ID: 904947979

View in Genome Browser
Species Human (GRCh38)
Location 1:34213258-34213280
Sequence GCAGGGAAGGTTCTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904947979 Original CRISPR GCAGGGAAGGTTCTGTGATG GGG (reversed) Intronic
900640448 1:3685782-3685804 TCAGGGAAGCTGCTGTGCTGGGG + Intronic
903237912 1:21962220-21962242 GCAGGGAAGGTGCTGGGGTCAGG + Intergenic
903965637 1:27087533-27087555 GCAGGGAAGGTCCTGGAATCTGG - Intergenic
903967585 1:27100142-27100164 GCAGGGGAGGAGCTGTGCTGGGG + Exonic
904011117 1:27391250-27391272 GCAGTGATGGTGCTGTGATGGGG + Intergenic
904418415 1:30376380-30376402 CCAGAGAAGGTTCTCTGAGGAGG - Intergenic
904947979 1:34213258-34213280 GCAGGGAAGGTTCTGTGATGGGG - Intronic
905170471 1:36106847-36106869 GGATGGAAGGGTCTGGGATGGGG - Intronic
905172997 1:36119991-36120013 GGAGGGAAGCCTCTGTGAAGAGG - Intronic
905672951 1:39804414-39804436 TCAGGGAAGGTCCTCTGAGGAGG + Intergenic
905874240 1:41422220-41422242 AGAAGGAAGGTGCTGTGATGAGG + Intergenic
905964016 1:42074621-42074643 GCTGGGAAGGGTGTGTGTTGTGG - Intergenic
906718731 1:47990131-47990153 GCAGGCACGGTTCTGTGTTCAGG + Intronic
906792812 1:48673747-48673769 GCAAGGAAGGGTCAGTCATGAGG + Intronic
907181600 1:52575398-52575420 GCAGTGAAGATTGTGTGAAGTGG - Intergenic
907318557 1:53588426-53588448 GCAGGGAAAGTTCCCTGAAGGGG - Intronic
907544019 1:55243614-55243636 TCAGGGAAGCTTCTCTGAGGAGG - Intergenic
908019484 1:59885727-59885749 GCAGAGAGGCTTCTGTGGTGAGG + Intergenic
908077799 1:60540061-60540083 GCTGGGCAGGATCTGTGCTGAGG - Intergenic
908498661 1:64721017-64721039 GCAGGGGATGTTCAGTGAGGAGG + Intergenic
908512120 1:64857879-64857901 GCAGGGCAGATAGTGTGATGGGG - Intronic
909501496 1:76339881-76339903 TCAGAGCAGGTTCTGTGATAAGG + Intronic
914371939 1:147033246-147033268 GCAGGAATGGTCCTGGGATGTGG - Intergenic
914577578 1:148989560-148989582 GCAGGAATGGTCCTGGGATGTGG + Intronic
915742822 1:158132351-158132373 GCACTGAAGATTCTTTGATGGGG + Intergenic
916491022 1:165302492-165302514 GCAGAGAATGTTCTGAGATGTGG + Intronic
918030918 1:180809676-180809698 GGAGGGAAGGTTTTGGGATCAGG + Intronic
918045062 1:180936482-180936504 GCTGGGCTGGGTCTGTGATGGGG - Exonic
918072127 1:181140978-181141000 GAAGGGAAAGTTCTGATATGGGG + Intergenic
918911515 1:190578199-190578221 GCAGCGAGGGTTCTGTAATGAGG - Intergenic
919820784 1:201470547-201470569 ACAGGGAAGGTCCTGTTGTGGGG + Intergenic
919934260 1:202241309-202241331 TCAGGGAAGGTTCAGTCTTGTGG + Intronic
920910186 1:210209237-210209259 GTAAGGAAGGGTCTCTGATGTGG - Intergenic
921812698 1:219532626-219532648 TCAGGGAAGGTTCTTTAAAGAGG + Intergenic
922755872 1:228096720-228096742 CCCTGGAAGGTTCTGTGTTGGGG + Intronic
922886384 1:229024054-229024076 GCAGGGCAGTTCCTGGGATGTGG + Intergenic
1063009386 10:2007680-2007702 GCAGGGTATGATCTGTGCTGGGG - Intergenic
1064674201 10:17745195-17745217 GCAGCGAAGGTTCCTTCATGAGG - Intergenic
1065806264 10:29395861-29395883 GCAGGAAAAGTACTGTCATGGGG - Intergenic
1067223750 10:44362248-44362270 CCTGAGAAGGTTCTGTGTTGGGG + Intergenic
1068685208 10:59863551-59863573 GCAGGGAAGGGTGGGTGGTGGGG + Intronic
1069175489 10:65284495-65284517 GCAAGGAAGAGTCTTTGATGTGG - Intergenic
1069910623 10:71757007-71757029 GCAGGGAACCTGCTGTAATGTGG - Intronic
1069922095 10:71821965-71821987 GCTGGTTGGGTTCTGTGATGAGG - Exonic
1070783606 10:79150852-79150874 GCAGGGATGGGGCTGTGCTGAGG + Intronic
1070804837 10:79264939-79264961 GCAGGGAATTTTCTGGGCTGGGG + Intronic
1071514406 10:86287638-86287660 TCAGGGAAGGCTCTGTGGAGGGG - Intronic
1072015887 10:91346287-91346309 TCAGGGAAGGAGATGTGATGTGG - Intergenic
1073427362 10:103463758-103463780 TCAGAGAAGGAGCTGTGATGAGG - Intergenic
1074433740 10:113416116-113416138 GCAGTGAAGGGTCTGTGGTCGGG - Intergenic
1074639994 10:115369226-115369248 GGATGGAGGATTCTGTGATGAGG + Intronic
1075598807 10:123752141-123752163 GCATGAAAGGCTGTGTGATGTGG - Intronic
1076148562 10:128144720-128144742 GCAGGGAAGGATCTGGCTTGTGG + Intergenic
1076982542 11:212557-212579 GCAGCCAAGGGTCTGTGATCAGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077491763 11:2864251-2864273 GCAGGGCAGGCTCAGTGATGTGG - Intergenic
1077992504 11:7424449-7424471 GCAGGAAAGGTGTTGTGATATGG - Intronic
1078451880 11:11446623-11446645 GCAGGGGAGGTGCTGAGATGGGG - Intronic
1079464914 11:20720662-20720684 TGAGGGAAGGGTCTGTTATGGGG + Intronic
1081752466 11:45521579-45521601 GCAAGGAAGGTTTGGTGCTGGGG + Intergenic
1081774876 11:45670148-45670170 GCAGGGAGTGGTCTGTGCTGGGG + Intergenic
1081872119 11:46387980-46388002 TCAGGGAAGGGCCTGTGGTGGGG - Intergenic
1083678493 11:64340779-64340801 GCGGGGAAGGATCTGAGAGGAGG + Intronic
1083682045 11:64355762-64355784 GCAGGGAACGTTCTGGTGTGAGG + Intronic
1085059326 11:73430409-73430431 GCAGAAAAGGTTCTATGAGGAGG + Intronic
1085769585 11:79312868-79312890 GCAGGGAAGGCTCTGTGGAGTGG - Intronic
1086405247 11:86493909-86493931 GCAGGGAGGATGCTGTCATGAGG - Intronic
1087149288 11:94844165-94844187 TCAAGGAAGGTTCTTGGATGTGG - Intronic
1088433855 11:109789059-109789081 GCAGGGAAGTCTGAGTGATGGGG - Intergenic
1089409976 11:118232868-118232890 GGAGGGAAGACTCTCTGATGTGG - Intronic
1089591615 11:119545877-119545899 GCAGGGAGGGTGCTGGGAGGAGG + Intergenic
1090090854 11:123696524-123696546 GCAGTGTAGTTTCTGTGTTGTGG - Intergenic
1090240446 11:125177735-125177757 GCAGGGAAGGCTGTGGGCTGTGG + Intronic
1090245959 11:125216260-125216282 GCAGGGAGGGGTCTGAGCTGTGG + Intronic
1090801403 11:130174808-130174830 TCAGGGAAGAGTCTGTAATGTGG - Intronic
1090963703 11:131580051-131580073 GCAGGGAGGGCTGCGTGATGAGG + Intronic
1091335289 11:134762006-134762028 GCTGGGAAGGTTGTGTAAAGAGG + Intergenic
1092049439 12:5457380-5457402 CCAGAGAAGGGTCTGTGATAAGG - Intronic
1092275724 12:7059670-7059692 TCAGGGAAGGCTCTGTGGAGTGG + Intronic
1092998504 12:13973593-13973615 GCAGGGGAGGCACAGTGATGAGG - Intronic
1093588152 12:20867670-20867692 ACATGGAAGCTTCTGTAATGTGG + Intronic
1094201127 12:27795446-27795468 GATGGGATGGTTCAGTGATGTGG + Intronic
1096974768 12:55693761-55693783 CCAGGGAAGCTTCTCTGCTGTGG - Intronic
1098465889 12:70784574-70784596 GCAGGGAGGGTACTGGGAGGAGG - Intronic
1100024850 12:90115440-90115462 GCTGGGAAGGGTGTGTGTTGTGG - Intergenic
1100239269 12:92694541-92694563 GCAGGCCTGGTTCTGTGTTGGGG + Intergenic
1101225208 12:102681416-102681438 ACAGGGAAGGTTGTTAGATGGGG + Intergenic
1102894141 12:116585051-116585073 GCAGGGAGGTCTGTGTGATGAGG + Intergenic
1103842750 12:123878556-123878578 GCAGGGAAAGTTCTGGAATTGGG + Intronic
1105254503 13:18733533-18733555 GGAGGGAAGGTTGGGGGATGAGG + Intergenic
1106257411 13:28033973-28033995 GCAGGGAAGGTACTAGGATCAGG - Exonic
1106521518 13:30502411-30502433 GCAAGGAAGGAACTGAGATGGGG - Intronic
1107388794 13:39942039-39942061 GCAGGGAAGTTTCTGGAATTCGG + Intergenic
1110447760 13:75606377-75606399 TCAGGGAGGCTTCTGTGAGGAGG + Intergenic
1112739336 13:102455741-102455763 ACAGGGAAGGTTGTGGGATTGGG + Intergenic
1113210109 13:107968245-107968267 GCAGGGCAGGTTCTGGGTTTCGG + Intergenic
1113271797 13:108682694-108682716 GCATGGAAGGGTCAGTGATGTGG + Intronic
1113651920 13:112039556-112039578 GCAGGGACAGCTCTGAGATGAGG + Intergenic
1114763675 14:25346397-25346419 GCAGGGAAACTTGTGTCATGGGG + Intergenic
1114955514 14:27813085-27813107 GCAGGGAAGGTAGGGTTATGAGG + Intergenic
1117025846 14:51619548-51619570 TCAGGGAAGCTTCTGTGAGGTGG - Intronic
1119232552 14:72992243-72992265 GCATGGAAGGTTCTGAGACTGGG - Intronic
1119355436 14:74002337-74002359 GCAGAGAATGGTCTGAGATGAGG + Intronic
1119787047 14:77321463-77321485 GGAGGGAGGGGTCTGTTATGGGG - Intronic
1119814616 14:77554739-77554761 GCAGGTAAGAATCTGTGGTGTGG - Intronic
1120184694 14:81382548-81382570 GGAGGGAAGGGGATGTGATGAGG + Intronic
1121729493 14:96176389-96176411 GCAAGGAAGGATGGGTGATGGGG + Intergenic
1122138917 14:99650503-99650525 GCAGGGAGGGTGCTGTGGTGTGG + Intronic
1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG + Intronic
1126957813 15:53953823-53953845 GCAAGGAGAGTTTTGTGATGTGG - Intergenic
1127276624 15:57451339-57451361 TCAGGGAAGGTTCCCTGAAGGGG + Intronic
1128174349 15:65541603-65541625 GCAGGGACAGTTCTATGATTTGG + Intronic
1128743001 15:70096364-70096386 GCTGGGAAGGTTCTGGGCTGAGG - Intronic
1129349230 15:74944916-74944938 GCAGGGCAAGTTGTGAGATGGGG + Intergenic
1129904757 15:79178599-79178621 GGATGGAAGCTTCTGGGATGAGG + Intergenic
1130012213 15:80160604-80160626 GCTGGGAAAGGTCAGTGATGAGG - Intronic
1131116575 15:89799766-89799788 GCAGGGCAGGTTCTGAGGTTTGG - Intronic
1132091532 15:98951321-98951343 GCTGGGAAGTTTCCTTGATGAGG - Intronic
1132220659 15:100102726-100102748 GCAGGGAGGTCTCTGTGCTGAGG - Intronic
1132387603 15:101411455-101411477 GCAGGGGTCTTTCTGTGATGTGG - Intronic
1132670272 16:1099687-1099709 GCAGGGCAGCTGCTGTGATTTGG - Intergenic
1132874989 16:2133144-2133166 GCAGGGCAGGCTCTGGGGTGGGG + Intronic
1133441012 16:5820939-5820961 ACAGGGAGGGCACTGTGATGAGG - Intergenic
1133450412 16:5899381-5899403 TCAGGGAAGGCTCTCTGAGGTGG + Intergenic
1134232365 16:12438828-12438850 TCAGGGAAGGTTCTGGGCTGAGG + Intronic
1134520001 16:14914246-14914268 GCAGGGCAGGCTCTGGGGTGGGG - Intronic
1134553932 16:15151991-15152013 GCAGGGCAGGCTCTGGGGTGGGG + Intergenic
1134707674 16:16312900-16312922 GCAGGGCAGGCTCTGGGGTGGGG - Intergenic
1134959869 16:18399225-18399247 GCAGGGCAGGCTCTGGGGTGGGG + Intergenic
1135913900 16:26586205-26586227 TCAGGGGAGGTTCTCTGAGGAGG - Intergenic
1137736266 16:50726091-50726113 GCTGGGGAGGTGATGTGATGGGG + Intronic
1139597707 16:67968098-67968120 GCCGGGAAGGGCCTGAGATGGGG + Intronic
1140220482 16:73040219-73040241 GCAGCAAAGGAGCTGTGATGGGG + Intronic
1141559054 16:84854596-84854618 GGGGGGAAGGTTGTGTGCTGTGG - Intronic
1141962100 16:87415820-87415842 GAAGGGATGGCACTGTGATGGGG - Intronic
1142222494 16:88862385-88862407 GCAGGGAAGCTCCTGTGAAGGGG + Exonic
1143258806 17:5583593-5583615 GCAGGGAGGGCTCAGTGGTGGGG + Intronic
1144587170 17:16493926-16493948 GCAAGGAAGAGTCTTTGATGTGG - Intergenic
1144661274 17:17072433-17072455 GGAGCGAAGGTTCTGGGGTGGGG + Intronic
1144940178 17:18933366-18933388 GCAAGTCAGGTTCTGTGGTGTGG + Intergenic
1146585598 17:34078923-34078945 GCAGGGAAGTTTCAGTTATCTGG - Intronic
1146796565 17:35785247-35785269 GCAGGGCAGGACCAGTGATGAGG + Intronic
1146908109 17:36630765-36630787 GCAGGGAAAGGTCTGGGAGGAGG + Intergenic
1146922789 17:36724565-36724587 GAAGGGCAGGTGCTGTGATTGGG - Intergenic
1147387996 17:40092886-40092908 GGAGGGGAAGTTCGGTGATGGGG + Exonic
1147504185 17:40998770-40998792 GTATTGAAGGTTCTATGATGTGG + Intergenic
1148228977 17:45919402-45919424 GCAGGTAAGGGGCTGGGATGAGG - Intronic
1148737581 17:49873457-49873479 GCAGGGGAGGTTCTGCCATCAGG - Intergenic
1149418380 17:56484020-56484042 GGAGGGAAGGGTATCTGATGTGG + Intronic
1149537325 17:57442980-57443002 GCAGGGAAGGTGCTGGCAGGTGG - Intronic
1150137436 17:62703640-62703662 GCAGGGGAGGGTTGGTGATGGGG + Intronic
1151141369 17:71995660-71995682 GTGGGGAAGGGTCAGTGATGTGG - Intergenic
1151472750 17:74328035-74328057 GCAGGCACGGCTCTGGGATGAGG - Intronic
1151488898 17:74420334-74420356 GCAAGGAAGAGTCTTTGATGTGG + Intergenic
1151786145 17:76275961-76275983 GGAGGGAAGGGTCAGTGCTGAGG + Intronic
1153954098 18:10081365-10081387 GGAGGGCAGGCTCTGCGATGTGG + Intergenic
1154938669 18:21088860-21088882 GCAGGTTTGGTTCTCTGATGAGG - Intronic
1156595961 18:38548035-38548057 GCTGTGAAGACTCTGTGATGGGG + Intergenic
1156810515 18:41244035-41244057 GCAAGAAAGTTTCTGTGGTGGGG - Intergenic
1157301455 18:46482762-46482784 GCAGGGAAGGCTCTAGGGTGTGG + Intronic
1157569981 18:48705819-48705841 TCAGGGAAGGTTCTGCCAGGTGG - Intronic
1158550410 18:58431016-58431038 GTAGGGAAGGTGCTATGCTGTGG - Intergenic
1158882242 18:61791616-61791638 GCAGGGGAGGGTCTGGGAAGAGG - Intergenic
1161410619 19:4115233-4115255 GCTGGGCAGGTTCTGTGGTCTGG - Intronic
1161772965 19:6241346-6241368 GCAGGGAAGGTGCTGTCCAGCGG - Intronic
1161796677 19:6391058-6391080 GCAGTGGAGGTTATGAGATGTGG - Intronic
1161845721 19:6710895-6710917 GCAGGGAGGGATCCGGGATGGGG + Intronic
1163433955 19:17284044-17284066 GAAGGGATGATTCTGAGATGGGG - Intronic
1163500424 19:17672937-17672959 GCAGGGAAAGTGCTTTGAGGTGG - Intronic
1163648526 19:18503788-18503810 GCAGGGAAGGCTCCCTGAGGAGG - Intronic
1165221516 19:34320436-34320458 GCAGGAAAGCTTCTAAGATGGGG + Intronic
1165838033 19:38771142-38771164 GCAGGGGAGGGTCGGTGGTGAGG + Intronic
1165841532 19:38791555-38791577 GCAGGGGAGGGTCGGTGGTGAGG - Intronic
1166062634 19:40336227-40336249 GCAGGGAAAGGTCAGTGGTGAGG + Intronic
1167622528 19:50567722-50567744 GCAGGGCGAGTTCTGTGCTGTGG - Intronic
1167916230 19:52742271-52742293 CCAGTGAAGGGTCTGTGCTGAGG - Intergenic
1168511872 19:56979831-56979853 TCAGGGGAGGTTCTGTGGTACGG + Intergenic
925761306 2:7187244-7187266 GCAGGGAAGAGCCTGTGCTGGGG + Intergenic
926339372 2:11892264-11892286 TCAAGGAAGGTTCTGTGAGAAGG - Intergenic
926972173 2:18477419-18477441 GCAGGCCAGGTTTTGTGATAAGG - Intergenic
927087267 2:19684774-19684796 GAGGGGAAGTTTCTGAGATGGGG - Intergenic
927757331 2:25719617-25719639 CCAGGGAAGGTGCAGTGTTGGGG - Intergenic
928446429 2:31337558-31337580 GCAGGGAAGGTTCTGCACAGAGG - Intronic
928633784 2:33221364-33221386 GCAGCCAAAGTTCTGGGATGTGG - Intronic
929265535 2:39915012-39915034 CCTGGGAAGGATCTGTGTTGGGG - Intergenic
929871166 2:45760595-45760617 GCTGGCAAGGTCCAGTGATGTGG + Intronic
929875196 2:45791085-45791107 GAAGGGAAGGTTTTGTGTAGAGG + Intronic
930421063 2:51153305-51153327 GCAGGGAGGGTACTGTGAGTTGG - Intergenic
934481764 2:94655794-94655816 GCAGGGAAGGTAGGGTTATGAGG - Intergenic
934652596 2:96100971-96100993 GGAGGGAAGGGTCTGGAATGAGG - Intergenic
935509114 2:103949373-103949395 GAAGGGAAGGTTCTATTATTAGG - Intergenic
936280744 2:111137576-111137598 GCAGTGCAGGGTCTGAGATGTGG - Intronic
937516095 2:122656884-122656906 GAAGGGAGGCTTCTGTGTTGAGG + Intergenic
938066730 2:128285554-128285576 GCAGGGAAGGTTCTAGGACCAGG + Intronic
939202736 2:139059023-139059045 GCAGGGAAGGTACTAGAATGTGG - Intergenic
939963965 2:148592460-148592482 GCAGGTTAGGTGCCGTGATGGGG + Intergenic
941219487 2:162758219-162758241 TCAGGGAAGGTTCTCTGGAGGGG + Intronic
942138942 2:172957596-172957618 GCAGGGAAGGTTTTATTTTGAGG - Intronic
944915310 2:204354436-204354458 GCAAGGAAGAGTCTTTGATGTGG + Intergenic
945672769 2:212821938-212821960 GAAGGGAATGTTCTCTGTTGGGG + Intergenic
946086624 2:217180029-217180051 GCAGGTCATGTTCAGTGATGGGG - Intergenic
947052936 2:226067130-226067152 GCAAGGAAGAATCTTTGATGTGG - Intergenic
947153404 2:227136668-227136690 GCAAGGCTGGTTCTGTGCTGAGG - Intronic
947619094 2:231577190-231577212 CCCGGGAAGGGTCTGTGCTGAGG + Intergenic
947936952 2:234014828-234014850 GTAGGGAAGGTAATGTGAGGAGG - Intronic
1168860593 20:1043610-1043632 GCTGGGAAGGGTGTCTGATGAGG + Intergenic
1169109573 20:3023323-3023345 GAAGGGAAGGGTCTGTGCTGAGG + Intronic
1169930897 20:10831962-10831984 GGAGAGAAGGTTCAGTGATCTGG + Intergenic
1170587053 20:17742708-17742730 ACAGAGAAGGGTCTGTGATAGGG + Intergenic
1172847460 20:37938431-37938453 CCAGGGAAGGTGCTGGGGTGAGG - Intronic
1173587475 20:44193776-44193798 GCAGAGAAGATGCTGTGATAAGG - Intergenic
1174507828 20:51028164-51028186 GCAGGGCAGGAGCTGGGATGAGG - Intergenic
1174637339 20:52013140-52013162 TCAGGGAAGGCTCTCTGAGGAGG + Intergenic
1175277398 20:57781513-57781535 GGAGGGAAGGTTCTAGGGTGAGG + Intergenic
1175979992 20:62733841-62733863 AGAGGGAAGGCTCTGTGCTGGGG + Intronic
1176710188 21:10144718-10144740 GCCTGGAAGGTTCTGGGAAGTGG - Intergenic
1177413325 21:20760375-20760397 GCAAGAAAGCTTCTGTGAGGAGG + Intergenic
1178137894 21:29648885-29648907 GAAGGGCAGGGTCTGCGATGTGG + Intronic
1178704376 21:34861285-34861307 GCAGGGTATGTGATGTGATGTGG + Intronic
1178869970 21:36365233-36365255 TCAGCGAAGGCTTTGTGATGAGG + Intronic
1179382483 21:40912124-40912146 GCAGGGAAGGTTGAGAGCTGGGG + Intergenic
1180215454 21:46320754-46320776 GCAAGGAAGCATCTCTGATGTGG - Intronic
1181441232 22:22936076-22936098 CCAGGGAAGGTCCTGGGGTGGGG - Intergenic
1181890285 22:26056754-26056776 CCAGGGAAGAATCTGTGATTTGG + Intergenic
1182348946 22:29687730-29687752 GCAGGGAAGGTTCAGGGCTGGGG - Intronic
1183739225 22:39660933-39660955 GAAGGGGAGGCACTGTGATGGGG + Intronic
1184685360 22:46094381-46094403 GCAGGGAAGGGGCTAGGATGGGG + Intronic
1184905679 22:47484399-47484421 GCAAGGAAGAGTCTTTGATGTGG + Intronic
1184966629 22:47978731-47978753 GCAGGGAAGGTTTTGCTATCAGG + Intergenic
950459178 3:13111089-13111111 GCAGGGCAGGAGCTGTGCTGGGG - Intergenic
952063656 3:29541519-29541541 GCAGTGAAGGTGCTGAAATGAGG - Intronic
952593306 3:34984302-34984324 GAAGGGAAGTTTATGAGATGTGG + Intergenic
954132284 3:48566862-48566884 GTAGGGAAGGTTCAGGGATCAGG + Intronic
954844995 3:53547649-53547671 GCAGGGAAGTTTCTCCGAGGAGG + Intronic
954876748 3:53807292-53807314 GGAGGGAAGGCTTTCTGATGAGG + Intronic
955640235 3:61074857-61074879 GCTGGGAGGATTCTGTTATGGGG - Intronic
957532869 3:81463004-81463026 GCAGAGAAGGTGTTGTGCTGTGG - Intergenic
958615949 3:96493839-96493861 GCAGGGAGGATACTGTGGTGGGG + Intergenic
961033126 3:123623690-123623712 GCAGCCAAGGTTCTGTGCAGTGG - Intronic
962118723 3:132540095-132540117 TCAGGCAAGTGTCTGTGATGGGG + Intergenic
963072045 3:141312425-141312447 GCAAGGAAGAGTCTTTGATGTGG + Intergenic
963384958 3:144581031-144581053 ACAAGGAAGGTTTTGTGAAGTGG + Intergenic
965557854 3:170036287-170036309 GCAAGGAAGAGTCTTTGATGTGG - Intergenic
966444607 3:179987723-179987745 GCAGTGAAGGTTCACTGCTGGGG - Intronic
966807545 3:183818832-183818854 GCGGGGAGGGTGGTGTGATGGGG + Intronic
968224994 3:196968022-196968044 GCCGGGAAAGTTCTGTAATGAGG - Intronic
968672149 4:1857384-1857406 GCAGGGCAAGTGCTGTGCTGGGG - Intergenic
969213042 4:5702193-5702215 GCAGGGAAGGTGCTGTAAGGAGG - Intronic
969501023 4:7553066-7553088 GCAGGAAAGAGTCAGTGATGTGG + Intronic
969703141 4:8778675-8778697 GGAGTGAAGGTTCTGAGCTGTGG - Intergenic
971370211 4:26013007-26013029 GCAGGGCAGGTTCTGGCACGAGG - Intergenic
974794589 4:66732058-66732080 GCAAGGAACGGTCTTTGATGTGG + Intergenic
977425209 4:96860038-96860060 GGAGGGAAGGTTCCTTCATGAGG + Intergenic
977826921 4:101543568-101543590 GCTGGGAAGGGTGTGTGTTGAGG + Intronic
979669734 4:123349497-123349519 GCAAGGAAGAGTCTTTGATGTGG + Intergenic
981166899 4:141570520-141570542 GCAGGGAAAATTCAGAGATGTGG + Intergenic
982030406 4:151294884-151294906 TCAGGGAAGGTTCTCTGAGGAGG + Intronic
983706866 4:170672238-170672260 TCAGTGATGGTTTTGTGATGGGG - Intergenic
984011770 4:174380440-174380462 GCAGTAAAGGGTCTGTGCTGAGG + Intergenic
984065102 4:175037963-175037985 GCAGTGTAGGTGCTGTGTTGAGG - Intergenic
985256691 4:188077032-188077054 GCAAGGAAGAGTCTTTGATGTGG + Intergenic
986422000 5:7594550-7594572 GCAAGGAAGGTGCTGTGGAGAGG - Intronic
986516389 5:8569045-8569067 GCAGGGACAGTGGTGTGATGTGG + Intergenic
986596696 5:9430049-9430071 GCAGTGAAGGTGCTGAGAAGTGG + Intronic
987322691 5:16785142-16785164 GCAGGGCAGTTTCAGGGATGTGG - Intronic
989217120 5:38917019-38917041 GCAGGCAAGGTGCTGGGAGGAGG + Intronic
991295629 5:65077144-65077166 GCAGGGAGGATTCTGGGGTGGGG + Intergenic
994267498 5:97735758-97735780 GCAGGGAATGTTCCTTGATCAGG + Intergenic
995234072 5:109806077-109806099 GGAGTGAAGGTTCTCTGCTGGGG + Intronic
995332857 5:110965024-110965046 CCATGGCAGGTTCTGTCATGTGG - Intergenic
995517272 5:112966696-112966718 CCAGGGAAGGTTTTTTGAAGAGG + Intergenic
997009151 5:129856406-129856428 TCAGGAAAGATTCTGTGATTTGG - Intergenic
997439481 5:133899127-133899149 GCAGGGAAAGTTCTGCAATCAGG + Intergenic
998551295 5:143080458-143080480 TCAGGGAAGGCTCTCTGAGGAGG + Intronic
999053905 5:148553291-148553313 TCAGGGAAGGTTCAATGATAAGG + Intronic
999829875 5:155308157-155308179 TCAGGGAAGCTTCTTTGATGAGG + Intergenic
999899792 5:156074228-156074250 GCACAGAAGGTTCTGTGGTATGG + Intronic
999998698 5:157117191-157117213 GCTGGGAAGATTTTGTGATCAGG - Intronic
1000067974 5:157712905-157712927 GCCAGTAAGGTTCTGAGATGTGG - Intergenic
1000082085 5:157858533-157858555 GCAGGGAAGGTTTGGGGGTGGGG - Intronic
1001763936 5:174230165-174230187 GCAGGGAGGCTTCTGTGGTGAGG - Intronic
1002000423 5:176193766-176193788 GCATGGATGGTGCTGTGCTGAGG - Intergenic
1002253912 5:177945215-177945237 GCATGGATGGTGCTGTGCTGAGG + Intergenic
1003088111 6:3077750-3077772 GCAGGAAAGGTGCTATGCTGAGG - Intronic
1003392705 6:5727289-5727311 GGAGGGAAAGTTCTGTGCAGAGG - Intronic
1003592450 6:7447328-7447350 TCTGGGAAGGTTCTGTGCAGAGG + Intergenic
1005358709 6:25009903-25009925 GCAGGAAAGGCCCTGTGGTGTGG + Intronic
1005748730 6:28864017-28864039 CCAGAGAAAGGTCTGTGATGGGG + Intergenic
1006020318 6:31114071-31114093 GGAGAGAAGGCTCTCTGATGTGG - Intergenic
1006422997 6:33947240-33947262 GCAGGCAGGGTGCTGTGATCTGG - Intergenic
1006865837 6:37208317-37208339 GCAGGGGAGGTTATATGAAGTGG + Intergenic
1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG + Intergenic
1007397018 6:41583691-41583713 GCAGGACAGGTGCTCTGATGGGG - Intronic
1007397301 6:41585211-41585233 GCAGGGAGGGTTCAGAGCTGTGG + Intronic
1008288799 6:49687039-49687061 CCAGGGATGGTTGTGGGATGGGG + Intergenic
1011400055 6:86951040-86951062 ACAAGGAAGGTTCTGCAATGAGG - Intronic
1011804406 6:91054914-91054936 GCTGGGAAGGGACGGTGATGGGG - Intergenic
1012470480 6:99568281-99568303 GGAGGGAAGGATCTGTGAGGGGG - Intronic
1012512746 6:100023058-100023080 GGAGGGAAGGGAATGTGATGTGG + Intergenic
1013378472 6:109542302-109542324 GCAGGGAAGGGTGTGTGGTAGGG + Intronic
1014184017 6:118414896-118414918 ACAGGTAAGCTTGTGTGATGGGG - Intergenic
1015338186 6:132065891-132065913 GCAGGGAAGGTTTGGGGAAGTGG + Intergenic
1017085764 6:150711306-150711328 GGAGGCAGGGTTCAGTGATGGGG - Intronic
1017093010 6:150778484-150778506 TCAGGGAAGGTTCTCTGAGGAGG - Intronic
1018573058 6:165230817-165230839 GCAGGGAGGGCTCTGGGATCTGG - Intergenic
1018860397 6:167707063-167707085 GCAGGGAGGCTTCTGTGGTGGGG - Intergenic
1018936474 6:168277101-168277123 GCAGGGACGGTCCTGGGACGGGG - Intergenic
1019714329 7:2531373-2531395 GCCGGGAGGGTTCTGGGAAGAGG - Intergenic
1019741994 7:2679699-2679721 GCCGGGAGGGTTCTGGGAAGAGG + Intronic
1021690157 7:23223293-23223315 GCAGGGCCGGGTCAGTGATGAGG + Intergenic
1021897952 7:25255264-25255286 GAAGGGAAGGAGGTGTGATGTGG + Intergenic
1023795643 7:43789723-43789745 GAAGGGAAGGGTATGTGAAGAGG - Intronic
1023878875 7:44307444-44307466 GCAGGGGAGGGTGTGTGAAGAGG + Intronic
1023971749 7:44996750-44996772 GCTGGGAAGGGTGTGTGTTGGGG + Intergenic
1023988333 7:45111554-45111576 GCTGGGAAGGTCCTGGGATGCGG - Intronic
1024788637 7:52937012-52937034 GCGAGGAAGAGTCTGTGATGTGG - Intergenic
1025023117 7:55495448-55495470 GATGGGAAGCTTCTGTGGTGAGG - Intronic
1025610737 7:63073626-63073648 CCAGGGAAGGTTCTGAGATCTGG + Intergenic
1027175237 7:75899207-75899229 CCAGGGCAGGTCCTGTGCTGAGG - Intronic
1027669066 7:81073670-81073692 GCAGGCAAGGTTCTGGGAATAGG - Intergenic
1028140587 7:87270452-87270474 GCTGGGAAGGTTATGTGTAGGGG - Intergenic
1030395113 7:108976356-108976378 TAAGAGAAGGTTTTGTGATGAGG - Intergenic
1032518340 7:132523505-132523527 GCACGGAAGGATGGGTGATGGGG + Intronic
1034077812 7:148249641-148249663 GCAGGGCAGGTTGTGGGAAGGGG - Intronic
1034443630 7:151100900-151100922 CCAGGCAGGGTCCTGTGATGGGG - Intronic
1034684396 7:152957301-152957323 GAAGGGAGGGTCCTCTGATGTGG + Intergenic
1035587538 8:787480-787502 GGAAGGATGGTCCTGTGATGGGG + Intergenic
1037800037 8:22027986-22028008 GCAGGGAAGATGATGAGATGTGG - Intronic
1038275791 8:26119612-26119634 GCAAGGAGGGTTCTGTCACGGGG + Intergenic
1038406091 8:27324145-27324167 GCAGGGAAGGTGTGGGGATGAGG - Intronic
1039049261 8:33478306-33478328 GCAGGGAACATTCTGTTATTAGG - Intronic
1039382978 8:37103016-37103038 TGAGAGAAGGTTCTGTGGTGGGG - Intergenic
1041942392 8:63403088-63403110 TGAGTGAAGGTCCTGTGATGGGG - Intergenic
1043428356 8:80171159-80171181 GGAGAGAAGGTTCTGGGAGGTGG - Intronic
1044712611 8:95072256-95072278 ACAGGGAGGGTTCTGGCATGGGG - Intronic
1046430976 8:114127202-114127224 GCTGGGAAGGGTGTGTGTTGAGG - Intergenic
1047651707 8:126929962-126929984 GCAGGGAAGGTGATGAGATTTGG + Intergenic
1047805304 8:128353232-128353254 GTAGGGAAGGGTCTCTGGTGTGG + Intergenic
1048407689 8:134139864-134139886 GAAGGGAAGGGTCTTTCATGGGG - Intergenic
1048469459 8:134694642-134694664 GCAGGGAAGATCCAGCGATGGGG - Intronic
1048798049 8:138170095-138170117 GCAGGGAAGCTTCTCCCATGAGG - Intronic
1048871934 8:138806384-138806406 GCAGGGAAGGGTGTGAGATGAGG + Intronic
1049143695 8:140981411-140981433 GGAGGGAAGGGTATGTGATCAGG + Intronic
1049319897 8:141990698-141990720 GAAGGGAAGGGCCTGTGAGGTGG - Intergenic
1049479044 8:142811290-142811312 GCAGGAAAGGAGCTGTGCTGGGG + Intergenic
1049548224 8:143244720-143244742 GCAGGAAAGGGTCTGTCAGGCGG + Intergenic
1051436472 9:17038442-17038464 GGAAGGAAGGGTATGTGATGCGG + Intergenic
1053137718 9:35662139-35662161 CCAGGAAGGGTGCTGTGATGAGG - Intronic
1053676074 9:40429131-40429153 GCAGGGAAGGTAGGGTTATGAGG + Intergenic
1053925847 9:43055243-43055265 GCAGGGAAGGTAGGGTTATGAGG + Intergenic
1054287647 9:63195762-63195784 GCAGGGAAGGTAGGGTTATGAGG - Intergenic
1054289146 9:63264651-63264673 GCAGGGAAGGTAGGGTTATGAGG + Intergenic
1054387174 9:64569202-64569224 GCAGGGAAGGTAGGGTTATGAGG + Intergenic
1054508548 9:65947163-65947185 GCAGGGAAGGTAGGGTTATGAGG - Intergenic
1055276147 9:74619255-74619277 GCTGGGAAGGTTTGGTGCTGAGG - Intronic
1056721007 9:89071885-89071907 GCAAGGAAGAGTCTTTGATGTGG - Intronic
1056965786 9:91161916-91161938 CCAGGGAGGCTTCTGTGAAGTGG + Intergenic
1057911935 9:99026138-99026160 GCAGGGAAGGTGCTGAGTTCAGG - Intronic
1057973505 9:99579708-99579730 TCAGAGAAGGCTCTTTGATGAGG + Intergenic
1059405245 9:114095173-114095195 GCAGGGAAGGTTGGGTCTTGAGG - Intronic
1059540537 9:115125940-115125962 TCTGGGAAGGTTCTGGGAGGAGG + Intergenic
1060309724 9:122448490-122448512 CCCGTGAAGGGTCTGTGATGAGG - Intergenic
1060749949 9:126162564-126162586 CCTGGGATGGTTCTGTGAGGAGG - Intergenic
1060931488 9:127492064-127492086 GCAGTGAAGGGTCTGGGATCTGG + Intronic
1061237464 9:129351300-129351322 GCAGGGAAGGTACTGGGAGTGGG + Intergenic
1061391835 9:130321038-130321060 TCAGAGAAGGTTCTGAAATGGGG - Intronic
1061485951 9:130920616-130920638 GAAGGGCAGGACCTGTGATGGGG + Intronic
1061552831 9:131347934-131347956 GCAGGGAGTCTTCAGTGATGTGG + Intergenic
1061834804 9:133321772-133321794 GAAGGGAAGGTTCTGACACGTGG - Intergenic
1062440988 9:136569153-136569175 GCTGGGGAGGTTCTCTGAAGAGG - Intergenic
1062694405 9:137865977-137865999 CCAGGGAGGCTTCTCTGATGAGG + Intronic
1185683394 X:1907347-1907369 GCAAGAAAGGGTCTTTGATGTGG + Intergenic
1186819576 X:13273217-13273239 GGAGGCAATGTTCTGTGATCTGG + Intergenic
1187215236 X:17269488-17269510 GCAGGGAAAATTCAGTGCTGGGG - Intergenic
1188309344 X:28597826-28597848 GAAGGCAAGATTCTGTAATGGGG + Intronic
1188617768 X:32179738-32179760 ACGGGGATGGTTCTGTGCTGAGG + Intronic
1189865561 X:45323587-45323609 GCAGGGAAGGTTCAGTAAATAGG + Intergenic
1190876641 X:54464927-54464949 GCTGTGGAGATTCTGTGATGTGG + Intronic
1191018486 X:55835772-55835794 CCAGTGAAGGGTCTGTGCTGAGG - Intergenic
1195316554 X:103685185-103685207 TCAGGGAAGGTTCTGCAATCAGG + Exonic
1196716748 X:118819418-118819440 GCTGGGAAGGGTGTGTGTTGTGG - Intergenic
1196765630 X:119239718-119239740 ACAGTGAAGGTTATGTAATGTGG + Intronic