ID: 904949802

View in Genome Browser
Species Human (GRCh38)
Location 1:34227550-34227572
Sequence TATTAATTAGAACAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904949799_904949802 -3 Left 904949799 1:34227530-34227552 CCTTGAAAGGTTTAAAAGTATAT No data
Right 904949802 1:34227550-34227572 TATTAATTAGAACAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904949802 Original CRISPR TATTAATTAGAACAGGTGGA TGG Intergenic
No off target data available for this crispr