ID: 904939911

View in Genome Browser
Species Human (GRCh38)
Location 1:34158434-34158456
Sequence CAGTGCATTCTCGAGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904939901_904939911 10 Left 904939901 1:34158401-34158423 CCACCCAAGGAGATAAATCCAGG 0: 1
1: 0
2: 1
3: 7
4: 137
Right 904939911 1:34158434-34158456 CAGTGCATTCTCGAGGTAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 69
904939908_904939911 -8 Left 904939908 1:34158419-34158441 CCAGGGAGGGCAATGCAGTGCAT 0: 1
1: 0
2: 0
3: 9
4: 162
Right 904939911 1:34158434-34158456 CAGTGCATTCTCGAGGTAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 69
904939905_904939911 6 Left 904939905 1:34158405-34158427 CCAAGGAGATAAATCCAGGGAGG 0: 1
1: 1
2: 2
3: 30
4: 246
Right 904939911 1:34158434-34158456 CAGTGCATTCTCGAGGTAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 69
904939904_904939911 7 Left 904939904 1:34158404-34158426 CCCAAGGAGATAAATCCAGGGAG 0: 1
1: 0
2: 2
3: 27
4: 242
Right 904939911 1:34158434-34158456 CAGTGCATTCTCGAGGTAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 69
904939900_904939911 17 Left 904939900 1:34158394-34158416 CCATATGCCACCCAAGGAGATAA 0: 1
1: 0
2: 0
3: 30
4: 190
Right 904939911 1:34158434-34158456 CAGTGCATTCTCGAGGTAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904939911 Original CRISPR CAGTGCATTCTCGAGGTAGA GGG Intronic
900495482 1:2974151-2974173 CTGTGCCTTCTCCAGGTGGACGG + Intergenic
904939911 1:34158434-34158456 CAGTGCATTCTCGAGGTAGAGGG + Intronic
916081466 1:161235761-161235783 CAGTGCATTCTCTACATAGCAGG - Intronic
921123571 1:212157578-212157600 CAATGCGTTCTGGAGGAAGAGGG - Intergenic
923079736 1:230642175-230642197 CAGAGCAGTCTCAGGGTAGAAGG + Intergenic
924588597 1:245381662-245381684 CAGAGTATTCTGGAGGTGGATGG - Intronic
1069596125 10:69672033-69672055 CTGTGCCTTCACAAGGTAGAAGG + Intergenic
1070515279 10:77199778-77199800 CAGTGCATTCTGGGAGTGGAAGG + Intronic
1075528891 10:123210260-123210282 CAGGGCATGCTCGAGGTGGGGGG + Intergenic
1080952013 11:37044902-37044924 CAGGGAATTCTGGAGGTATATGG - Intergenic
1090226948 11:125077361-125077383 CAGCCCCTTCTCGAGGAAGAGGG - Intronic
1096534741 12:52264136-52264158 CTGTGCAATCTCCAGGTTGAGGG - Intronic
1108429854 13:50342603-50342625 CAGTGAATTTTAGAGATAGAAGG + Intronic
1119136142 14:72222280-72222302 CAGGGAATTCTCCAGGTAAATGG + Intronic
1120862479 14:89267196-89267218 CAGTGGGTTCTCAGGGTAGACGG + Intronic
1121284791 14:92726725-92726747 CAGTGCATGGCCCAGGTAGATGG - Intronic
1122134017 14:99622307-99622329 CAGTGCAATCTAGAGTTAGAGGG - Intergenic
1124043683 15:26127980-26128002 CAGTGCAGTCTAGGGGTACATGG + Intergenic
1136576073 16:31126174-31126196 AAGGGCATTCTCCAGGTAGAAGG + Intronic
1146648363 17:34590438-34590460 CAGAGCATTGTGGAGGAAGAGGG + Intronic
1158207675 18:55011541-55011563 CACTGCATTCCAGAGATAGAGGG + Intergenic
1165418939 19:35713238-35713260 GTGTGCATTCTGGAGGTAGAGGG + Intronic
1166830558 19:45637119-45637141 CAGAGCCTTCTCGAGGCAGCTGG - Intronic
1167297696 19:48661594-48661616 CAGTGCACCGTCGAGGTAGAAGG + Exonic
925144820 2:1574233-1574255 CAGAGCATTCTCCAGGCAGGTGG + Intergenic
926293255 2:11547875-11547897 CAGTGTGTTCTTGGGGTAGAAGG - Intronic
929760294 2:44801278-44801300 GAATGCATTCTGGAGGAAGAAGG + Intergenic
933512365 2:83257224-83257246 CAGTGCAATCTGGAGATAAAAGG + Intergenic
934744986 2:96753451-96753473 CAGTGCATTCAGCAGGTAGAGGG + Intergenic
935089872 2:99884885-99884907 CAGTGAATCCCCCAGGTAGAGGG - Intronic
937316876 2:120937391-120937413 CTGTGCCTCCTGGAGGTAGAAGG - Intronic
946497720 2:220212816-220212838 CAGTGCATTCCCTTTGTAGATGG - Intergenic
1174177366 20:48653440-48653462 CAGTGCATTCTGAAGGTCAATGG - Exonic
1174267144 20:49340223-49340245 CAGTGCAGTCACAAGCTAGAGGG + Intergenic
1174531194 20:51215643-51215665 CAGTGTATTCTCCTGGCAGATGG + Intergenic
1176220459 20:63967117-63967139 CACTGCAGTCCCGAGGTTGAGGG - Intronic
1184487109 22:44786408-44786430 CAGTGCATTCTCCAGTAAGGCGG - Intronic
960111017 3:113844809-113844831 CAGTGCATTCTAGTGGTCAAAGG - Intronic
960966367 3:123107695-123107717 CAGTGCTTTTTGTAGGTAGAGGG + Intronic
961043346 3:123692817-123692839 CAGTGCCTTCTCGATGGAGACGG + Exonic
962422656 3:135241808-135241830 GAGTGAATTCTCAAGGAAGAAGG - Intronic
965113159 3:164452270-164452292 CAGTGCATTATTTAGGTAAATGG + Intergenic
967136214 3:186515035-186515057 CAGTGCATTATCTTTGTAGAAGG - Intergenic
968552317 4:1229938-1229960 CTGGGCATTCTCCAGGAAGAAGG + Intronic
972882335 4:43440671-43440693 CAGTGCATTCTACAGAGAGATGG - Intergenic
976025858 4:80687663-80687685 CAGGGCATTCTGGAGGGAGGAGG + Intronic
976040896 4:80884020-80884042 CAGTGCATACTGGAGGGTGAAGG - Intronic
980566009 4:134542270-134542292 TTGAGCATTCTCCAGGTAGAAGG + Intergenic
981965470 4:150595829-150595851 CAGAGCATTTTAGATGTAGAAGG - Intronic
984656338 4:182322668-182322690 CAGTGCATGCTCGAGAGAGTGGG + Intronic
988909818 5:35827841-35827863 CAATGCATCATTGAGGTAGAAGG + Intergenic
990504917 5:56434487-56434509 CAGAGCATTGTAGAGGTGGAAGG - Intergenic
990794184 5:59521275-59521297 CAGTGCATTCCTGATGTATAAGG + Intronic
992074461 5:73177850-73177872 AAGTGCCTTCTAGAGGTGGAGGG + Intergenic
1000473215 5:161672249-161672271 CAGTGAAATCTCTAGGTAAAGGG + Intronic
1003630771 6:7784832-7784854 CTGTGCAATCCCAAGGTAGAAGG - Intronic
1007811210 6:44487084-44487106 CATGCCATTCTCCAGGTAGATGG + Intergenic
1013199729 6:107881692-107881714 CAGTTCAGTCCTGAGGTAGAAGG - Intronic
1014490599 6:122057170-122057192 GAGTGCATTCTCAGGGAAGAAGG + Intergenic
1016208761 6:141503622-141503644 AAGTGGATTATTGAGGTAGAAGG - Intergenic
1023907870 7:44534854-44534876 CAATGCATGCTCAAGGAAGATGG - Intronic
1024905864 7:54378600-54378622 CAGTGATTTCCAGAGGTAGAGGG - Intergenic
1026273628 7:68857940-68857962 CATTGCATTCTCTTGGTTGAAGG + Intergenic
1026474083 7:70719097-70719119 CAGTGCCCTTTTGAGGTAGATGG + Intronic
1031956194 7:127944928-127944950 CAGTGTAATCTCTAGGAAGATGG - Intronic
1032866383 7:135929449-135929471 GAGTGCATTCTTAAGGCAGAAGG + Exonic
1034429900 7:151036036-151036058 CAGTGCATTCAGGAGGCAGCTGG - Intronic
1035812677 8:2505602-2505624 CAGTGCATTCTCAGGGAAGCCGG - Intergenic
1038735569 8:30166155-30166177 CAATGCATTCTTCAGTTAGAAGG + Intronic
1042378956 8:68090614-68090636 CAGTGCATTATCAAGGTGAATGG + Exonic
1046581461 8:116098193-116098215 CTGTGCCTTCTCGTGGCAGATGG - Intergenic
1047731961 8:127735695-127735717 CAGTGCGTTCTCGGTGTGGAGGG + Intronic
1056631090 9:88293705-88293727 CTGTGCTATCTCCAGGTAGATGG - Intergenic
1195849834 X:109271165-109271187 GGGAGCATTCTTGAGGTAGAGGG - Intergenic
1196042880 X:111224819-111224841 CAGTGACTTCTCTAGGTATAGGG - Intronic
1198005197 X:132486723-132486745 CAAAGCATTATCTAGGTAGAGGG + Intronic