ID: 904954401

View in Genome Browser
Species Human (GRCh38)
Location 1:34270992-34271014
Sequence CACACCAACCACACTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904954401_904954403 1 Left 904954401 1:34270992-34271014 CCTCAAGGAGTGTGGTTGGTGTG No data
Right 904954403 1:34271016-34271038 TTATCGAAATGTCATATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904954401 Original CRISPR CACACCAACCACACTCCTTG AGG (reversed) Intergenic
No off target data available for this crispr