ID: 904958195

View in Genome Browser
Species Human (GRCh38)
Location 1:34306431-34306453
Sequence GAATGCACATAGGTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904958195_904958204 23 Left 904958195 1:34306431-34306453 CCTTCCTCAACCTATGTGCATTC No data
Right 904958204 1:34306477-34306499 CTGACAATGAACACACACATGGG No data
904958195_904958203 22 Left 904958195 1:34306431-34306453 CCTTCCTCAACCTATGTGCATTC No data
Right 904958203 1:34306476-34306498 TCTGACAATGAACACACACATGG No data
904958195_904958205 24 Left 904958195 1:34306431-34306453 CCTTCCTCAACCTATGTGCATTC No data
Right 904958205 1:34306478-34306500 TGACAATGAACACACACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904958195 Original CRISPR GAATGCACATAGGTTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr