ID: 904940183

View in Genome Browser
Species Human (GRCh38)
Location 1:34160239-34160261
Sequence GTGCCCACCATATCTAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904940183 Original CRISPR GTGCCCACCATATCTAGGGC TGG (reversed) Intronic
900503299 1:3017029-3017051 CTGGCCACCAGATGTAGGGCCGG + Intergenic
901266693 1:7915995-7916017 GTGCCCACCGCAGCTAGGGCAGG - Exonic
902502811 1:16922095-16922117 GTGCCCACCCTGTCTGGGGCGGG + Intronic
902958577 1:19944749-19944771 GTGCCCACCAGATTAAGGGTGGG - Intergenic
903228837 1:21909770-21909792 GTGCCCAAAATAGCTAGAGCAGG + Intronic
904335460 1:29794326-29794348 GTGCCCACCAGATTAAGGGTGGG - Intergenic
904578083 1:31518607-31518629 GTGCCCACCAGATTAAGGGTGGG - Intergenic
904940183 1:34160239-34160261 GTGCCCACCATATCTAGGGCTGG - Intronic
905451709 1:38061209-38061231 GTCCCTACCCTATCCAGGGCTGG - Intergenic
906247937 1:44290177-44290199 GTGCCCACCAGCTCCAGGACAGG + Intronic
910361174 1:86414733-86414755 GTGCCCACCAGATTAAGGGTGGG - Intergenic
910588544 1:88904233-88904255 GTGCCCACCAGATTAAGGGTAGG - Intergenic
910789553 1:91036938-91036960 GTGCCCACCAGATTAAGGGTGGG - Intergenic
910789880 1:91040002-91040024 GTGCCCACCAGATTAAGGGTGGG - Intergenic
910802171 1:91157844-91157866 GTGCCCACCAGATTAAGGGTGGG + Intergenic
913389423 1:118293883-118293905 GTGCCCACCATATTAAGGGTGGG + Intergenic
913653404 1:120939424-120939446 GTGCCCACCAGATTTAGGGTGGG + Intergenic
914167698 1:145189609-145189631 GTGCCCACCAGATTTAGGGTGGG - Intergenic
914383815 1:147147715-147147737 GTGCCCACCAGATTAAGGGTGGG - Intergenic
914519093 1:148399548-148399570 GTGCCCACCAGATTTAGGGTGGG + Intergenic
914643587 1:149633587-149633609 GTGCCCACCAGATTTAGGGTGGG + Intergenic
915244038 1:154543811-154543833 GTGCCCACCCCCTCTAGGGTGGG - Intronic
917389516 1:174519479-174519501 GTGCCCACCAGATTAAGGGTGGG + Intronic
917462284 1:175242381-175242403 GTGCCCACCAGATTAAGGGTGGG - Intergenic
918126567 1:181589107-181589129 TGGCCCACCAGATCTGGGGCAGG - Intronic
918681657 1:187362714-187362736 GTGCCCACCAGATTAAGGGTGGG - Intergenic
919515528 1:198517375-198517397 GTGCCCACCAGATTAAGGGTGGG + Intergenic
919974595 1:202602490-202602512 GTGCCTCCCATGTCCAGGGCAGG + Exonic
920386367 1:205572587-205572609 GGGGCCAGCATATCTAGGGGTGG - Intronic
921008303 1:211115447-211115469 GTGCCCACCAGATTAAGGGTGGG - Intronic
921352105 1:214246441-214246463 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1063238074 10:4139971-4139993 GTGCCCACCATATTAAGGGTGGG - Intergenic
1064469256 10:15618603-15618625 GTGCCCACCAGATTCAGGGTGGG - Intronic
1065028057 10:21557744-21557766 GTGCCCATCATCTCTGTGGCTGG + Intronic
1065698878 10:28405397-28405419 ATGCCTATCATATCTAGGCCTGG + Intergenic
1065888328 10:30098403-30098425 ATCCCCACCACATCTAGGCCTGG + Intronic
1067754033 10:48991205-48991227 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1067754857 10:48997630-48997652 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1068557419 10:58474610-58474632 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1070695805 10:78562221-78562243 GTACCCAGCATGTCCAGGGCTGG + Intergenic
1070705274 10:78632944-78632966 GTGCACACCATGTCTGGGCCTGG + Intergenic
1071943239 10:90611330-90611352 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1072208938 10:93229192-93229214 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1072209745 10:93235601-93235623 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1073656351 10:105421969-105421991 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1076029588 10:127146039-127146061 CTGGCCACGATGTCTAGGGCTGG - Intronic
1079107913 11:17585611-17585633 GTGGCCAGCATATCCAGGTCAGG - Intronic
1083152805 11:60803606-60803628 GTGTTCACCCTTTCTAGGGCAGG + Intergenic
1084772887 11:71355781-71355803 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1086032124 11:82372539-82372561 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1086546207 11:87970522-87970544 GTGCACCCCATGCCTAGGGCGGG - Intergenic
1087388404 11:97503749-97503771 GTGCTCACTATATCTCTGGCTGG - Intergenic
1092648102 12:10601656-10601678 GAGCCCACCATATATATGCCAGG - Intergenic
1094289095 12:28826009-28826031 GTGCCGCCCACATCGAGGGCGGG + Intergenic
1095054297 12:37581727-37581749 GTGCCCAGAATCTCTAGGTCTGG - Intergenic
1095603624 12:44042511-44042533 GTGCCCACCAGATTAAGGGTGGG - Intronic
1096447567 12:51707558-51707580 GTGCCCACCACATTAAGGGTGGG + Intronic
1096685525 12:53286046-53286068 GTGGCCACCAGCTCTAGAGCAGG - Exonic
1096717863 12:53501781-53501803 GTGCCCACCTTAACTGAGGCAGG + Intronic
1099165107 12:79296102-79296124 GTGCCCCCCATGTCCAAGGCGGG - Exonic
1100083623 12:90880719-90880741 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1102349105 12:112179141-112179163 GTCCCCACCATACCCAGGCCGGG - Intronic
1102740414 12:115202273-115202295 GTGCCAACCATATATATGACAGG - Intergenic
1104771820 12:131368661-131368683 GTGCCCACCCCTTCTAGGGGAGG + Intergenic
1107019724 13:35739188-35739210 GTGCCCACCAGATTGAGGGTGGG - Intergenic
1107090489 13:36473970-36473992 GTGCCCACCATTGCTGAGGCTGG - Intergenic
1107445827 13:40469746-40469768 GTGCCCACCTTTCCTAGGGAGGG - Intergenic
1107783208 13:43927089-43927111 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1109516196 13:63444894-63444916 GTGCCCACCAGATTAAGGGTAGG - Intergenic
1109565086 13:64102745-64102767 GTGCCCACCAGATTGAGGGTGGG - Intergenic
1109609915 13:64751212-64751234 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1111385393 13:87520923-87520945 GTTCCACACATATCTAGGGCAGG - Intergenic
1112841693 13:103587148-103587170 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1113674903 13:112200427-112200449 GTGCCCACCAGAGCCAGGGCGGG + Intergenic
1114206182 14:20573242-20573264 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1116290475 14:43030368-43030390 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1117645039 14:57842857-57842879 GTGCCCACCAGATTGAGGGTGGG - Intronic
1119059390 14:71459711-71459733 GTGCCCACCAGATTAAGGGTGGG + Intronic
1119109287 14:71956652-71956674 GTGCCCACCAGATTAAGGGTGGG + Intronic
1119422068 14:74513154-74513176 GTGCCCAGCATGTTTGGGGCAGG - Intronic
1202935114 14_KI270725v1_random:80679-80701 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1123946978 15:25243543-25243565 GTGCTCACCACAGCTAGTGCAGG - Intergenic
1124430949 15:29608108-29608130 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1124968799 15:34463626-34463648 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1125410004 15:39396155-39396177 GTGCCCTCCATCTCTGAGGCTGG + Intergenic
1126619578 15:50623500-50623522 TTGCCCCCCAAATCCAGGGCGGG - Intronic
1132013931 15:98299767-98299789 GTGCCCACCAAATCTGAGGGCGG + Intergenic
1132550914 16:553513-553535 GTGACCACCATGCCTGGGGCAGG + Exonic
1133787718 16:8986096-8986118 GTGCCCACAATACCCAGGACAGG - Intergenic
1133881830 16:9789411-9789433 ATGTCCACCAGATCTAGGGAGGG - Intronic
1134341401 16:13350084-13350106 GAGCCCCCCATGTCAAGGGCAGG - Intergenic
1134859678 16:17550017-17550039 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1137365969 16:47859701-47859723 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1137852188 16:51756672-51756694 GTGCCCAGCATATCAGCGGCAGG - Intergenic
1138135629 16:54519041-54519063 ATGCACACCATTTCTAGGCCTGG - Intergenic
1139291236 16:65859778-65859800 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1140090430 16:71834019-71834041 GTGCCCACCAGATCAAGGGTGGG - Intergenic
1142177736 16:88652657-88652679 GTGCCCAGCATCTGTAGGGCCGG + Intronic
1142317085 16:89354511-89354533 GTGCCCTCCCTATCAAGAGCAGG - Intronic
1145374841 17:22337803-22337825 GTGCCCAGAATCTCTAGGTCTGG - Intergenic
1149565835 17:57639949-57639971 GTGTCCCCCGCATCTAGGGCAGG - Intronic
1151700887 17:75742080-75742102 CTGCCCACCTCATCAAGGGCTGG - Intronic
1154068021 18:11127435-11127457 GTGCCCACCAGATTAAGGGTGGG - Intronic
1155891805 18:31279375-31279397 ATGCCCACTAGCTCTAGGGCTGG + Intergenic
1157889066 18:51397214-51397236 TTGCCCAACATGGCTAGGGCAGG + Intergenic
1158073882 18:53506163-53506185 GTGTCCACCATATGTAAGGGTGG - Intronic
1159558781 18:69972915-69972937 GTGCCCACCAGATTAAGGGTAGG + Intergenic
1159559523 18:69978675-69978697 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1163380253 19:16961466-16961488 GTGCCCACCATTGCTGAGGCTGG + Intronic
1166254045 19:41589823-41589845 GTGCTTACCATCTCTAGGGGTGG - Intronic
926051667 2:9749121-9749143 GTGCCCAGCCTATGTAGGGCAGG + Intergenic
926159260 2:10476186-10476208 TTGCCCAGCATGTCCAGGGCTGG - Intergenic
926320970 2:11748159-11748181 GTCCCCACCTAATCCAGGGCAGG - Intronic
927708287 2:25310453-25310475 CTGCCCACCATATGGATGGCGGG + Intronic
929796870 2:45066463-45066485 GTGCCCACCAGATTAAGGGTGGG + Intergenic
932012793 2:67994805-67994827 ATGCCCACCCCATCCAGGGCAGG + Intergenic
933554844 2:83819350-83819372 GTGCCCACCAGATTAAGGGTGGG - Intergenic
934465519 2:94259702-94259724 GTGCCCACCAGATTAAGGGTGGG - Intergenic
934753539 2:96809708-96809730 CTGCCCCCCCTATCCAGGGCTGG - Exonic
937785773 2:125895649-125895671 GTGCCCACCAGATTAAGGGTGGG + Intergenic
937843519 2:126552131-126552153 GTGCCCACCAAATTAAGGGTGGG + Intergenic
938901802 2:135804754-135804776 GGACCCACCATACCTGGGGCTGG + Exonic
941715635 2:168760411-168760433 GTGCCCACCAGATTAAGGGTGGG + Intronic
941733822 2:168949834-168949856 GTGCCCACCAGATTAAGGGTGGG - Intronic
942886161 2:180926596-180926618 GTGCCCACCAGATTAAGGGTGGG - Intergenic
943299018 2:186173995-186174017 GTGCCCACCAGATTAAGGGTGGG - Intergenic
945146236 2:206741441-206741463 GTGCCCACCAGATTAAGGGTGGG - Intronic
1169838419 20:9906569-9906591 GTGCCCACCAGATTGAGGGTGGG + Intergenic
1171527961 20:25830620-25830642 GTGCCCATAATCTCTAGGTCTGG + Intronic
1171548865 20:26025260-26025282 GTGCCCATAATCTCTAGGTCTGG - Intergenic
1176078162 20:63258543-63258565 GTGGCCCCCAAATCTAGGCCTGG - Intronic
1176596537 21:8702907-8702929 GTGCCCACCAGATTAAGGGTCGG - Intergenic
1177003076 21:15637149-15637171 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1178238780 21:30875084-30875106 CTGCCCACCATAGCTAGAGGCGG + Intergenic
1179677114 21:42990899-42990921 GTGCCCTCCGTATCTACGGGGGG - Intronic
1180586662 22:16898888-16898910 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1182765910 22:32758427-32758449 GTGCCCACCAGATTAAGGGTGGG - Intronic
949165037 3:929753-929775 GTGCCCACCAGATTAAGGGTGGG - Intergenic
949417276 3:3828421-3828443 GTGCCCACCAGATTAAGGGTGGG + Intronic
949424970 3:3906918-3906940 GTGCCCAGCATACCCAGTGCAGG - Intronic
949635367 3:5976388-5976410 GTGCCCACCAGATTAAGGGTGGG + Intergenic
951362303 3:21739657-21739679 TTGCCCATCATAACAAGGGCAGG + Intronic
951384084 3:22024051-22024073 GTGCCCACCAGATTAAGGGTGGG - Intronic
951384837 3:22029999-22030021 GTGCCCACCAGATTAAGGGTGGG - Intronic
952931129 3:38361776-38361798 GTGCCCATCAAACCTTGGGCAGG - Intronic
953129622 3:40125470-40125492 GTGCCCACCAGATTAAGGGTGGG + Intronic
953192851 3:40704842-40704864 GTGCCCACCAGATTAAGGGTGGG - Intergenic
953882299 3:46696896-46696918 GGGCCCATCATATCTGGGGTTGG - Intergenic
957374239 3:79336002-79336024 GTTCCATACATATCTAGGGCAGG - Intronic
959263198 3:104105825-104105847 GTGCCCACCAGATTAAGGGTGGG + Intergenic
959606218 3:108244574-108244596 GTTCCAAACATCTCTAGGGCAGG - Intergenic
960630846 3:119728981-119729003 GTGCCCACCATATGCCAGGCAGG - Intronic
962898753 3:139738414-139738436 GTGCCCACCAGATTTAGGGTGGG - Intergenic
962965822 3:140353493-140353515 GTGCCCACCAGATTAAGGGGTGG + Intronic
964148365 3:153493732-153493754 GTGCCCACCAGATTAAGGGTGGG + Intronic
965008909 3:163060428-163060450 GTGCCCACCAGATTAAGGGTGGG + Intergenic
965434770 3:168636238-168636260 GTGGCCACCATGTCTAGGACTGG + Intergenic
967156633 3:186698366-186698388 GTGCCCACCAGATTAAGGGTGGG + Intergenic
970670017 4:18386024-18386046 GTGCCCAGAATATCTGGGCCAGG + Intergenic
972201725 4:36720816-36720838 GTGCCCACCAGATTAAGGGTGGG + Intergenic
975340582 4:73235223-73235245 GTGGCCACTATACCTAGGTCTGG + Intronic
978186318 4:105860563-105860585 GTGCCCACCATTGCTGAGGCTGG + Intronic
978898747 4:113924356-113924378 GTGCCCACCAGATTAAGGGTGGG + Intronic
978899533 4:113930402-113930424 GTGCCCACCAGATTAAGGGTGGG + Intronic
980265673 4:130512267-130512289 GTGCCCACCAGATTAAGGGTGGG + Intergenic
980527436 4:134010620-134010642 GTCTCCAACATCTCTAGGGCTGG + Intergenic
981835320 4:149046376-149046398 GTGCCCACCAGATTAAGGGTGGG - Intergenic
981900872 4:149860994-149861016 GTGCCCACCAGATTAAGGGTGGG + Intergenic
984306384 4:177997249-177997271 GTGCCCACCAGATTAAGGGTGGG + Intergenic
987125157 5:14805114-14805136 GTGCCCACCAGATTAAGGGTGGG - Intronic
987906408 5:24083244-24083266 GTGCCCACCAGATTAAGGGTGGG - Intronic
988160512 5:27514393-27514415 GTGCCCACCAGATCAAGGGTGGG + Intergenic
988161254 5:27520528-27520550 GTGCCCACCAGATCAAGGGTGGG + Intergenic
989307189 5:39972129-39972151 GTGCCCACCAGATTAAGGGTGGG + Intergenic
991033874 5:62108397-62108419 GTGCCCACCAGATTAAGGGTGGG - Intergenic
991133545 5:63154716-63154738 GTTCCCACCAGATTAAGGGCCGG - Intergenic
994494810 5:100498431-100498453 GTGCCCACCAGATTAAGGGTGGG + Intergenic
994672512 5:102779621-102779643 GTGCCCACCAGATTAAGGGTGGG - Intronic
994836970 5:104867190-104867212 GTGCCCACCCTATTAAGGGGTGG - Intergenic
994937061 5:106268405-106268427 GTGCCCACCAGATTAAGGGTGGG + Intergenic
994958022 5:106560572-106560594 GTGCCCACCACATCAAGGATGGG + Intergenic
997286872 5:132686265-132686287 GTGCCCACATTATCTAAGGATGG + Intergenic
999928661 5:156407092-156407114 GTGCCCACCAGATTAAGGGTGGG + Intronic
1000749366 5:165074891-165074913 GTGGCCACCATTTCTGTGGCTGG - Intergenic
1000852056 5:166352503-166352525 GTGCCCACCACTTCTAAAGCTGG + Intergenic
1000995046 5:167950242-167950264 GTGCTGACAATATCCAGGGCTGG - Intronic
1003696362 6:8409740-8409762 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1005000299 6:21233359-21233381 GTGACCTCCATCTCTAGGGAGGG + Intergenic
1006419381 6:33923883-33923905 GTGCCCACCATCCCGTGGGCTGG - Intergenic
1009458113 6:63880206-63880228 GTGCCCACCAGATTAAGGGTGGG - Intronic
1009730019 6:67589927-67589949 GTGCCCACCCTATTAAGGGTGGG - Intergenic
1011026548 6:82875588-82875610 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1011199820 6:84823445-84823467 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1011206357 6:84903567-84903589 GTGCCCACCAGATTAAGGGTAGG + Intergenic
1011491332 6:87896507-87896529 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1011752349 6:90465853-90465875 GTGCCCACCAGATTGAGGGTGGG + Intergenic
1014416566 6:121191810-121191832 GTGCCCACCAGATTAAGGGTGGG - Intronic
1014417302 6:121197893-121197915 GTGCCCACCAGATTAAGGGTGGG - Intronic
1015060710 6:128961661-128961683 GTGCCCACCAGATTAAGGGTGGG + Intronic
1015376588 6:132516793-132516815 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1016266034 6:142233437-142233459 GTGCCCACCAAATTAAGGGTGGG + Intergenic
1017225911 6:152021152-152021174 GTGCCCACCAGATTAAGGGTGGG - Intronic
1017461606 6:154656217-154656239 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1021529893 7:21632560-21632582 GTGCCAAAAATCTCTAGGGCAGG + Intronic
1022962486 7:35441700-35441722 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1023987627 7:45106055-45106077 GTGCCTACCATAGACAGGGCAGG + Intronic
1024654938 7:51444112-51444134 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1025297679 7:57789263-57789285 GTGCCCAGAATCTCTAGGTCTGG - Intergenic
1025861727 7:65336947-65336969 TTTCACACCATCTCTAGGGCAGG - Intergenic
1026080623 7:67215897-67215919 GTGCCCACCACATTAAGGGTGGG + Intronic
1026696466 7:72598132-72598154 GTGCCCACCATATTAAGGGTGGG - Intronic
1027474180 7:78609134-78609156 GTGCCCACCAGATTAAGGGTGGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1030435540 7:109514661-109514683 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1032693179 7:134310084-134310106 GTACACACTATATCTATGGCAGG + Intronic
1033289728 7:140073221-140073243 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1033632950 7:143179068-143179090 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1034136971 7:148779858-148779880 GTGCCCACCAGATTGAGGGTGGG - Intronic
1034194645 7:149237074-149237096 GTGCCCACCAGATTGAGGGTGGG - Intergenic
1034940125 7:155225261-155225283 GTGCCCACCAGCTGTAGGCCTGG - Intergenic
1036506450 8:9360987-9361009 GTGCTCACCACATCTACTGCAGG + Intergenic
1039323878 8:36464064-36464086 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1043180846 8:77084934-77084956 GTGCCCACCAGATTGAGGGTGGG - Intergenic
1043511946 8:80958473-80958495 GTGACCAGTATATCTAGAGCTGG + Intergenic
1046186264 8:110724559-110724581 GTGCCCACAATTTCTTAGGCTGG - Intergenic
1046226412 8:111286038-111286060 GTGCCACACATCTCTAGGGCAGG + Intergenic
1048753948 8:137713732-137713754 GTGCCCACCAGATGAAGGGTGGG - Intergenic
1048835850 8:138518108-138518130 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1049857797 8:144874555-144874577 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1050493250 9:6212054-6212076 GTGCCTACCATAACTAAGGGTGG + Intergenic
1052003708 9:23320588-23320610 GTACTCACCACATCTAGGGCAGG - Intergenic
1052680629 9:31687159-31687181 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1052725278 9:32221570-32221592 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1053695584 9:40636483-40636505 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1054149254 9:61588105-61588127 GTGCCCAGAATCTCTAGGTCTGG - Intergenic
1054306831 9:63435705-63435727 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1054405562 9:64759695-64759717 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1054439187 9:65245184-65245206 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1054469016 9:65519216-65519238 GTGCCCAGAATCTCTAGGTCTGG - Intergenic
1054491219 9:65776757-65776779 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1054843752 9:69770734-69770756 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1057188305 9:93071534-93071556 GTGCCCACCAGATTAAGGGTGGG + Intronic
1058319875 9:103615542-103615564 GTGCTCACTATATTTGGGGCTGG + Intergenic
1061558521 9:131387362-131387384 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1062540073 9:137037699-137037721 GTGCCCACCAGATGAAGGGTGGG - Exonic
1202778029 9_KI270717v1_random:10099-10121 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1185673744 X:1832085-1832107 GTGCCCGCCAGGTCTAGGGTGGG + Intergenic
1185995931 X:4949403-4949425 GTGCCCACCAGATTGAGGGTGGG - Intergenic
1188048813 X:25459352-25459374 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1188237952 X:27752121-27752143 GTGTCCCCCATCTCCAGGGCTGG - Intergenic
1189070899 X:37862793-37862815 GTGCCCACCATTTCTAGTGAAGG + Intronic
1190412388 X:50149978-50150000 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1191721838 X:64237325-64237347 GTGCCCACCAGATTAAGGGTAGG + Intergenic
1192132794 X:68568580-68568602 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1192138475 X:68628984-68629006 GTGCCCACCAGATTGAGGGTAGG - Intergenic
1192940667 X:75908538-75908560 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1193574128 X:83178794-83178816 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1193827217 X:86241349-86241371 GTTCCAAACATCTCTAGGGCAGG - Intronic
1194567026 X:95501763-95501785 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1194849601 X:98855054-98855076 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1196324009 X:114379770-114379792 GTGCCCACCAGATTAAGGGTGGG + Intergenic
1197116066 X:122835114-122835136 GTGCCCACCAGATTAAGGGTGGG - Intergenic
1197158173 X:123292927-123292949 GTGCACTCCATTTCTAGGGAAGG + Intronic
1198785359 X:140282757-140282779 GTGGCCACCATCACTAGGACTGG + Intergenic
1199024681 X:142922210-142922232 GTGCCCACCACATTAAGGGTGGG - Intergenic
1201193357 Y:11468391-11468413 GTGCCCACCAGATTAAGGGTGGG - Intergenic