ID: 904954403

View in Genome Browser
Species Human (GRCh38)
Location 1:34271016-34271038
Sequence TTATCGAAATGTCATATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904954397_904954403 10 Left 904954397 1:34270983-34271005 CCAGGTCCTCCTCAAGGAGTGTG No data
Right 904954403 1:34271016-34271038 TTATCGAAATGTCATATGAAAGG No data
904954395_904954403 22 Left 904954395 1:34270971-34270993 CCAGAGCTGAGTCCAGGTCCTCC No data
Right 904954403 1:34271016-34271038 TTATCGAAATGTCATATGAAAGG No data
904954401_904954403 1 Left 904954401 1:34270992-34271014 CCTCAAGGAGTGTGGTTGGTGTG No data
Right 904954403 1:34271016-34271038 TTATCGAAATGTCATATGAAAGG No data
904954400_904954403 4 Left 904954400 1:34270989-34271011 CCTCCTCAAGGAGTGTGGTTGGT No data
Right 904954403 1:34271016-34271038 TTATCGAAATGTCATATGAAAGG No data
904954394_904954403 26 Left 904954394 1:34270967-34270989 CCAACCAGAGCTGAGTCCAGGTC No data
Right 904954403 1:34271016-34271038 TTATCGAAATGTCATATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904954403 Original CRISPR TTATCGAAATGTCATATGAA AGG Intergenic
No off target data available for this crispr