ID: 904949802 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:34227550-34227572 |
Sequence | TATTAATTAGAACAGGTGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904949799_904949802 | -3 | Left | 904949799 | 1:34227530-34227552 | CCTTGAAAGGTTTAAAAGTATAT | No data | ||
Right | 904949802 | 1:34227550-34227572 | TATTAATTAGAACAGGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904949802 | Original CRISPR | TATTAATTAGAACAGGTGGA TGG | Intergenic | ||
No off target data available for this crispr |