ID: 904968132

View in Genome Browser
Species Human (GRCh38)
Location 1:34396220-34396242
Sequence TTGTTCCAGTCCAAGCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904968132_904968138 25 Left 904968132 1:34396220-34396242 CCTTTGAGCTTGGACTGGAACAA No data
Right 904968138 1:34396268-34396290 TAGCAGATTGTGGTATTTACTGG No data
904968132_904968137 15 Left 904968132 1:34396220-34396242 CCTTTGAGCTTGGACTGGAACAA No data
Right 904968137 1:34396258-34396280 AGACTGCAAATAGCAGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904968132 Original CRISPR TTGTTCCAGTCCAAGCTCAA AGG (reversed) Intergenic
No off target data available for this crispr