ID: 904955843

View in Genome Browser
Species Human (GRCh38)
Location 1:34283279-34283301
Sequence CAGCCACACTGGCCTTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904955838_904955843 -4 Left 904955838 1:34283260-34283282 CCTTTGACACATGCATCTCCAGC No data
Right 904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG No data
904955833_904955843 26 Left 904955833 1:34283230-34283252 CCCAAAGTTCTCCCCATGGTCGA No data
Right 904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG No data
904955835_904955843 15 Left 904955835 1:34283241-34283263 CCCCATGGTCGAGATGCATCCTT No data
Right 904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG No data
904955837_904955843 13 Left 904955837 1:34283243-34283265 CCATGGTCGAGATGCATCCTTTG No data
Right 904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG No data
904955834_904955843 25 Left 904955834 1:34283231-34283253 CCAAAGTTCTCCCCATGGTCGAG No data
Right 904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG No data
904955836_904955843 14 Left 904955836 1:34283242-34283264 CCCATGGTCGAGATGCATCCTTT No data
Right 904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904955843 Original CRISPR CAGCCACACTGGCCTTCTTG GGG Intergenic
No off target data available for this crispr