ID: 904953170

View in Genome Browser
Species Human (GRCh38)
Location 1:34260791-34260813
Sequence AAGAAAAAGGAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904953162_904953170 26 Left 904953162 1:34260742-34260764 CCTGTGGGCTGGAAATGTGGACC No data
Right 904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG No data
904953165_904953170 5 Left 904953165 1:34260763-34260785 CCAAGTATCCTGAGTGACTGGGG No data
Right 904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG No data
904953167_904953170 -3 Left 904953167 1:34260771-34260793 CCTGAGTGACTGGGGAGAAGAAG No data
Right 904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904953170 Original CRISPR AAGAAAAAGGAGAAGGAGAA AGG Intergenic
No off target data available for this crispr