ID: 904948148

View in Genome Browser
Species Human (GRCh38)
Location 1:34214382-34214404
Sequence TGATGTGCATAAATCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904948148_904948152 12 Left 904948148 1:34214382-34214404 CCAGGGAAGATTTATGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904948152 1:34214417-34214439 GGGCTGGAAGTAAGAGAAAGAGG 0: 1
1: 1
2: 4
3: 62
4: 627
904948148_904948157 29 Left 904948148 1:34214382-34214404 CCAGGGAAGATTTATGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904948157 1:34214434-34214456 AAGAGGAAGCAGGATAGGGTGGG 0: 1
1: 0
2: 6
3: 81
4: 629
904948148_904948153 19 Left 904948148 1:34214382-34214404 CCAGGGAAGATTTATGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904948153 1:34214424-34214446 AAGTAAGAGAAAGAGGAAGCAGG 0: 1
1: 1
2: 14
3: 164
4: 1744
904948148_904948150 -8 Left 904948148 1:34214382-34214404 CCAGGGAAGATTTATGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904948150 1:34214397-34214419 GCACATCAGAGTGAATTGATGGG 0: 1
1: 0
2: 0
3: 12
4: 94
904948148_904948151 -4 Left 904948148 1:34214382-34214404 CCAGGGAAGATTTATGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904948151 1:34214401-34214423 ATCAGAGTGAATTGATGGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 530
904948148_904948149 -9 Left 904948148 1:34214382-34214404 CCAGGGAAGATTTATGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904948149 1:34214396-34214418 TGCACATCAGAGTGAATTGATGG 0: 1
1: 0
2: 0
3: 17
4: 149
904948148_904948155 25 Left 904948148 1:34214382-34214404 CCAGGGAAGATTTATGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904948155 1:34214430-34214452 GAGAAAGAGGAAGCAGGATAGGG 0: 1
1: 1
2: 14
3: 205
4: 1610
904948148_904948154 24 Left 904948148 1:34214382-34214404 CCAGGGAAGATTTATGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904948154 1:34214429-34214451 AGAGAAAGAGGAAGCAGGATAGG 0: 1
1: 0
2: 18
3: 218
4: 1841
904948148_904948156 28 Left 904948148 1:34214382-34214404 CCAGGGAAGATTTATGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904948156 1:34214433-34214455 AAAGAGGAAGCAGGATAGGGTGG 0: 1
1: 0
2: 9
3: 117
4: 1325
904948148_904948158 30 Left 904948148 1:34214382-34214404 CCAGGGAAGATTTATGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904948158 1:34214435-34214457 AGAGGAAGCAGGATAGGGTGGGG 0: 1
1: 1
2: 7
3: 95
4: 1057

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904948148 Original CRISPR TGATGTGCATAAATCTTCCC TGG (reversed) Intronic
900812739 1:4820324-4820346 TGATGAGAGTTAATCTTCCCTGG - Intergenic
900890663 1:5447541-5447563 TTAAGGCCATAAATCTTCCCAGG + Intergenic
901971754 1:12913909-12913931 CGATGTGCATGAATCTGACCTGG + Intronic
902013414 1:13287831-13287853 CGATGTGCATGAATCTGACCTGG - Intergenic
904948148 1:34214382-34214404 TGATGTGCATAAATCTTCCCTGG - Intronic
907601197 1:55771859-55771881 TGATTTACATAGCTCTTCCCAGG + Intergenic
909784764 1:79597152-79597174 TGGTATGCATATATCATCCCTGG + Intergenic
911838891 1:102656813-102656835 TGATAGGAATTAATCTTCCCTGG - Intergenic
913055564 1:115155857-115155879 TGATGACAATAACTCTTCCCAGG - Intergenic
924297179 1:242599292-242599314 TGATCCCCATAAATCTTCCTGGG - Intergenic
1062981165 10:1724285-1724307 TGAGGTGCACAATTCTTGCCTGG + Intronic
1063908018 10:10800210-10800232 TGATGTGCAAAAAGCATCCGTGG - Intergenic
1065438714 10:25727489-25727511 TGATGAGTTTTAATCTTCCCTGG + Intergenic
1066646985 10:37620034-37620056 TTATGTGGACAAATCTACCCTGG - Intergenic
1067984935 10:51132643-51132665 TGATGTCCATAAATCATTCCTGG - Intronic
1068041664 10:51832947-51832969 TGATATGAATAAATCTTGCCTGG + Intronic
1068374234 10:56157117-56157139 TGATGTGTTTAAATCTACCCTGG - Intergenic
1072294360 10:93994614-93994636 TGATGTACACAAATCTCTCCAGG - Intronic
1073031181 10:100527299-100527321 TAATGTACATAAGCCTTCCCTGG + Intronic
1074125142 10:110522896-110522918 TTATGTTCATATATCTTCTCTGG + Intergenic
1074277751 10:112020887-112020909 TGATTTGCATACATCTTTCCAGG - Intergenic
1074306279 10:112281481-112281503 TGAAGTGCATGCATCTTCCCAGG + Intergenic
1075161072 10:120024982-120025004 TCATGGCCATAAAACTTCCCTGG - Intergenic
1076578111 10:131484345-131484367 TGAGTTGCATAAATCCTCTCTGG - Intergenic
1088006892 11:104952089-104952111 ATATGTGAAGAAATCTTCCCAGG - Intronic
1088910565 11:114188099-114188121 TAATGTGCTTAAATCATCCCAGG + Intronic
1091819399 12:3463860-3463882 GGATGTGCATCAACCCTCCCAGG - Intronic
1096333748 12:50737286-50737308 TTGGGTGCCTAAATCTTCCCTGG - Intronic
1097284917 12:57869775-57869797 AGATGTGAATAAAGCTTCCAGGG + Intergenic
1098065165 12:66606878-66606900 TTATGTGCCTAAATTTACCCTGG + Intronic
1098613964 12:72499383-72499405 TGATGTTCATCAGTCTTCCAAGG - Intronic
1099604757 12:84789498-84789520 TGATGGGCTTACATCTTCCATGG - Intergenic
1102364116 12:112316630-112316652 TGATGTACAGGAATCTTGCCCGG - Intronic
1102964923 12:117118678-117118700 TGATGTGCATAACATTCCCCTGG + Intergenic
1105310142 13:19199328-19199350 TGATATTCAAAAATCTTCCTTGG + Intergenic
1105359889 13:19700871-19700893 TGATATTCAAAAATCTTCCTTGG + Intronic
1108116424 13:47133659-47133681 TGATATGCATTAAAATTCCCCGG + Intergenic
1109244024 13:59930696-59930718 TCATGTGCTTAAATCTTCAGTGG - Intronic
1110485912 13:76041839-76041861 TGAAGTGCAGAAAACTCCCCAGG + Intergenic
1110649772 13:77929774-77929796 TGATTTGCATAAGGCTTCTCAGG - Intergenic
1112596426 13:100811969-100811991 TGATCTTCATAAATATGCCCAGG + Intergenic
1116044392 14:39726063-39726085 TGCTCTTCATAAATCTTCCAGGG + Intergenic
1119428049 14:74548621-74548643 AGATGTGCATCAAACTGCCCAGG - Intronic
1119464518 14:74844997-74845019 TTATTTTCAAAAATCTTCCCTGG + Intronic
1119641266 14:76316777-76316799 ATATGTGCACAAATCTTCCCAGG + Intronic
1120319292 14:82938898-82938920 TGATGTGTATTAATCTTGCATGG - Intergenic
1120746552 14:88157650-88157672 AGATGTAAATATATCTTCCCAGG - Intergenic
1121859763 14:97306321-97306343 TCATGAGCAAAAAGCTTCCCAGG + Intergenic
1125007721 15:34837008-34837030 TGCTGTGATTAAATCTTGCCTGG - Intergenic
1125191909 15:37003316-37003338 TGATATGAATAAGTCTTCCAGGG + Intronic
1128873593 15:71183732-71183754 TGATGTGGATAAATCAGGCCTGG - Intronic
1130750423 15:86705722-86705744 TGATGTGCATGCATTTTCACTGG + Intronic
1131137277 15:89947280-89947302 TCATGGCCATAAAACTTCCCTGG + Intergenic
1140650149 16:77079349-77079371 TGATTTGCTTAAATCTTCCTGGG + Intergenic
1140889474 16:79272614-79272636 TGAAGGTCATAACTCTTCCCAGG - Intergenic
1141362038 16:83404671-83404693 CTATGTGCCTAAATCTTCCTCGG + Intronic
1142662050 17:1437478-1437500 TGATGGGCATCTTTCTTCCCAGG - Intronic
1145862019 17:28218859-28218881 GGATGTGCACAGAGCTTCCCGGG + Intergenic
1146689666 17:34864789-34864811 TCAGCTGCATAAATCATCCCGGG + Intergenic
1148710349 17:49676310-49676332 TGGGGTGCATATATCTTCCTGGG - Intronic
1149882106 17:60302721-60302743 TAATGTGCGTAAGTTTTCCCAGG - Intronic
1154405043 18:14083215-14083237 TGATGTGCACCAGTATTCCCAGG + Intronic
1155751809 18:29433392-29433414 TGATATACATCAATTTTCCCTGG - Intergenic
1158727588 18:59987616-59987638 TGATGTGCAGATACCTTTCCTGG - Intergenic
1160123373 18:76149446-76149468 GGATTTGCATATGTCTTCCCAGG - Intergenic
1160123507 18:76150845-76150867 AGATTTGCATATGTCTTCCCAGG + Intergenic
1167790419 19:51674777-51674799 TGATGTCAATATATCTACCCAGG + Intergenic
926953032 2:18264682-18264704 GAATGTGCATAAATTTTCCTTGG - Intronic
928082068 2:28320472-28320494 TGATGTGCACAGATGTTTCCAGG - Intronic
930435798 2:51340800-51340822 AGATATGCATTAATCTTGCCTGG - Intergenic
930609447 2:53524866-53524888 TAATGTGCAGAAAACCTCCCAGG + Intergenic
931903767 2:66820857-66820879 TGATGTGCATGATCCTCCCCTGG + Intergenic
932421091 2:71601834-71601856 GGATGTGCATTAAGATTCCCTGG - Intronic
938969050 2:136415345-136415367 TGATCTGGCTAATTCTTCCCTGG + Intergenic
940020331 2:149149595-149149617 TCTTGTGCAGAAGTCTTCCCTGG - Intronic
941123178 2:161554852-161554874 TGGAGTGCAAAAATCATCCCGGG - Intronic
941832382 2:169976786-169976808 AGATGTCCATATTTCTTCCCAGG + Intronic
944074909 2:195718788-195718810 TGATGTTCAAAAATGTTACCTGG + Intronic
944851248 2:203721704-203721726 TGATCTGCACAAAACTTCCGGGG - Intronic
947969869 2:234313909-234313931 TGATTTGCAAAAATATTGCCTGG + Intergenic
1168940011 20:1701537-1701559 TGATGGCCATACATCTCCCCAGG + Intergenic
1173240591 20:41293285-41293307 TGATGTGCATACAAATTACCTGG - Intronic
1175126122 20:56752756-56752778 TGATTTGCTTAAATATTCACTGG + Intergenic
1182192051 22:28471690-28471712 TGATTTGAATTAATCTTCCTAGG + Intronic
949500532 3:4676456-4676478 TGATGTGCATTTACCTTTCCAGG + Intronic
952759469 3:36901300-36901322 TCATGGCCATAAAACTTCCCTGG - Intronic
955420923 3:58736708-58736730 TTATATGCTTAAATCTTGCCAGG + Intronic
955676895 3:61458300-61458322 TGGTGTGCATAAGTCTTACTTGG + Intergenic
957041557 3:75339678-75339700 TGAGGTGCTTAAAACTTCCTAGG - Intergenic
957273680 3:78063151-78063173 TCATGAACAAAAATCTTCCCAGG + Intergenic
957378900 3:79398672-79398694 TGCAGTACATAAAGCTTCCCTGG + Intronic
957988940 3:87607040-87607062 TGATCTGAGTTAATCTTCCCTGG + Intergenic
959417055 3:106088168-106088190 TTATGGGCATAAATATTTCCCGG - Intergenic
960464412 3:117979185-117979207 TGATGAGCACAAAGCTCCCCAGG + Intergenic
963389573 3:144642394-144642416 AAATTTCCATAAATCTTCCCAGG + Intergenic
965788494 3:172362078-172362100 AGATGTGCAAAAATCTTAGCTGG - Intronic
970123297 4:12781548-12781570 TGAAGTGCATAAATTTTATCAGG + Intergenic
971600945 4:28591458-28591480 TCATGTGGATATATCTTCCTCGG + Intergenic
972072578 4:35039068-35039090 TGATGTCCATAAAAATCCCCAGG + Intergenic
973608222 4:52608713-52608735 TGTTGTTCTTAAATCTTCCCGGG + Intronic
974691216 4:65299893-65299915 TTATGTGTTTAAATCTTCACTGG - Intergenic
976541644 4:86284376-86284398 TGAAGTGAATCAATTTTCCCAGG - Intronic
976565052 4:86543380-86543402 TGATGTCTAAAAATCCTCCCTGG + Intronic
980187186 4:129476688-129476710 TATTGTGCTTAAATCTTCACTGG + Intergenic
983091259 4:163505373-163505395 AGATGTGGATATATCTTCTCAGG + Intronic
987064065 5:14270471-14270493 TAATGTACATAAATCTTTGCTGG - Intronic
988167360 5:27611264-27611286 TGATGTCCAGAAATCTTCATTGG + Intergenic
992128604 5:73668044-73668066 TGGAGAGCATAAATCTTCTCAGG - Intronic
994895130 5:105693363-105693385 TCATGGCCATAAAACTTCCCTGG - Intergenic
997966667 5:138362354-138362376 TGATAGGAATTAATCTTCCCTGG - Intronic
1001430646 5:171659165-171659187 AGATGTGCACAAATGTTCCAAGG + Intergenic
1004315453 6:14582974-14582996 AAGAGTGCATAAATCTTCCCTGG - Intergenic
1004557980 6:16718321-16718343 TGTTTTGCCTAAATCTTGCCAGG + Intronic
1004761594 6:18672736-18672758 TGATGTGCAAAAATTTACCATGG + Intergenic
1006661039 6:35644847-35644869 TTGTGTGCATATATTTTCCCAGG - Intronic
1007331893 6:41117625-41117647 AGATATTCATATATCTTCCCTGG - Intergenic
1008120387 6:47609218-47609240 TGATGTGAAAAAAAATTCCCTGG + Exonic
1009564470 6:65294241-65294263 TGATCTGCCTAAACTTTCCCAGG - Intronic
1012295869 6:97522876-97522898 TAATGTTTATTAATCTTCCCTGG + Intergenic
1012572662 6:100749304-100749326 TAATATGCAAAAATATTCCCTGG + Intronic
1013583542 6:111559241-111559263 TGTTGTGCAGAGCTCTTCCCCGG - Exonic
1015216648 6:130757994-130758016 TCATGGCCATAAACCTTCCCTGG - Intergenic
1016077388 6:139813260-139813282 TAATTTGCATAAATATTGCCAGG - Intergenic
1021394389 7:20129534-20129556 TGATGTGGATAATTCTTGCAAGG - Intergenic
1021941602 7:25684700-25684722 TGTTGTGCATAAAACATCTCTGG + Intergenic
1022112681 7:27240980-27241002 CGATGTTCATTAATCTTGCCTGG - Intergenic
1024366194 7:48522797-48522819 AGCTGTTCATAAAGCTTCCCAGG + Intronic
1029931096 7:104371887-104371909 TGGTGTGAATAAATCTGCCAGGG - Intronic
1034093679 7:148387007-148387029 TCATGGCCATAAAACTTCCCTGG + Intronic
1044613552 8:94117338-94117360 TTATGTGGATATATCTTCACAGG + Intergenic
1045011054 8:97958686-97958708 AGAGGTGCTTAAATTTTCCCAGG + Intronic
1047599119 8:126408754-126408776 TGATATGCGTTAATCCTCCCGGG + Intergenic
1048644989 8:136410054-136410076 TGAAGTTCATAAAGCTTCCCTGG - Intergenic
1049563992 8:143328127-143328149 TGATTTGCAAAAATCTTTCATGG - Intronic
1050202327 9:3158768-3158790 TGATGTGCATAAATATTTTGAGG + Intergenic
1051145575 9:14023767-14023789 TGATGAGCCAAAATCTACCCAGG - Intergenic
1051462649 9:17339760-17339782 TCATGTGCATATATCTTCTGAGG + Intronic
1051835594 9:21334569-21334591 TGATGTGCATTAAGCTTCATGGG - Exonic
1052463505 9:28798635-28798657 TGATGAACATAAATCTAACCTGG + Intergenic
1054871336 9:70049560-70049582 AGATGAGCATAACTCGTCCCTGG - Intronic
1055334538 9:75219801-75219823 TGATGTGCTTATGTCTTCCATGG + Intergenic
1060672833 9:125485417-125485439 TGGTGCTCAAAAATCTTCCCTGG + Intronic
1185976159 X:4722861-4722883 TAAAATGCATAATTCTTCCCTGG - Intergenic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1190022017 X:46887315-46887337 TGATGTTCTTAAAGCTTCCTAGG - Intergenic
1200803914 Y:7412669-7412691 TGATGTGGATAAATTTTCTTAGG - Intergenic