ID: 904957905

View in Genome Browser
Species Human (GRCh38)
Location 1:34302834-34302856
Sequence ATTGGCTTCTAATTGTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904957903_904957905 -4 Left 904957903 1:34302815-34302837 CCATAATTTCAGATGAGAAATTG No data
Right 904957905 1:34302834-34302856 ATTGGCTTCTAATTGTATTGAGG No data
904957902_904957905 7 Left 904957902 1:34302804-34302826 CCTTCTGGTCTCCATAATTTCAG No data
Right 904957905 1:34302834-34302856 ATTGGCTTCTAATTGTATTGAGG No data
904957901_904957905 18 Left 904957901 1:34302793-34302815 CCATCTCACTGCCTTCTGGTCTC No data
Right 904957905 1:34302834-34302856 ATTGGCTTCTAATTGTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904957905 Original CRISPR ATTGGCTTCTAATTGTATTG AGG Intergenic
No off target data available for this crispr