ID: 904949799

View in Genome Browser
Species Human (GRCh38)
Location 1:34227530-34227552
Sequence ATATACTTTTAAACCTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904949799_904949800 -10 Left 904949799 1:34227530-34227552 CCTTGAAAGGTTTAAAAGTATAT No data
Right 904949800 1:34227543-34227565 AAAAGTATATTAATTAGAACAGG No data
904949799_904949803 -2 Left 904949799 1:34227530-34227552 CCTTGAAAGGTTTAAAAGTATAT No data
Right 904949803 1:34227551-34227573 ATTAATTAGAACAGGTGGATGGG No data
904949799_904949801 -7 Left 904949799 1:34227530-34227552 CCTTGAAAGGTTTAAAAGTATAT No data
Right 904949801 1:34227546-34227568 AGTATATTAATTAGAACAGGTGG No data
904949799_904949805 23 Left 904949799 1:34227530-34227552 CCTTGAAAGGTTTAAAAGTATAT No data
Right 904949805 1:34227576-34227598 GGTCACTTTGTCCTCTCACGTGG No data
904949799_904949802 -3 Left 904949799 1:34227530-34227552 CCTTGAAAGGTTTAAAAGTATAT No data
Right 904949802 1:34227550-34227572 TATTAATTAGAACAGGTGGATGG No data
904949799_904949804 2 Left 904949799 1:34227530-34227552 CCTTGAAAGGTTTAAAAGTATAT No data
Right 904949804 1:34227555-34227577 ATTAGAACAGGTGGATGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904949799 Original CRISPR ATATACTTTTAAACCTTTCA AGG (reversed) Intergenic
No off target data available for this crispr