ID: 904939348

View in Genome Browser
Species Human (GRCh38)
Location 1:34154298-34154320
Sequence CACCATGGAAATGGTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904939348_904939351 -5 Left 904939348 1:34154298-34154320 CCTGGCACACCATTTCCATGGTG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 904939351 1:34154316-34154338 TGGTGCTCTGAAAAACATCATGG 0: 1
1: 0
2: 5
3: 14
4: 234
904939348_904939353 28 Left 904939348 1:34154298-34154320 CCTGGCACACCATTTCCATGGTG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 904939353 1:34154349-34154371 AAAATTAACACACTAACCCAGGG 0: 1
1: 0
2: 1
3: 17
4: 280
904939348_904939352 27 Left 904939348 1:34154298-34154320 CCTGGCACACCATTTCCATGGTG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 904939352 1:34154348-34154370 AAAAATTAACACACTAACCCAGG 0: 1
1: 0
2: 0
3: 19
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904939348 Original CRISPR CACCATGGAAATGGTGTGCC AGG (reversed) Intronic
901231290 1:7642871-7642893 CCCCTTGGACATGGTGTGCAGGG - Intronic
901613152 1:10515490-10515512 CACCCTGGAAAGAGAGTGCCTGG + Intronic
901760632 1:11469043-11469065 CCCCATGGAAAGGATGTGCTGGG + Intergenic
903739058 1:25547740-25547762 CAACATGGAAATGGTGTGCAGGG + Intronic
904004347 1:27356016-27356038 CACCATCCAAATGGTGAGTCGGG - Exonic
904939348 1:34154298-34154320 CACCATGGAAATGGTGTGCCAGG - Intronic
907445706 1:54506492-54506514 CACCATGGACATGAAGAGCCTGG + Intergenic
908411237 1:63867808-63867830 GACCATGGAAATGATGGGCAGGG + Intronic
912602456 1:110950801-110950823 TACCATGGAAAAGGTGAGACAGG - Intronic
918135864 1:181673539-181673561 CACCTTGGAAAAGCTGTTCCTGG - Intronic
919060496 1:192626089-192626111 CAGCATGCAAATGTTGTACCTGG + Intergenic
920267411 1:204734420-204734442 CAGCATGGAAGTGGTGTGACTGG + Intergenic
920764415 1:208818103-208818125 CTCCATGGAGATGGTGTGGAGGG - Intergenic
923006311 1:230052828-230052850 CACCCTGGATATGGTGAGCAGGG - Intergenic
924563981 1:245180702-245180724 CACCATGGAAATGGTGGTGGTGG + Intronic
1069752235 10:70752036-70752058 CACCAGGGCAATGGGGGGCCTGG + Intronic
1072038411 10:91585200-91585222 CACCATGGAAATAATGTGTAAGG + Intergenic
1072308401 10:94130624-94130646 GGCCATGGAGATGGTGTGCTGGG - Intronic
1074826790 10:117220521-117220543 CACCAGGCAAATGTGGTGCCTGG - Intergenic
1075060503 10:119253622-119253644 CACCATAAAAATGGTGTGAGTGG + Intronic
1077477296 11:2796552-2796574 CCCCATGGAGAGGGTGTGTCGGG - Intronic
1078449756 11:11431974-11431996 CACCAGGGAAAAGGGGTGGCTGG + Intronic
1079701236 11:23551181-23551203 CACCATGGAAAATCTGTGGCTGG - Intergenic
1081638755 11:44738633-44738655 CACCAGGGAAAGGCTGTGCGAGG - Intronic
1083548886 11:63570412-63570434 CTACAAAGAAATGGTGTGCCTGG - Intergenic
1085151287 11:74254496-74254518 GCCCTTGGAAATGGCGTGCCTGG - Exonic
1086331917 11:85762668-85762690 AACCAGGGAAATGCTGTTCCAGG - Intronic
1089553422 11:119299777-119299799 CAGCAGGGAGATGGTGTGCTAGG - Exonic
1089875474 11:121717350-121717372 CACCATGGATTTAGTCTGCCAGG + Intergenic
1090135254 11:124191145-124191167 CTCCCTGGAAATAGTGTGCTTGG - Intergenic
1091380473 12:54978-55000 CTCCAAGGAAATGGTGTCCTGGG + Intergenic
1091917650 12:4281128-4281150 CCACATGAAAATGGTGTGCTAGG + Intronic
1099382182 12:81968593-81968615 CACTATGCAAATGGCATGCCTGG - Intergenic
1101259636 12:103014890-103014912 CACCAGAGAAATGCTCTGCCGGG + Intergenic
1101832952 12:108273484-108273506 ATCCATGGAAAGGGTGTGCTGGG - Intergenic
1103940368 12:124498259-124498281 CACCATGGTAAGCGTGTGCCAGG - Intronic
1104602545 12:130163008-130163030 CTCCATGGACATGGAGCGCCCGG + Exonic
1107659470 13:42624283-42624305 CATGATGGAAATGGTCTTCCTGG + Intergenic
1114645000 14:24250655-24250677 CACTGAGGAAGTGGTGTGCCAGG - Intronic
1121540113 14:94719309-94719331 CACCATGGAAATCTTTGGCCTGG - Intergenic
1121670025 14:95701993-95702015 CACCATGTCAATGTTGTTCCTGG - Intergenic
1122054236 14:99081806-99081828 CACCTTAGGAATGGTGAGCCTGG - Intergenic
1122330592 14:100909736-100909758 CAGCAAGGAAATGCTGAGCCAGG - Intergenic
1123033040 14:105460166-105460188 CACCTGGGGAGTGGTGTGCCTGG + Intronic
1202833425 14_GL000009v2_random:59711-59733 CACCTCTGCAATGGTGTGCCAGG - Intergenic
1128896803 15:71381393-71381415 CACCAAGGAAATGCTTTGGCAGG - Intronic
1131472666 15:92710286-92710308 CACCAGGGCACTGGTGTGTCCGG + Intronic
1136540491 16:30925387-30925409 CACCACGGACAAGGAGTGCCTGG + Intronic
1138093507 16:54194771-54194793 CCCCATGGGAATGGTGTCCTGGG + Intergenic
1140226613 16:73082674-73082696 CACGAGGGAAGTGGTGTGCCTGG + Intergenic
1145175661 17:20698673-20698695 CAGCATGGCACAGGTGTGCCAGG + Intergenic
1151920195 17:77148773-77148795 CACAATGGAAAGTGTGTGGCAGG - Intronic
1153172560 18:2332902-2332924 CACCTTGGAATTGTTGTACCTGG - Intergenic
1154301158 18:13193659-13193681 CAACATGGAGATGGGGTGGCTGG + Intergenic
1154514441 18:15146177-15146199 CACCTTGGAAATGAAGTGCATGG - Intergenic
1156228320 18:35130446-35130468 CAGGATGGATATGGTTTGCCAGG + Intronic
1158884781 18:61816445-61816467 CACCATGGAGACGCTGTCCCAGG - Exonic
1160344810 18:78124025-78124047 CAGCACGGAAAGGGTGGGCCAGG + Intergenic
1160806405 19:994076-994098 CACCATGGAGAAGGTGGGCGGGG + Exonic
1161064134 19:2229262-2229284 CTCCAGGGACATGGCGTGCCTGG + Intronic
1165368389 19:35384987-35385009 CACCATGGATATTTTGTTCCTGG + Intergenic
1166002916 19:39888957-39888979 CACCATGGACGTGAAGTGCCTGG + Intronic
1166005703 19:39905209-39905231 CACCATGGACGTGAAGTGCCTGG + Intronic
1166063660 19:40343551-40343573 CACCCTGGAGGTGTTGTGCCTGG + Intronic
1166525790 19:43508772-43508794 CACCATGGTAATCGTGAGCAGGG + Exonic
927712103 2:25332408-25332430 ATCCCTGGACATGGTGTGCCAGG + Intronic
933302710 2:80560620-80560642 CAGCATGGATATGTTTTGCCTGG - Intronic
935009575 2:99120713-99120735 CACCATGCACATGGTGTATCTGG - Intronic
935433569 2:103004069-103004091 CACCATGGAAATTGTCTTTCAGG + Intergenic
936386116 2:112030748-112030770 CACCCTGGAGATTGGGTGCCTGG - Intergenic
936411391 2:112261162-112261184 CACCATGTAAATGGCGCACCTGG + Intergenic
938514687 2:131990800-131990822 CACCTTGGAAATGAAGTGCATGG - Intergenic
938684918 2:133728948-133728970 CACCATGCAAATGCAGTGCATGG - Intergenic
943145121 2:184034044-184034066 CACAATGGCAATGGTGTTCCTGG - Intergenic
947574377 2:231260981-231261003 GACCATGGCCAGGGTGTGCCTGG - Intronic
1171727439 20:28638098-28638120 CAGCATAGAAATGGTGGTCCAGG - Intergenic
1171750799 20:29046521-29046543 CAGCATGGAAATGGTGGTCCAGG + Intergenic
1171968555 20:31549051-31549073 CACCAAGGACCTGGTGTGCCTGG + Exonic
1172860014 20:38041967-38041989 CTCCATGTAAGTGGTGTCCCAGG + Intronic
1175072603 20:56346789-56346811 CACCTTGGATATGGGGTGCTGGG + Intergenic
1175240474 20:57544317-57544339 CACAATTAAAATGGGGTGCCTGG - Intergenic
1176313962 21:5224399-5224421 CAGCATGGAAATGGTGGTCCAGG - Intergenic
1178978163 21:37238567-37238589 CACCATAGAAATGGTGAAGCCGG - Exonic
1180391778 22:12290517-12290539 CAGCATGGAAATGATGGTCCAGG - Intergenic
1180407966 22:12574239-12574261 CAGCATGGAAATGATGGTCCAGG + Intergenic
1181279539 22:21709272-21709294 CACCGAGGAAATGGGGTGCCTGG + Intronic
1181886275 22:26024673-26024695 CGCCATGGCAATGATGGGCCCGG - Intronic
1182696787 22:32203724-32203746 CACCATGGCACTGATGTCCCAGG + Intergenic
1183358491 22:37371682-37371704 CACCATGGTAACCCTGTGCCTGG - Exonic
1183931027 22:41236391-41236413 GGGCATGGACATGGTGTGCCTGG + Intronic
950123563 3:10497662-10497684 CAGCATGGAAATGGTGGAGCAGG + Intronic
950166940 3:10808274-10808296 GACCATGTGAATGGTGTCCCTGG + Intergenic
950270089 3:11606994-11607016 CACCATGGCCATGCTGTGTCCGG - Intronic
951052899 3:18114397-18114419 CACCAGCCAAATGGTGTGCCAGG - Intronic
952541517 3:34372464-34372486 CACCTTGAGAATGATGTGCCTGG + Intergenic
952937775 3:38413591-38413613 CAGCATGGAAAGGGTGAGCATGG - Exonic
953786099 3:45912461-45912483 CACTGTTGAAATGATGTGCCAGG + Intronic
953843986 3:46412458-46412480 CACCAACGTAATGGAGTGCCTGG - Intronic
953931454 3:47007870-47007892 CACCATGCACGTGGTGTCCCGGG - Exonic
954178728 3:48864826-48864848 CACAATGGAGATGGTGTGAAGGG + Intronic
954269147 3:49493852-49493874 GACCAGTGAAATGGTGGGCCAGG - Intronic
956164510 3:66386239-66386261 CACCATGGCTATGGTGGGCAAGG - Exonic
956206044 3:66755493-66755515 CACCATAGAACTTGAGTGCCTGG - Intergenic
960727632 3:120686446-120686468 CTTCATGGAAATGATGTGCAGGG - Intergenic
961032482 3:123618592-123618614 CACCATGAATAGGGTGTGGCTGG - Intronic
961088608 3:124091049-124091071 CACCCTTGAAATGGTATCCCTGG + Intronic
966233631 3:177675633-177675655 CTCCAAGGATATTGTGTGCCTGG + Intergenic
968581832 4:1398879-1398901 TGCCATGGCAATGGTGTGCCTGG - Intergenic
968602597 4:1517390-1517412 CACCATGGTGTGGGTGTGCCGGG - Intergenic
969124894 4:4939882-4939904 CTTCATGGAAATGGGGTGGCAGG + Intergenic
969639746 4:8389609-8389631 CACCGTGGACCTGGTGTGCCAGG + Exonic
970342646 4:15122447-15122469 TACCTTGGAAATGGTGTCCAGGG + Intergenic
974099630 4:57402532-57402554 CAGCATGGAAATGCTCAGCCAGG + Intergenic
977182741 4:93897866-93897888 CAGCATGGAAATAGTGTGATTGG + Intergenic
980343288 4:131579830-131579852 CAAAATGTAAATGGTGTCCCTGG + Intergenic
983562783 4:169117651-169117673 CTCCAGGGAAATGGCGTGGCTGG - Exonic
983617360 4:169722877-169722899 GACCATGAAATTGTTGTGCCTGG + Intronic
985433159 4:189900950-189900972 CAGCATAGAAATGGTGGTCCAGG + Intergenic
1202766596 4_GL000008v2_random:153854-153876 CACCTCTGCAATGGTGTGCCAGG + Intergenic
987989042 5:25186725-25186747 TACCATGGAAATGGAGGGCTTGG + Intergenic
989318197 5:40106048-40106070 CACCAGGGAAATGGGGAGCGGGG + Intergenic
995898593 5:117043682-117043704 CAACATGTAAATGCTGTGCATGG + Intergenic
996191309 5:120546289-120546311 CACAATGGTAATGATGTACCTGG + Intronic
999722344 5:154408110-154408132 CACCATATAAATGGTGTGGCTGG - Intronic
999862892 5:155667489-155667511 CACCATGGAAATGAGGTGATTGG + Intergenic
1000817927 5:165946654-165946676 TACCATAGAAAGAGTGTGCCTGG + Intergenic
1004529045 6:16436661-16436683 CACCATCGAGGTGGTGTTCCTGG + Intronic
1007313997 6:40969713-40969735 CAGCAAGGAAATGGTGGGTCAGG - Intergenic
1007372287 6:41433848-41433870 CACAATGGAAAAGTTGGGCCCGG + Intergenic
1014683775 6:124469072-124469094 CACCATGTGAATGGTGCCCCTGG + Intronic
1016299318 6:142612402-142612424 CACCATGGAAAGGTTGTGTGAGG - Intergenic
1016795181 6:148110164-148110186 CACCATGGTAAGCCTGTGCCGGG + Intergenic
1017518097 6:155176091-155176113 GACCATGGACAAGGTGTGTCTGG + Intronic
1018238360 6:161748568-161748590 GTCCATGGAAATGGGGTTCCTGG + Intronic
1022926130 7:35057770-35057792 CAACATGGAGTTGCTGTGCCAGG - Intergenic
1023871246 7:44264102-44264124 CACCATGGGAAAGGTGAGCAGGG + Intronic
1026376397 7:69755246-69755268 TATCATGGAAATGGTATGCAAGG + Intronic
1026541393 7:71282829-71282851 CTACCTGGAAATGGTTTGCCAGG + Intronic
1027842051 7:83325144-83325166 CACCATGAAATTGGTTTCCCTGG - Intergenic
1029450032 7:100636136-100636158 GACCAGGGAAGTGGAGTGCCTGG - Intronic
1029824140 7:103172457-103172479 CAACATGGAGTTGCTGTGCCAGG - Intergenic
1030860759 7:114623859-114623881 CAGCAGGGAAATAGTGTGACAGG - Intronic
1031492064 7:122401528-122401550 AACTATGGAAATAGTGTGCAAGG + Intronic
1032101248 7:128980013-128980035 CACAATGGGATTGGTATGCCTGG + Exonic
1034062422 7:148105362-148105384 CACCATGACAATGGTGTGTGTGG - Intronic
1034876579 7:154729930-154729952 AGCCCTAGAAATGGTGTGCCCGG + Intronic
1035497106 8:61852-61874 CACCATGGCTTTGGAGTGCCTGG - Intergenic
1035787882 8:2276917-2276939 CATCATGGAAATGGCCTGTCTGG + Intergenic
1035804928 8:2444799-2444821 CATCATGGAAATGGCCTGTCTGG - Intergenic
1037209403 8:16367519-16367541 CACCATTGAAATGGTGTCATTGG - Intronic
1038278660 8:26143013-26143035 CACACTAGAAATGGTGTCCCAGG + Intergenic
1038675474 8:29618918-29618940 AAATATGGACATGGTGTGCCTGG + Intergenic
1039010212 8:33085614-33085636 CACCATGGAAATTGTGGCCAAGG + Intergenic
1043800663 8:84605779-84605801 CAGTATGTAAATGGTGTGCTAGG - Intronic
1048991207 8:139761254-139761276 CACCCTATAAATGGTGTGTCTGG - Intronic
1049157261 8:141074772-141074794 CACGCTGGGAATTGTGTGCCTGG + Intergenic
1050416075 9:5418958-5418980 CACCATGGAGACGCTGTCCCAGG - Intronic
1050826479 9:9952396-9952418 CAACCGGGAAATGGTGTTCCTGG + Intronic
1052043479 9:23767974-23767996 GACCATGGCAATGGAGTGGCTGG - Intronic
1052517436 9:29501600-29501622 CCCCAGGGAAATGGTTTCCCTGG - Intergenic
1052963281 9:34318967-34318989 CACCAAGGACATGGAGTGCATGG + Intronic
1053722301 9:40959005-40959027 CAGCATAGAAATGGTGGTCCAGG + Intergenic
1054343668 9:63892993-63893015 CAGCATAGAAATGGTGGTCCAGG - Intergenic
1056751013 9:89351172-89351194 CACCACAGAGATGCTGTGCCTGG + Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057783823 9:98072037-98072059 CACCAAGCAAATGGGCTGCCTGG - Intronic
1058255547 9:102758149-102758171 CAACAGGGAAATGGTGTCTCTGG + Intergenic
1059800892 9:117748589-117748611 AACCATAGCAATGGTGTACCAGG - Intergenic
1062245143 9:135562304-135562326 CGCCATGGCCATGGAGTGCCAGG - Exonic
1062249856 9:135588603-135588625 CACCATGGCCATGGAGTACCAGG - Intergenic
1203452875 Un_GL000219v1:136975-136997 CAGCATAGAAATGGTGGTCCAGG - Intergenic
1203547396 Un_KI270743v1:138956-138978 CACCTCTGCAATGGTGTGCCAGG - Intergenic
1185832837 X:3317761-3317783 CACCATTGCAATGGAGTGTCTGG - Exonic
1186235781 X:7507915-7507937 GACCATGGAAATGGCTTCCCAGG - Intergenic
1186515121 X:10161183-10161205 CACCATGAAAATGGTCTCCTGGG + Intronic
1186864447 X:13705730-13705752 CAACATGGAAATTGTGTGAAAGG + Intronic
1188505599 X:30880404-30880426 TAGCAGGGAAATGGTGTGCTGGG + Intronic
1189669904 X:43396478-43396500 CACCATAGAAAAGGTGTTCTAGG + Intergenic
1190026011 X:46923845-46923867 AACCATGGAGCTGGTTTGCCAGG + Intronic
1191730000 X:64323157-64323179 CCCCCTGGAATTGGTATGCCTGG - Intronic
1192565148 X:72157339-72157361 CACCCTGGAACTGGGGTTCCAGG - Intergenic
1193401952 X:81055479-81055501 CACCATGGGAGTGTTGTGGCCGG + Intergenic
1197857043 X:130925397-130925419 CAACATGGAAGTGGTGCACCTGG - Intergenic