ID: 904948960

View in Genome Browser
Species Human (GRCh38)
Location 1:34220583-34220605
Sequence CACATGGAAATGCCTGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904948958_904948960 -1 Left 904948958 1:34220561-34220583 CCTTAGCAGAACAGAGGAAGATC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 904948960 1:34220583-34220605 CACATGGAAATGCCTGCCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904948960 Original CRISPR CACATGGAAATGCCTGCCAA AGG Intergenic
901415005 1:9110602-9110624 CACAAGCAAACGCCTGCAAAAGG - Intronic
902155457 1:14482007-14482029 GACATGGTAATGCTTCCCAAAGG + Intergenic
904948960 1:34220583-34220605 CACATGGAAATGCCTGCCAAAGG + Intergenic
907249964 1:53131479-53131501 CAGACAGAACTGCCTGCCAAGGG + Intronic
907674095 1:56502894-56502916 CACATGGGAATGCATGCAAAAGG - Intronic
907763499 1:57385889-57385911 CACATTTAAATACCTTCCAAGGG - Intronic
910007589 1:82417588-82417610 CAAATGGAAAAGCTTCCCAAGGG + Intergenic
910965553 1:92804647-92804669 AACATGGAAATGTCAACCAAAGG + Intergenic
913200168 1:116489520-116489542 CACATGGGACTGCTTGCCAGGGG + Intergenic
913318204 1:117570489-117570511 GAAATGGAAATGACTGCTAATGG + Intergenic
916943734 1:169702935-169702957 CCCATTGAAATGCCTGTAAAAGG - Intronic
917087091 1:171314709-171314731 GAGATGGAAATGCCAGCCATTGG + Intronic
917234491 1:172876098-172876120 CACAAGGAGATGTCTGTCAAAGG - Intergenic
917746325 1:178011609-178011631 CACCTGGAAATGACTGACAGGGG - Intergenic
921279025 1:213547339-213547361 TACCTAGAAATGCCTGCCACAGG + Intergenic
922062015 1:222101761-222101783 CACATAGATATGACTGCCTATGG - Intergenic
923453289 1:234140096-234140118 AACATGGATATGCCGGACAAAGG + Intronic
923602818 1:235418549-235418571 CACATGTAAAAGCCTCCCTAAGG - Intronic
923873570 1:238022447-238022469 CACTTGGAAAAGCCTTCCACAGG - Intergenic
924906434 1:248458020-248458042 CACATAGAACTGCATGTCAAGGG + Intergenic
924921452 1:248634018-248634040 CACATAGAACTGCATGTCAAGGG - Intergenic
1065855936 10:29830094-29830116 CACATGGAAATGGCACACAAAGG + Intergenic
1065896246 10:30165394-30165416 TACGTGGTAATGCCTGCAAAAGG - Intergenic
1065898379 10:30184023-30184045 CACATGGAAATGCCAGCTGATGG - Intergenic
1070219827 10:74429097-74429119 TACATTGAAATGATTGCCAATGG + Intronic
1070775313 10:79106415-79106437 CAATTGGTAATGCCTGCCATGGG + Intronic
1070918518 10:80169736-80169758 CACCTGAACATGCCTGCCAGAGG - Intronic
1071371691 10:84957865-84957887 CACATGGTAATCCCTCCTAAAGG + Intergenic
1075380859 10:122017417-122017439 CACAGGGAAAGCCCTGGCAAAGG - Intronic
1076154026 10:128188971-128188993 CACATGGAAATACCTGGGCAGGG + Intergenic
1078468428 11:11567998-11568020 CACGTGGCAATGCCTGGCAGTGG - Intronic
1079183986 11:18220414-18220436 CCCAAGGTCATGCCTGCCAAGGG + Intronic
1079943030 11:26705568-26705590 GACATTAAAATACCTGCCAAAGG + Intronic
1080210069 11:29775706-29775728 CACATTGAAAATCCTGCCCATGG - Intergenic
1080229612 11:30004700-30004722 CACATGCATTTGCCTGCTAATGG + Intergenic
1080653837 11:34243070-34243092 CAGGAGGAAATGCCTGCCAGTGG + Intronic
1080975973 11:37340952-37340974 GACAAGGAAATTCCTGGCAAAGG - Intergenic
1081595336 11:44454867-44454889 CAGACAGAAATGCCTGGCAAAGG - Intergenic
1083345100 11:61983996-61984018 GCCATGGAAGAGCCTGCCAATGG + Intergenic
1087718234 11:101633002-101633024 CGCAAGGAATGGCCTGCCAAGGG + Intronic
1088722773 11:112609042-112609064 ACCATGGAGATGCCTGCAAAGGG + Intergenic
1089375581 11:117992107-117992129 GATATGGAAATGCCCACCAATGG - Intronic
1091430781 12:432459-432481 CACATGGAGATACTGGCCAAAGG - Intronic
1092769698 12:11885347-11885369 CACATGGAAGTGTCTGTCAGTGG - Intronic
1095048979 12:37540848-37540870 CATTTTGAAATGCCTGCCAGAGG - Intergenic
1101200516 12:102430833-102430855 CTGAGGGAAATGACTGCCAAAGG - Intronic
1102767931 12:115449803-115449825 CACATGGAAATGCAAGCCCAGGG - Intergenic
1105251637 13:18703972-18703994 CACATGGACACGCGTGACAAAGG + Intergenic
1105740096 13:23315089-23315111 CACCTGTAAGGGCCTGCCAAAGG - Intronic
1107418459 13:40223043-40223065 CAGATGGAAATGAATGCAAAAGG - Intergenic
1108968466 13:56341862-56341884 CACAAGGAAAGAGCTGCCAAAGG - Intergenic
1111050053 13:82871079-82871101 GACATGGAAATGCCCATCAATGG - Intergenic
1113157626 13:107342105-107342127 CACATGCCAATGTCTGCCAATGG + Intronic
1113870627 13:113557688-113557710 CACAGGCAAATGCCTGACTAGGG - Intergenic
1118836689 14:69483331-69483353 CACATCCAAATGCCTGCAGAGGG + Intergenic
1118878691 14:69808069-69808091 CCCTTGGAAGTGCCTGCCACTGG + Intergenic
1119817445 14:77582686-77582708 GAGATGGAAATGCCTGACCATGG - Intronic
1120019106 14:79508170-79508192 CTCATGCATATGGCTGCCAACGG + Intronic
1120847448 14:89138901-89138923 CACATTGCAATACCTGCCAAAGG - Intronic
1124566980 15:30825002-30825024 CACCTGGAGATCACTGCCAAGGG - Intergenic
1125358459 15:38840958-38840980 CACTAGGAAGTGCCTGACAATGG - Intergenic
1125472569 15:40019265-40019287 CCCATGTAAATGACTGCAAAAGG - Intronic
1129187876 15:73921556-73921578 GAAATAGAAATGCCTCCCAAAGG + Intergenic
1130117242 15:81015778-81015800 CACATGCAAAAGCTTGCCATGGG + Intronic
1130285639 15:82552242-82552264 CACATGCGCATGCCTGCCCATGG - Intronic
1131442229 15:92467719-92467741 CACATGGACATGCCTTACACTGG + Exonic
1131726557 15:95232427-95232449 AACATGAAAATGCCTGGCAAGGG + Intergenic
1131798658 15:96046842-96046864 CACAAGGAAATACCTCCAAAAGG + Intergenic
1134311934 16:13083007-13083029 CACATGGCAGTGGCTGCTAATGG - Intronic
1134355657 16:13479815-13479837 CACATGGGAATCCCTGACAAAGG - Intergenic
1135305166 16:21361743-21361765 CTCATAGAAATCACTGCCAATGG + Intergenic
1136301910 16:29340908-29340930 CTCATAGAAATCACTGCCAATGG + Intergenic
1139959275 16:70708414-70708436 CACATGGAACTGCAGGCCAAGGG + Intronic
1140881224 16:79199842-79199864 CTCTTAGAAATGCCTGGCAAAGG - Intronic
1141911962 16:87066480-87066502 CCCATGGAAATGGCTGCTCAGGG + Intergenic
1142588269 17:987888-987910 CCCATGTAAATGCTCGCCAAAGG - Intergenic
1145064871 17:19755555-19755577 CACATGCTAAGGCCTGCCAGTGG + Intergenic
1145378865 17:22376202-22376224 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145379341 17:22378572-22378594 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145379819 17:22380942-22380964 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145380299 17:22383317-22383339 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145380778 17:22385664-22385686 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145381257 17:22388039-22388061 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145381990 17:22391814-22391836 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145382465 17:22394178-22394200 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145383319 17:22398364-22398386 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145383687 17:22400099-22400121 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145383832 17:22400832-22400854 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145384270 17:22403034-22403056 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145384589 17:22404496-22404518 CATGTTGAAATGCCTGCCAGAGG - Intergenic
1145385373 17:22408567-22408589 CATTTTGAAATGCCTGCCAGAGG - Intergenic
1148246424 17:46033778-46033800 CATATGGAAATGCATACCCAGGG + Intronic
1149218404 17:54386487-54386509 CTCATGTAACTGCCTACCAAGGG - Intergenic
1149433636 17:56615396-56615418 CACTTGAAAATGCTTCCCAAAGG - Intergenic
1159684308 18:71398577-71398599 CACATGGGCATACCTGACAAAGG + Intergenic
1160149268 18:76386925-76386947 CACAGGAAAAAACCTGCCAAGGG + Intronic
1160348790 18:78156219-78156241 CACAAGGAAAGGACTGACAATGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1164285099 19:23807765-23807787 CAAATGGAAAATTCTGCCAATGG + Intronic
1164621522 19:29698283-29698305 CCTATGGAACTGCCTGCCCAGGG - Intergenic
1164628716 19:29746877-29746899 CACATCTAGCTGCCTGCCAAAGG - Intergenic
1166341477 19:42140097-42140119 CACATGGCAGTGGATGCCAAGGG - Intronic
1168030782 19:53677956-53677978 AACATGGAGATGTCAGCCAAGGG - Intergenic
1168031533 19:53683481-53683503 AACATGGAGATGTCAGCCAAGGG - Intergenic
1168466153 19:56603202-56603224 AAAATGGAAATGAGTGCCAATGG - Intronic
933632683 2:84674838-84674860 CACATGGAAATGCCTCTCCCTGG + Intronic
933694896 2:85210351-85210373 CTAGTGGAGATGCCTGCCAAGGG - Intronic
934565893 2:95340872-95340894 CACATGGAAAGTCCAGCCAGAGG - Intronic
935193909 2:100799751-100799773 CAAATGGAAATGCCAGTCCAGGG + Intergenic
935985131 2:108665152-108665174 CACAGGGAAATGTCTGAGAAAGG + Intronic
936137567 2:109908796-109908818 CACAGGGAAATGTCTGAGAAAGG + Intergenic
936207130 2:110462689-110462711 CACAGGGAAATGTCTGAGAAAGG - Intronic
940847406 2:158656717-158656739 CACATGGACAGGCCTGGGAAGGG + Intronic
942322802 2:174750728-174750750 CTAATGGAAATGCTTGCCACTGG - Intronic
943361301 2:186922450-186922472 CACATGAAAATTCCTGTCCAGGG + Intergenic
946495379 2:220191260-220191282 CACAGGGAACTGCTTGCCACAGG - Intergenic
946672630 2:222122437-222122459 CACTTGGTAATGCCTCCCATGGG + Intergenic
947076701 2:226352801-226352823 CACAGTGACATGCCTGCCACTGG + Intergenic
947962861 2:234254232-234254254 CACATGGGAATGCATGCAGAGGG - Intergenic
948305813 2:236945973-236945995 CACATGGATAAGACTGCCCAGGG - Intergenic
948396081 2:237646308-237646330 CACAGGTAAATGTGTGCCAAGGG + Intronic
948398331 2:237663817-237663839 CACAGGGAAAGGTCTGGCAAAGG + Intronic
948600189 2:239103556-239103578 CACATGGAAATGGCTCTCAGAGG + Intronic
1171524638 20:25799332-25799354 CATTTTGAAATGCCTGCCAGAGG + Intronic
1171543520 20:25984350-25984372 CATTTTGAAATGCCTGCCAGAGG - Intergenic
1171552189 20:26056551-26056573 CATTTTGAAATGCCTGCCAGAGG - Intergenic
1171793307 20:29547843-29547865 CATTTTGAAATGCCTGCCAGAGG - Intergenic
1171846554 20:30280960-30280982 CATTTTGAAATGCCTGCCAGAGG - Intergenic
1171855147 20:30336536-30336558 CATTTTGAAATGCCTGCCAGAGG + Intergenic
1172392027 20:34572035-34572057 AGCTTGGAAATACCTGCCAAAGG + Intronic
1173681176 20:44883391-44883413 CACCTAGGAATGCCTGACAAAGG + Intergenic
1174096423 20:48092963-48092985 CACATGGAAATGAGCCCCAAAGG + Intergenic
1176837164 21:13803859-13803881 CACATGGACATGCGTGACAAAGG + Intergenic
1178921208 21:36739716-36739738 CACATGAAAATGCCTCTCACTGG + Intronic
1183084372 22:35477536-35477558 GACATGGATCTACCTGCCAAGGG - Intergenic
1183695321 22:39418617-39418639 CACATGGAAATACCTGAAATGGG - Intronic
1184515972 22:44963018-44963040 CAGATGGCAATGTCTGCCCAGGG - Intronic
1184792398 22:46708091-46708113 CACTTCTAGATGCCTGCCAAGGG - Intronic
950191923 3:10982786-10982808 CACATGTAACTGCCTCCCAGAGG + Intergenic
950643518 3:14363554-14363576 GACATGGAAACACCTGCCCAAGG + Intergenic
950950416 3:16992698-16992720 CAGAAGGAAATTCCAGCCAAGGG + Intronic
950950670 3:16995099-16995121 CAGAAGGAAATTCCAGCCAAGGG + Intronic
956288577 3:67636930-67636952 CAGCTGGAAATGGCTGCCCAGGG + Intronic
956507637 3:69959651-69959673 CACCTGGAAATGCGTGCCATGGG - Intronic
957342434 3:78918019-78918041 CACATGGAAATGCCATGCAAAGG + Intronic
957574946 3:81995483-81995505 AACAGGGAAATGGCTGGCAAAGG - Intergenic
959423230 3:106153524-106153546 GAGGTGGAAATGCATGCCAAAGG - Intergenic
959511920 3:107223327-107223349 CACAACCAAATGCCTACCAATGG + Intergenic
959567398 3:107846568-107846590 CACATGGAAAAGCTAGCAAAGGG - Intergenic
962076234 3:132084742-132084764 CACCTGTAAATGCCTGAGAATGG - Intronic
962627718 3:137243226-137243248 CACATGAAAATGTTTACCAAAGG + Intergenic
965845022 3:172951573-172951595 CCCATGGATATCCCTGACAAGGG + Intronic
966382239 3:179355649-179355671 TCCATGGAAATGCCAGCCAGGGG + Intronic
967121463 3:186386092-186386114 CACATGGGAATGAAGGCCAATGG - Intergenic
967790154 3:193539768-193539790 CACATGAAAATGCTTAGCAATGG + Intronic
970215144 4:13751087-13751109 CACATGGATATGCTGGACAAAGG - Intergenic
971243608 4:24910154-24910176 CACATGGCAAGGCATGCCAGAGG - Intronic
971698553 4:29937419-29937441 CACATTCAAATGCCTGCCCGAGG + Intergenic
972603534 4:40593446-40593468 CACCTGTACATCCCTGCCAAGGG + Intronic
976058843 4:81102220-81102242 CACATGCAAATTGCTGCTAAAGG - Intronic
978962481 4:114699820-114699842 CACATGCAAATCCCTGTCACTGG - Intergenic
983590219 4:169401018-169401040 ACCATGGAAAAGCCTGCAAAAGG + Intronic
986267121 5:6200483-6200505 CCCATGGAAGAGCTTGCCAAAGG - Intergenic
986438663 5:7759460-7759482 CACAGGGGACTGCCAGCCAAGGG - Intronic
986621803 5:9683618-9683640 CAATTAGTAATGCCTGCCAAGGG - Intronic
987149355 5:15023141-15023163 CTCCTGTAAATGCCTACCAAAGG - Intergenic
989505058 5:42217469-42217491 CAGATGGAGATGGCTGCCAGCGG + Intergenic
991124485 5:63053996-63054018 CACTTTGAAATGCCTACCAGGGG - Intergenic
993531824 5:89034801-89034823 GAGATGGAAAGACCTGCCAAAGG - Intergenic
1000728453 5:164801603-164801625 CACAGGGACATAGCTGCCAAAGG - Intergenic
1001806271 5:174589454-174589476 CAGATGGAAATGGTTGCCAGAGG + Intergenic
1003179784 6:3781652-3781674 CCCATCGAAATGGCTCCCAAGGG + Intergenic
1006454797 6:34125608-34125630 CACAGGGAAGGGCCTGCCCAAGG + Intronic
1006923519 6:37641270-37641292 GCCATGGAAATGCCAGCCAACGG + Intronic
1007156053 6:39744889-39744911 CACATGGACATGACTGTCCATGG - Intergenic
1007399424 6:41595302-41595324 CACAGGCAGATGCCAGCCAACGG + Intronic
1010171019 6:72975555-72975577 CACATGAAAGTACCTGCCCAAGG - Intronic
1015941386 6:138455854-138455876 CACATAGAATTTCCTGCCCAAGG - Intronic
1017726649 6:157281007-157281029 CACAGGGAGGTGCCAGCCAAGGG - Intergenic
1021951867 7:25782933-25782955 CACATGGAAATGACTATGAATGG + Intergenic
1022708294 7:32827250-32827272 CCCATGGAAGTTCCTGCGAAGGG - Intergenic
1024326471 7:48113338-48113360 GACATGGAAAGGCCTACCACTGG - Intergenic
1025285116 7:57654397-57654419 CATTTTGAAATGCCTGCCCAAGG + Intergenic
1025300850 7:57818847-57818869 CATTTTGAAATGCCTGCCAGAGG - Intergenic
1026962335 7:74416818-74416840 GCCATGGAGATGCCTTCCAAAGG - Intergenic
1027566816 7:79805185-79805207 CATATGGAAAGTACTGCCAAAGG + Intergenic
1032505506 7:132431453-132431475 CACATTGACTTGCCTGACAAAGG - Intronic
1032799057 7:135303495-135303517 CTCCTGGAAATGACTGGCAAAGG + Intergenic
1033241551 7:139683697-139683719 GACATGCCATTGCCTGCCAATGG - Intronic
1033961585 7:146920055-146920077 CAGATAGAAAAGCCTGACAAGGG + Intronic
1034108874 7:148516910-148516932 CACATGTAAATGAATGCCTATGG - Intergenic
1035299558 7:157887981-157888003 CACATGGGAAGCTCTGCCAAGGG - Intronic
1035581621 8:743863-743885 CACATGCAAATACCAGCAAAAGG - Intergenic
1035910388 8:3559143-3559165 CTCATGGAAGTTCCTGCCACAGG - Intronic
1036116632 8:5966842-5966864 CACAAGGGAAAGCCTGGCAAGGG - Intergenic
1036476927 8:9102046-9102068 CCCACGGAAGTGCCGGCCAAGGG + Intronic
1036496182 8:9271938-9271960 CAGATGGGAAAGCCTTCCAAAGG - Intergenic
1036598839 8:10240498-10240520 CACATGATAATGCCAGCCAGAGG - Intronic
1037652425 8:20851000-20851022 CAGCTGCAAGTGCCTGCCAAGGG - Intergenic
1038939468 8:32287545-32287567 CACATGGAAAAGACTGACCATGG - Intronic
1039712192 8:40067204-40067226 CACATGGAAAGGACTACTAAGGG + Intergenic
1043346755 8:79307086-79307108 CACATGGACCAGCCTGCCACTGG + Intergenic
1043348479 8:79328958-79328980 CTCATTGAAATACTTGCCAATGG - Intergenic
1045931813 8:107635859-107635881 CAAAAGGAAATGCCTGTAAAGGG - Intergenic
1049016236 8:139921990-139922012 CACATGGAAATAAATGTCAAAGG + Intronic
1050392821 9:5164620-5164642 GAAATGGAAATGACTGCTAATGG - Intronic
1053292301 9:36889200-36889222 GACATGGAAGTGCCTGGCCAGGG - Intronic
1053792979 9:41699825-41699847 CATTTTGAAATGCCTGCCAGAGG + Intergenic
1054152198 9:61615000-61615022 CATTTTGAAATGCCTGCCAGAGG - Intergenic
1054161520 9:61674848-61674870 CATTTTGAAATGCCTGCCAGAGG + Intergenic
1054181390 9:61911846-61911868 CATTTTGAAATGCCTGCCAGAGG + Intergenic
1054471970 9:65546143-65546165 CATTTTGAAATGCCTGCCAGAGG - Intergenic
1058047644 9:100373724-100373746 CCCTTAGAAATGCCAGCCAATGG - Intergenic
1058265900 9:102898408-102898430 CACATGGAAAACCCATCCAAAGG + Intergenic
1060147663 9:121266720-121266742 CACATGGTAATGCCTCCCTTAGG + Intronic
1060284591 9:122237832-122237854 CACATGTAAATGCCTGGGCATGG + Exonic
1186307044 X:8273005-8273027 TACATGGAAATGCCTGAGCAGGG + Intergenic
1188508841 X:30912049-30912071 AAGATTGAAATGACTGCCAAAGG + Intronic
1194752941 X:97704900-97704922 CAAATAGAAATGCCTTCCAGAGG - Intergenic
1197169085 X:123411173-123411195 CCAAAGGAAATGTCTGCCAAAGG + Intronic
1198047773 X:132919766-132919788 CCCAGCGAAATGCCTCCCAATGG - Intronic
1199547929 X:149027691-149027713 GACATGGAAATTGCTGCCCAAGG - Intergenic
1200792548 Y:7312576-7312598 CACCTGGAACTGCCAGCAAAAGG - Intergenic