ID: 904950824

View in Genome Browser
Species Human (GRCh38)
Location 1:34237303-34237325
Sequence GGGAATGAATGCACAGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904950823_904950824 -10 Left 904950823 1:34237290-34237312 CCTGTTTGCACGTGGGAATGAAT No data
Right 904950824 1:34237303-34237325 GGGAATGAATGCACAGCTACAGG No data
904950821_904950824 -5 Left 904950821 1:34237285-34237307 CCGTCCCTGTTTGCACGTGGGAA No data
Right 904950824 1:34237303-34237325 GGGAATGAATGCACAGCTACAGG No data
904950822_904950824 -9 Left 904950822 1:34237289-34237311 CCCTGTTTGCACGTGGGAATGAA No data
Right 904950824 1:34237303-34237325 GGGAATGAATGCACAGCTACAGG No data
904950818_904950824 23 Left 904950818 1:34237257-34237279 CCTGCAGGAAACAAGGTTCGTCT No data
Right 904950824 1:34237303-34237325 GGGAATGAATGCACAGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904950824 Original CRISPR GGGAATGAATGCACAGCTAC AGG Intergenic
No off target data available for this crispr