGTGGCGGGAAGG + Intergenic
989343311 5:40401493-40401515 CAGCAGTAAATGAGGCTTGAAGG - Intergenic
989353875 5:40518926-40518948 CTGCATGAAATGAGCCTGAAGGG - Intergenic
989378400 5:40789624-40789646 CTGGGGTAAGTGGGGCTGGAGGG + Intronic
989676693 5:43981568-43981590 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
990139093 5:52682518-52682540 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
991430653 5:66541504-66541526 CTGGAAGAAAGGAGGCTGGAGGG - Intergenic
992196479 5:74344593-74344615 CTTCAGGAAGGGAAGCTAGAAGG + Intergenic
992435858 5:76755605-76755627 CTGTTGGAAGACAGGCTGGAAGG - Intergenic
992563639 5:77976329-77976351 CAGCAAGAAGAGAGGATGGATGG + Intergenic
995653239 5:114395786-114395808 CAGCAGGCAGTGAAGCAGGAAGG - Intronic
997337929 5:133120867-133120889 CTGAAGGAAGTGAGGAAGGGAGG - Intergenic
997484586 5:134219480-134219502 CTGCTGGTGTTGAGGCTGGAAGG - Intronic
997979633 5:138460830-138460852 CTGGGGAAAATGAGGCTGGAAGG - Intergenic
998040454 5:138948080-138948102 CTGTAGGAAGTGTGCCTGTATGG + Intronic
998250608 5:140549685-140549707 CTGCTGGAAGTGGGCCTGGTGGG - Intronic
998507238 5:142681783-142681805 ATGCAGGAATTGAGGCTTGTTGG - Intronic
998531632 5:142890439-142890461 TGGGAGGAGGTGAGGCTGGAGGG + Intronic
999087899 5:148909860-148909882 CTCCAGGAAGAGAGGCAGTAGGG + Intergenic
999256388 5:150212020-150212042 CAGGAGGAAGTGAAGCTGGTGGG - Intronic
999372184 5:151062663-151062685 CTGCAGGAAGTCAGGGAGGGAGG - Intronic
999829247 5:155303428-155303450 ATGGAGGAACTGAGACTGGAGGG - Intergenic
1000079421 5:157830915-157830937 CTACTGGAGGTGAGGGTGGAGGG + Intronic
1001443588 5:171764703-171764725 ATGAAGGATGGGAGGCTGGAGGG - Intergenic
1001679399 5:173545052-173545074 CTGCTGGAACTGTGGTTGGATGG + Intergenic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001977188 5:176009768-176009790 CTGCAGGTCTTCAGGCTGGAGGG - Intronic
1002080171 5:176732992-176733014 CAGAAGGCAGTGAGGCTGGGAGG + Intergenic
1002240237 5:177834012-177834034 CTGCAGGTCTTCAGGCTGGAGGG + Intergenic
1002274314 5:178094544-178094566 CTGCAGGAAGCCAGGTGGGAGGG + Intergenic
1002327048 5:178416460-178416482 CTGCTGGGAGTGAGCCCGGAGGG + Intronic
1002373455 5:178772507-178772529 CTTCACCAAGTCAGGCTGGAAGG + Intergenic
1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1002891825 6:1340061-1340083 CTACAAGAAGTGAGGTTGGAGGG - Intergenic
1003114842 6:3276941-3276963 CTTCGGGAAGTGAAGCTGGTGGG - Intronic
1003383575 6:5647234-5647256 CCCCAGGAAGAGAGGCGGGAAGG - Intronic
1003490816 6:6619991-6620013 CTGGTGGAAGTGAGATTGGAGGG + Intronic
1003879996 6:10471244-10471266 CTGCAGAAAGAGAGGCTGCAGGG + Intergenic
1003967408 6:11266244-11266266 CTGGAGTAAGTGAGGGGGGAGGG - Intronic
1004447362 6:15712410-15712432 CTGCAGGAAGTGAGGGGAGCTGG - Intergenic
1004769134 6:18762163-18762185 AGGCAGGAAGGGAGGCAGGAAGG - Intergenic
1005121049 6:22389807-22389829 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1005311623 6:24564462-24564484 CTGCAGGGAATGAGGCTGGCGGG + Intronic
1005695607 6:28350126-28350148 CTGCAGGAACTGGGGAGGGAAGG - Intronic
1006150353 6:31983706-31983728 CTGAAGGAAATAAGGGTGGAAGG + Intronic
1006156654 6:32016444-32016466 CTGAAGGAAATAAGGGTGGAAGG + Intronic
1006269084 6:32950114-32950136 CTGAAGGAAGTCATGGTGGAGGG - Intronic
1006312636 6:33271677-33271699 TTGCCGGAAGTGAGGCTGCGGGG - Exonic
1006370205 6:33639667-33639689 ATGCAGGAAGGGTGGCTGGATGG + Intronic
1006807756 6:36799552-36799574 CTGCAGGCGGGGAGGCTGCAGGG + Intronic
1006924801 6:37648413-37648435 CTGGTGGAAGCGGGGCTGGAAGG + Intronic
1007102132 6:39256466-39256488 GTCCAGGAAGTGAGGCAGGGAGG - Intergenic
1008111838 6:47503372-47503394 CAGGAGGAAGGGTGGCTGGAAGG + Exonic
1008603293 6:53116591-53116613 TTGCAGGAAGTGAGGCTATAAGG + Intergenic
1008675029 6:53810126-53810148 CTGCAAGAAGGAAGGCAGGAAGG + Intronic
1008773663 6:55009224-55009246 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1010483220 6:76379301-76379323 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1010945607 6:81970204-81970226 CTGGAGCCAGGGAGGCTGGAGGG + Intergenic
1012548848 6:100449592-100449614 CTGCACGAAGTGAGAGTGGTAGG + Exonic
1012741175 6:103018365-103018387 CTGGAGCAAGGAAGGCTGGATGG - Intergenic
1013130326 6:107226590-107226612 TGGTAGAAAGTGAGGCTGGAGGG + Intronic
1013133878 6:107261254-107261276 ATGCAGGAGGTGGGGCTGGTGGG + Intronic
1013268607 6:108524723-108524745 ATGCAGAAAGTGGGGCTAGAAGG + Exonic
1014342790 6:120229718-120229740 CTGAAGGAAGTGAGGTAGGCTGG - Intergenic
1014374641 6:120658218-120658240 GTGCAGGAAGTGTGGCTGGGAGG + Intergenic
1015181839 6:130369034-130369056 TTGAAGGAAGCCAGGCTGGAGGG + Intronic
1015358184 6:132305176-132305198 CTGGAGCCAGAGAGGCTGGATGG + Intronic
1015660190 6:135566408-135566430 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1015712825 6:136160741-136160763 TGGTGGGAAGTGAGGCTGGAAGG - Intronic
1015841857 6:137485730-137485752 CTTAAGGAAGTGATGCTGAAGGG - Intergenic
1015878421 6:137846962-137846984 CCGCAGGAAGAGAGGCTGGCGGG - Intergenic
1015904034 6:138097896-138097918 CTGGAGGAAGAGGGGATGGAGGG - Intronic
1016330725 6:142949306-142949328 CTATGGGAAGTGAGGCTGGGTGG + Intergenic
1017577130 6:155817553-155817575 ATGCATGCAGTGAGGCAGGAGGG - Intergenic
1017595854 6:156027826-156027848 CTGGAGGACGTGAGGCCGGGAGG - Intergenic
1017671506 6:156773679-156773701 CTGCAGGAAATGCTGCGGGATGG + Intergenic
1017684658 6:156899619-156899641 CTCCAGGAAGTTTGGCTGCAGGG - Intronic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1018804014 6:167244764-167244786 AGGCAGGAAATGAGGGTGGAAGG + Intergenic
1019245803 6:170708845-170708867 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1019443370 7:1058611-1058633 CTGCTGGAAGAGAAGCAGGAGGG + Exonic
1019447073 7:1076836-1076858 GTGCAGGAAGTGTGGCTAGAAGG - Intronic
1020317571 7:6917342-6917364 CTGCAGGTAATGAGGATTGATGG - Intergenic
1020324763 7:6965911-6965933 CTGCGGGGAGTGGGGCTGGGAGG + Intergenic
1021150936 7:17149953-17149975 CTGTAGGAAGTGAGATGGGAGGG - Intergenic
1022477629 7:30722168-30722190 CTGCTGGATGTGAGCCTGGATGG + Intronic
1023057897 7:36304291-36304313 GTGCAGGAATTGAGGTTTGAGGG + Intergenic
1023284890 7:38608697-38608719 CTGCAAGAAGTGATGGTGGAAGG + Intronic
1023676198 7:42632748-42632770 CTGTAGGAAGTGGAGCTGAATGG + Intergenic
1023884878 7:44347648-44347670 AAGCAGGAGGTGAGGCTGCAAGG - Intergenic
1024054280 7:45649674-45649696 CTGCAGACAGTGTGACTGGAAGG + Intronic
1024076801 7:45825122-45825144 TTTCAGGATGAGAGGCTGGACGG + Intergenic
1024261937 7:47579879-47579901 CTGCAGGAGGTGTTGCTGAAGGG - Intronic
1024553624 7:50584374-50584396 CTGCAAGGAGAGAGGATGGAGGG + Intergenic
1025094197 7:56084954-56084976 CTGCAGCTGGTGAGTCTGGAGGG + Intronic
1026233370 7:68505022-68505044 CTGCAGGAGCTGAGGCTGCCAGG + Intergenic
1026446832 7:70492103-70492125 CTGCAGGCAGTGAGGCAGGCAGG - Intronic
1028459169 7:91071825-91071847 CTGAAGCCAGGGAGGCTGGATGG + Intronic
1029178579 7:98683207-98683229 CTCTTGGAAGTGGGGCTGGAGGG + Intergenic
1029514371 7:101016675-101016697 GTGGAGGAAGTGAGGCTGAGGGG + Intronic
1030204991 7:106944099-106944121 ATTCAGGAAATGAGGCTGCAAGG - Intergenic
1030701576 7:112646929-112646951 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1031804576 7:126292660-126292682 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
1032364870 7:131289303-131289325 TTGCAGGAAGTGGGGAAGGATGG + Intronic
1032919915 7:136534087-136534109 CTGAAGCCAGGGAGGCTGGATGG + Intergenic
1033658803 7:143390145-143390167 CTGCAGGAAATGGGGCTGTGGGG + Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034499122 7:151438970-151438992 CAGCAGGAAATGAGTCTGGCGGG - Intronic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034937892 7:155211481-155211503 CTGCAGGAAGACAGGCTGTAGGG + Intergenic
1034976518 7:155452012-155452034 CTGGTGGGAGTGAGACTGGACGG + Intergenic
1035303381 7:157913400-157913422 CAGCAGGCAGTGAAGCAGGAAGG - Intronic
1035318087 7:158010021-158010043 TGGCTGGAAGTGAGGGTGGAGGG - Intronic
1035502321 8:99353-99375 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
1035578552 8:725122-725144 CAGCAGGCACGGAGGCTGGAGGG - Intronic
1036022627 8:4862910-4862932 CAGCACCAAGAGAGGCTGGAGGG + Intronic
1036371301 8:8165030-8165052 CTGCGGGGAGTGGGGCTGGGAGG - Intergenic
1036670064 8:10777572-10777594 CTGCAGGGAGTGAGGTAGGCAGG + Intronic
1036879602 8:12500614-12500636 CTGCGGGGAGTGGGGCTGGGAGG + Intergenic
1037785067 8:21897886-21897908 CTGAAGGAGGTGAGCCTGGCTGG + Intergenic
1037827420 8:22167672-22167694 CTGGGTGAAGTGAGGCTGGTGGG + Intronic
1037993309 8:23336025-23336047 TTGCAGGAAGTGTGTCTGGAGGG - Intronic
1039223173 8:35357876-35357898 ATGAAGGAAGGGAGGATGGAAGG - Intronic
1039293852 8:36127773-36127795 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1039568500 8:38567583-38567605 CTCAAGGAGGTGAGGCTGGTCGG - Intergenic
1039771691 8:40694201-40694223 CTGCAGGCAGTAAGGGAGGATGG + Intronic
1040959759 8:53019222-53019244 CTGAAGCCAGGGAGGCTGGACGG + Intergenic
1042104227 8:65307575-65307597 CAGCAAGAAATGAGGCTGGAGGG + Intergenic
1044086305 8:87945980-87946002 CTGCAGGCAGTCAGGCTTTATGG + Intergenic
1044328955 8:90893693-90893715 CTGCTGGAATTCAGGCAGGATGG - Intronic
1044561361 8:93615595-93615617 TTGCAGGGAGTCAGGCTGGGAGG - Intergenic
1044600195 8:93996116-93996138 CAGCAGTAAGTGAGGCAGCATGG - Intergenic
1044664127 8:94618743-94618765 CGGGAGGAAGTGGGGCAGGAGGG + Intergenic
1044711517 8:95063043-95063065 GAGGAAGAAGTGAGGCTGGAAGG + Intronic
1045354786 8:101375754-101375776 CTGCAGCACGTGAAGCAGGAAGG + Intergenic
1045665600 8:104481020-104481042 CTGCATGGAATGAAGCTGGATGG + Intergenic
1046760980 8:118020217-118020239 CTGTAGGAACTGAGGCCAGATGG - Intronic
1046949493 8:120006234-120006256 AAGAAGGAAGTGAGGCTGGGCGG + Intronic
1047511883 8:125521770-125521792 AGGCAGGAAGGAAGGCTGGAAGG - Intergenic
1047549387 8:125853228-125853250 CTGCACTAAGTGAGGCTTGAGGG + Intergenic
1047806465 8:128366220-128366242 ATTGAGGAAGTGATGCTGGAAGG - Intergenic
1049120558 8:140733215-140733237 CTGGAGGAAGTGAGGAGGAAGGG + Intronic
1049529760 8:143148355-143148377 ATGCAGGAGGTGAGGCCTGACGG - Intergenic
1049567508 8:143348717-143348739 CTGCAGGCTGTGAGGATGAAGGG + Intronic
1049614118 8:143568897-143568919 CTGCAGGGGGTGGGGCTTGAAGG + Intronic
1049851923 8:144837246-144837268 CTGCAGGGAGAGTGGGTGGAGGG - Intronic
1050595970 9:7205075-7205097 CTGCAGGATGTGAATCTGGAAGG - Intergenic
1051116411 9:13698897-13698919 CTGCAGGAATTGAGACAGTATGG - Intergenic
1051372239 9:16368449-16368471 CAACAGGCAGTGTGGCTGGATGG + Intergenic
1052452448 9:28649619-28649641 CTCCAGGAATTGAGGCAGAATGG - Intronic
1052546637 9:29888904-29888926 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
1054759713 9:68993366-68993388 CTGAAGGAAGTGAGGGAGCATGG - Intronic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1055525036 9:77124561-77124583 GGGCAGGGAGTGAGTCTGGAAGG - Intergenic
1056771987 9:89484206-89484228 ATGCAGGCAGTGAAGCTGGCCGG - Intronic
1056810526 9:89760482-89760504 CTGATGGAGGTGAGGCTGGCAGG - Intergenic
1057047987 9:91900450-91900472 CTGGAGCAAGAGAGGCTGGCAGG + Intronic
1057389038 9:94627774-94627796 AGGCAGCAAATGAGGCTGGAGGG + Intronic
1057604391 9:96488794-96488816 TGTGAGGAAGTGAGGCTGGAAGG - Intronic
1057820581 9:98327385-98327407 ATTCAGGAAGTGCTGCTGGAGGG - Intronic
1057870170 9:98710726-98710748 CTCCAGGAAGGGAGGAAGGAAGG + Intergenic
1058643464 9:107109025-107109047 CTGGAAGAAGAGATGCTGGAAGG - Intergenic
1059284775 9:113162930-113162952 GTGCAGGCACTGAGGCTGGAGGG + Exonic
1059506067 9:114800987-114801009 AGGCATGAAGTGAGGTTGGAGGG + Intronic
1059596286 9:115724142-115724164 CTGGAGCCAGTGATGCTGGATGG + Intergenic
1060145938 9:121252388-121252410 TGGCAGGAAATGAAGCTGGAGGG + Intronic
1060182026 9:121541062-121541084 CTGGAGCTAGTGATGCTGGAAGG - Intergenic
1060205435 9:121680163-121680185 GTGTAGGAGGTGAGGCTGGGAGG + Intronic
1060206405 9:121685143-121685165 ATGGAGGGAGTGAGGGTGGAGGG - Intronic
1060449189 9:123721280-123721302 TGGCAGGAAATGAGGCTGGAAGG - Intronic
1060545187 9:124455119-124455141 CTCCGTGAAGTGAGGCTGGCAGG + Exonic
1060943631 9:127557464-127557486 CTGCAGGAAGAGGGGAGGGAGGG + Intronic
1061133936 9:128722878-128722900 TGGCAGGAAGTGAGGGAGGAAGG + Intronic
1061747852 9:132753321-132753343 CTGCAGGATGTGGGCCTGGCTGG + Intronic
1061851289 9:133417606-133417628 CTGCAAGAGGTGAGGCTTGAGGG - Exonic
1062311610 9:135940944-135940966 CTGCATGAAGTCAGCCTGGGTGG - Intronic
1062399821 9:136367443-136367465 CAGCAGGAAGTGGGGCTGCAGGG - Intronic
1062423711 9:136496596-136496618 CTGCACCAGGTGAGGCTGGGTGG + Exonic
1062480314 9:136747998-136748020 CTGCAGAACTGGAGGCTGGAGGG - Intronic
1062525798 9:136977664-136977686 CTGCTGGAAGTTGGGCTGCACGG - Exonic
1062533731 9:137012623-137012645 AGGCAGGCAGTGAGGCTAGAGGG + Intronic
1062539206 9:137034269-137034291 CTGGAGGGAGGGGGGCTGGAGGG + Intronic
1062656664 9:137607192-137607214 CTGCTGCAAGTGAGGTGGGAGGG + Intronic
1203572513 Un_KI270744v1:144168-144190 CTGCAGGAGGAGAGCCTGCAGGG + Intergenic
1203606001 Un_KI270748v1:58056-58078 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1185736568 X:2500687-2500709 CTCCCGGAAGTGGGGCTGGGCGG - Intronic
1185952473 X:4451950-4451972 CTTCAGTGAGGGAGGCTGGATGG + Intergenic
1186684948 X:11916243-11916265 TGGCAGAAAGTGAGGCTAGAAGG + Intergenic
1187176144 X:16897915-16897937 ATGGAGAGAGTGAGGCTGGAGGG + Intergenic
1187531707 X:20103089-20103111 TGGCAGGAAGTGAGGTTGGTGGG - Intronic
1189278613 X:39805188-39805210 TTCCAGGCAGTGTGGCTGGAGGG + Intergenic
1189571871 X:42306775-42306797 CTGGAGTCAGGGAGGCTGGATGG + Intergenic
1190529597 X:51361591-51361613 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
1190642270 X:52492375-52492397 AGGCAGGAAGGGAGGCAGGAAGG - Intergenic
1190645403 X:52520492-52520514 AGGCAGGAAGGGAGGCAGGAAGG + Intronic
1190727460 X:53198938-53198960 CTGGAGGAAGTGGGGCAAGAAGG - Intronic
1191930535 X:66366731-66366753 CTGGAGGCAGTGAGGCAGTATGG - Intergenic
1192271843 X:69588224-69588246 CTGCAGGAAGTCATGAAGGAAGG - Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192547182 X:72023802-72023824 CTGGAGGCAGGGAGGCTGGTGGG + Intergenic
1192930263 X:75799319-75799341 CTGGAGCCAGAGAGGCTGGACGG - Intergenic
1193719523 X:84971498-84971520 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1194286771 X:92020354-92020376 CTGGAGCCAGGGAGGCTGGATGG + Intronic
1194851949 X:98881114-98881136 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
1196607363 X:117671824-117671846 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1196685859 X:118509787-118509809 CTGGAGGAAGTGAGGCTTTTTGG - Intronic
1197602157 X:128543462-128543484 CTGCAGCCAGGGAGGCTGGACGG - Intergenic
1197758494 X:130012454-130012476 CTACAGGAAGTGAGGTAGGAAGG + Intronic
1199790790 X:151153251-151153273 CCGCAGGCAGTTAGGATGGATGG - Intergenic
1200061782 X:153487044-153487066 CTGGAGGGAGGGAGGCTGGCTGG - Exonic
1200604317 Y:5244914-5244936 CTGGAGCCAGGGAGGCTGGATGG + Intronic
1200980562 Y:9259921-9259943 CTGCAGGTTCTGAGGCTGGGTGG - Intergenic
1202092523 Y:21208840-21208862 CTGGAGCAAGGGAGGCTGGAGGG + Intergenic
1202149034 Y:21828160-21828182 CTGCAGGTCCTGAGGCTGCATGG - Intergenic
1202388168 Y:24344493-24344515 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1202482619 Y:25325635-25325657 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
1202588682 Y:26459184-26459206 ATGAAGGAAGTGAGGCTTGGAGG - Intergenic