ID: 904968323

View in Genome Browser
Species Human (GRCh38)
Location 1:34398405-34398427
Sequence CTTTCTGCACATATAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904968321_904968323 -7 Left 904968321 1:34398389-34398411 CCAAAATGATGTCATCCTTTCTG No data
Right 904968323 1:34398405-34398427 CTTTCTGCACATATAAAGCCTGG No data
904968320_904968323 -6 Left 904968320 1:34398388-34398410 CCCAAAATGATGTCATCCTTTCT No data
Right 904968323 1:34398405-34398427 CTTTCTGCACATATAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904968323 Original CRISPR CTTTCTGCACATATAAAGCC TGG Intergenic
No off target data available for this crispr